Woods Biol Hmwk DNA & Genetic Engineering (key) Pg. 1

Size: px
Start display at page:

Download "Woods Biol Hmwk DNA & Genetic Engineering (key) Pg. 1"

Transcription

1 Woods Biol Hmwk DNA & Genetic Engineering (key) Pg. 1 NOTE: Unless otherwise indicated in the problem, DNA will be from the Template strand. Figure 1: Look carefully at Fig s 1 & 2 to determine the following questions. You should look at figures in the text to determine whether it represents DNA Replication, Transcription, or Translation. 4. Strand 3 in Figure 1 is A. a DNA non-template strand. B. a DNA template strand. C. a polypeptide. D. mrna. Figure 2: (STET should be ILE) 5. Figure 1 depicts A. protein synthesis. B. replication. C. translation. D. transcription. 6. represents the missing base sequence on strand 3 of Figure 1. A. TACGGT B. ATGCCA C. UACGGU D. AUGCCA 7. The process depicted in Figure 2 is most likely occurring A. within the nucleus. B. on the surface of the endoplasmic reticulum. C. inside Golgi bodies. D. on the surface of the cristae. 8. In Figure 2 the line connecting LEU and TYR represents A. a hydrogen bond. B. an ionic bond. C. a peptide bond. D. a polar attraction. 1. Which one of the following would NOT cause a mutation? A. substitution of adenine for guanine in a DNA molecule B. removing a portion of a DNA molecule C. destroying one of the kinds of trna D. all of the above would cause mutations 2. mrna leaves the nucleus containing the following base sequence: CAC GUA GUA CCC. Which are the correct complementary bases for translation to be completed? A. CAC GUA GUA CCC B. CAC GTA GTA CCC C. GUG CAU CAU GGG D. GTG CAT CAT GGG 3. Why is it difficult to get bacteria to express genes directly from eukaryotic DNA? A. Eukaryotic genes contain introns. B. Eukaryotic genes do not contain operons. C. Eukaryotic genes are transcribed into a single mrna. D. Eukaryotic genes contain exons. E. Eukaryotic genes may contain oncogenes. 9. The process depicted in Figure 2 is A. replication. B. translation. C. gene splicing. D. transcription. 10. AUG at the beginning of the strand in Figure 2 represents A. three DNA bases which code for one amino acid. B. three mrna bases which code for three amino acids. C. an anticodon. D. an initiator codon. 11. is about to occur between TYR and ARG in Figure 2. A. Dehydration synthesis B. Hydrolysis C. Hydrogen bonding D. Transcription 12. is the DNA template sequence corresponding to Fig 2. A. AUG CUA UAU GGU AUC CAG AUC B. ATG CTA TAT GGT ATC CAG ATC C. UAC GAU AUA CCA UAG GUC UAG D. TAC GAT ATA CCA TAG GTC TAG

2 Woods Biol Hmwk DNA & Genetic Engineering (key) Pg A permanent point mutation can occur in A. DNA. B. mrna. C. trna. D. amino acid. 14. The beginning triplet of a mrna strand to produce a specific protein is a(an) A. codon. B. initiator codon. C. terminator codon. D. anticodon. 15. Polymerase Chain Reaction (PCR) allows us A. to insert eukaryotic genes into prokaryotic plasmids. B. to incorporate genes into viruses. C. to make DNA from RNA transcripts. D. to make many identical copies of DNA. E. to insert regulatory sequences into eukaryotic genes. 16. DROP 17. In the mrna, AGU codes for serine (ser), GAG codes for glutamic acid (glu), GGG codes for glycine (gly) and UGG codes for tryptophan (trp). If a mrna sequence that was GGGGAGUGG and has mutated so it now reads GGGGA- GUGC, a new amino acid will replace A. glutamic acid. B. tryptophan. C. glycine. D. serine. 18. Which of the following contains the codon message for how a protein is to be assembled? A. DNA B. trna C. ribosome D. mrna 19. The backbone of a double helix is A. sugar-phosphate. B. hydrogen bonds. C. base-pairing. D. All of these answers are true. 20. Which of the following would demonstrate a single point mutation to the template DNA sequence: CAT GAT ATC? A. GUACUAUAG B. AUGCUAUAG C. GUAGUAUAG D. GUAAUCAUG 21. Below is a section of DNA template strand. represents the trna bases (anticodon) which correspond to this segment. GCCAATGCT A. CGGUUACGA B. CGGTTACGA C. GCCAATGCT D. GCCAAUGCU 22. If you discovered a bacterial cell that contained no restriction endonuclease (enzyme), which of the following would you expect to happen? A. The cell would be unable to replicate its DNA. B. The cell would create incomplete plasmids. C. The cell could be infected and lysed by a bacteriophage (virus). D. It would die because no nutrients could enter the cell. E. Both A and D would occur. 23. DROP 24. If a protein is supposed to be a sequence with two valine, three alanine, and four histidine (VVAAAHHHH) and instead is three valine, three alanine, and three histidine (VVVAAAHHH), what conclusions would likely be true? A. there has been a point mutation in the second codon. B. there has been a point mutation at the eighth base pair. C. there has been a point mutation in the eighth codon. D. both B & C. 25. For use in genetic engineering purposes, introns must often be removed from a gene. The genes are modified by A. using polymerase to transcribe the gene. B. using reverse transcriptase to reconstruct the gene from its mrna. C. using a restriction endonuclease to cut the gene into shorter pieces. D. using DNA polymerase to reconstruct the gene from its polypeptide product. E. using DNA ligase to put together fragments of the DNA that code for a particular polypeptide. 26. is(are) NOT DIRECTLY involved with transcription. A. Enzymes which unzip the DNA B. RNA polymerase C. Amino acids D. DNA 27. In a double helix, the phosphates are bonded to A. phosphates. B. ribose. C. deoxyribose. D. uracil.

3 Woods Biol Hmwk DNA & Genetic Engineering (key) Pg What are the segments of eukaryotic pre-mrna that are removed prior to the final production of mature mrna? A. introns B. promoters C. exons D. terminator 29. The Central Dogma of molecular genetics is a statement describing the flow of information in a cell: DNA makes RNA, which makes proteins. This path is not reversible. The exception to part of this statement seems to be A. retroviruses. B. T2 phage. C. herpesviruses. D. tumor viruses. E. all viruses. 30. A change of information from normal hemoglobin to sickle cell hemoglobin is a A. base deletion. B. base insertion. C. base substitution. D. frame shift. 31. DROP 32. If the non-template strand of DNA has an adenine (A) nucleotide, the mrna would have A. adenine. B. uracil. C. cytosine. D. guanine. 33. If the mrna codon for proline can be CCU, CCC, CCA, or CCG, a trna could be A. CCA. B. GGA. C. GGT. D. All of the above. 34. UUU encodes for phenylalanine (Phe), AGU encodes for serine (Ser), UGG encodes for tryptophan (Trp), and CGA encodes for arginine (Arg). The template DNA base sequence to encode for a protein trp-arg-ser would be A. ACCGCTTCA. B. TCCGCUUCA. C. UCCGCTTCU. D. UGGCGAAGU. 35. Genetic recombination involves the use of enzymes to cut out segments of DNA. A. restriction enzymes B. reverse transcriptase C. ligase D. DNA polymerase 36. If the sequence of bases in trna is UCA, the sequence of bases in the non-template strand of DNA is A. A, G, and U. B. A, G, and T. C. T, C, and A. D. U, C, and A. 37. If a drug interferes with the activities of 50S ribosomes, which one of the following is likely to occur? A. Prokaryotic DNA will NOT be able to make copies of DNA (replication). B. Proteins will NOT be produced in eukaryotes. C. Mutations will occur to the prokaryotic DNA. D. Proteins will NOT be produced in prokaryotes. 38. In a nucleotide the sugar is bonded to a(n) A. anticodon. B. codon. C. sugar and phosphate. D. base and phosphate. 39. is(are) NOT DIRECTLY involved with translation. A. DNA B. mrna C. trna D. Ribosomes 40. Use the following codons: UUU = phenylalanine, UAU = tyrosine, UGU = cystine, GUU = valine, GGU = glycine. If the third amino acid in a protein was valine, the template DNA sequence for that amino acid would be A. CAA. B. CTT. C. GTT. D. GUU. 41. A codon calls for the placement of an individual A. protein. B. rrna. C. amino acid. D. mrna. 42. Recombinant DNA is(are) A. new nuclei. B. DNA sequences that would not normally occur together. C. a disease. D. All of these answers are true.

4 Woods Biol Hmwk DNA & Genetic Engineering (key) Pg The prokaryotic operon for tryptophan synthesis makes a number of enzymes to produce tryptophan from a precursor. Operons such as this are A. permanently turned on. B. turned on only when tryptophan is present in the growth C. turned off only when lactose is present in the growth D. turned on only when lactose is present in the growth E. turned off whenever tryptophan is added to the growth 44. Which of the following is normally the correctly ordered sequence in transcription? A. A (DNA) U (mrna) B. C (mrna) G (trna) C. U (DNA) A (mrna) D. A (DNA) T (trna) 45. Bacteria containing recombinant plasmids are often identified by which process? A. examining the cells with an electron microscope B. using radioactive probes to locate the bacterial cell wall C. examining the cells with an optical microscope D. removing the DNA of all cells in a culture to see which cells have plasmids E. using radioactive probes to locate a segment of DNA 48. If a drug interferes with the function of 40S ribosomes which one of the following is most likely to occur? A. Prokaryotic DNA will NOT be able to make copies of DNA (replication). B. Proteins will NOT be produced in eukaryotes. C. Mutations will occur to the eukaryotic DNA. D. Proteins will NOT be produced in prokaryotes. 49. PCR could be used to amplify DNA from which of the following? A. a fetal cell B. a bacteria C. a virus D. Only B and C are correct. E. A, B, and C are correct. 50. Both a base and a phosphate are attached in a nucleotide. A. to each other B. to a sugar C. to each other and to a sugar D. None of these answers are true because phosphate is not part of a nucleotide 46. GAU on the structure below represents A. a codon. B. an anticodon. C. trna. D. an amino acid. 47. Base pairs are attracted to each other by A. ionic bonds. B. covalent bonds. C. hydrogen bonds. D. unzipping enzymes.

5 Woods Biol Hmwk DNA & Genetic Engineering (key) Pg. 5 Quest Answer 1 C 2 C 3 A 4 D 5 D 6 D 7 B 8 C 9 B 10 D 11 A 12 D 13 A 14 B 15 D 16 B 17 B 18 D 19 A 20 C 21 D 22 C 23 B 24 B 25 B 26 C 27 C 28 A 29 A 30 C 31 E 32 A 33 B 34 A 35 A 36 B 37 D 38 D 39 A 40 A 41 C 42 B 43 E 44 A 45 E 46 B 47 C 48 B 49 E 50 B

Section 1 Workbook (unit 2) ANSWERS

Section 1 Workbook (unit 2) ANSWERS Section 1 Workbook (unit 2) ANSWERS Complete the following table: nucleotide DNA RN Name: B5. Describe DNA replication 1) Label each base given in the diagram below and describe the 4 primary characteristics

More information

PRACTICE TEST QUESTIONS

PRACTICE TEST QUESTIONS PART A: MULTIPLE CHOICE QUESTIONS PRACTICE TEST QUESTIONS DNA & PROTEIN SYNTHESIS B 1. One of the functions of DNA is to A. secrete vacuoles. B. make copies of itself. C. join amino acids to each other.

More information

Provincial Exam Questions. 9. Give one role of each of the following nucleic acids in the production of an enzyme.

Provincial Exam Questions. 9. Give one role of each of the following nucleic acids in the production of an enzyme. Provincial Exam Questions Unit: Cell Biology: Protein Synthesis (B7 & B8) 2010 Jan 3. Describe the process of translation. (4 marks) 2009 Sample 8. What is the role of ribosomes in protein synthesis? A.

More information

Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein

Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein Assignment 3 Michele Owens Vocabulary Gene: A sequence of DNA that instructs a cell to produce a particular protein Promoter a control sequence near the start of a gene Coding sequence the sequence of

More information

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled Biology 101 Chapter 14 Name: Fill-in-the-Blanks Which base follows the next in a strand of DNA is referred to. as the base (1) Sequence. The region of DNA that calls for the assembly of specific amino

More information

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes

More information

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!! DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other

More information

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d. 13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both

More information

Structure and Function of DNA

Structure and Function of DNA Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four

More information

RNA and Protein Synthesis

RNA and Protein Synthesis RNA and Protein Synthesis Answer Key Vocabulary: amino acid, anticodon, codon, gene, messenger RNA, nucleotide, ribosome, RNA, RNA polymerase, transcription, transfer RNA, translation Prior Knowledge Questions

More information

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,

More information

DNA and Protein Synthesis Grade 10

DNA and Protein Synthesis Grade 10 Ohio Standards Connection: Life Sciences Benchmark C Explain the genetic mechanisms and molecular basis of inheritance. Indicator 5 Illustrate the relationship of the structure and function of DNA to protein

More information

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins

More information

Transcription and Translation of DNA

Transcription and Translation of DNA Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes

More information

Hands on Simulation of Mutation

Hands on Simulation of Mutation Hands on Simulation of Mutation Charlotte K. Omoto P.O. Box 644236 Washington State University Pullman, WA 99164-4236 omoto@wsu.edu ABSTRACT This exercise is a hands-on simulation of mutations and their

More information

Molecular Facts and Figures

Molecular Facts and Figures Nucleic Acids Molecular Facts and Figures DNA/RNA bases: DNA and RNA are composed of four bases each. In DNA the four are Adenine (A), Thymidine (T), Cytosine (C), and Guanine (G). In RNA the four are

More information

Molecular Genetics. RNA, Transcription, & Protein Synthesis

Molecular Genetics. RNA, Transcription, & Protein Synthesis Molecular Genetics RNA, Transcription, & Protein Synthesis Section 1 RNA AND TRANSCRIPTION Objectives Describe the primary functions of RNA Identify how RNA differs from DNA Describe the structure and

More information

Genetics Module B, Anchor 3

Genetics Module B, Anchor 3 Genetics Module B, Anchor 3 Key Concepts: - An individual s characteristics are determines by factors that are passed from one parental generation to the next. - During gamete formation, the alleles for

More information

From Gene to Protein Transcription and Translation i

From Gene to Protein Transcription and Translation i From Gene to Protein Transcription and Translation i How do the genes in our DNA influence our characteristics? For example, how can a gene determine whether a person is an albino with very pale skin and

More information

Gene Finding CMSC 423

Gene Finding CMSC 423 Gene Finding CMSC 423 Finding Signals in DNA We just have a long string of A, C, G, Ts. How can we find the signals encoded in it? Suppose you encountered a language you didn t know. How would you decipher

More information

Protein Synthesis. Page 41 Page 44 Page 47 Page 42 Page 45 Page 48 Page 43 Page 46 Page 49. Page 41. DNA RNA Protein. Vocabulary

Protein Synthesis. Page 41 Page 44 Page 47 Page 42 Page 45 Page 48 Page 43 Page 46 Page 49. Page 41. DNA RNA Protein. Vocabulary Protein Synthesis Vocabulary Transcription Translation Translocation Chromosomal mutation Deoxyribonucleic acid Frame shift mutation Gene expression Mutation Point mutation Page 41 Page 41 Page 44 Page

More information

13.2 Ribosomes & Protein Synthesis

13.2 Ribosomes & Protein Synthesis 13.2 Ribosomes & Protein Synthesis Introduction: *A specific sequence of bases in DNA carries the directions for forming a polypeptide, a chain of amino acids (there are 20 different types of amino acid).

More information

2006 7.012 Problem Set 3 KEY

2006 7.012 Problem Set 3 KEY 2006 7.012 Problem Set 3 KEY Due before 5 PM on FRIDAY, October 13, 2006. Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. Which reaction is catalyzed by each

More information

RNA and Protein Synthesis

RNA and Protein Synthesis Name lass Date RN and Protein Synthesis Information and Heredity Q: How does information fl ow from DN to RN to direct the synthesis of proteins? 13.1 What is RN? WHT I KNOW SMPLE NSWER: RN is a nucleic

More information

1. Which of the following correctly organizes genetic material from the broadest category to the most specific category?

1. Which of the following correctly organizes genetic material from the broadest category to the most specific category? DNA and Genetics 1. Which of the following correctly organizes genetic material from the broadest category to the most specific category? A. genome chromosome gene DNA molecule B. genome chromosome DNA

More information

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results

More information

Multiple Choice Write the letter that best answers the question or completes the statement on the line provided.

Multiple Choice Write the letter that best answers the question or completes the statement on the line provided. Name lass Date hapter 12 DN and RN hapter Test Multiple hoice Write the letter that best answers the question or completes the statement on the line provided. Pearson Education, Inc. ll rights reserved.

More information

DNA, RNA, Protein synthesis, and Mutations. Chapters 12-13.3

DNA, RNA, Protein synthesis, and Mutations. Chapters 12-13.3 DNA, RNA, Protein synthesis, and Mutations Chapters 12-13.3 1A)Identify the components of DNA and explain its role in heredity. DNA s Role in heredity: Contains the genetic information of a cell that can

More information

(http://genomes.urv.es/caical) TUTORIAL. (July 2006)

(http://genomes.urv.es/caical) TUTORIAL. (July 2006) (http://genomes.urv.es/caical) TUTORIAL (July 2006) CAIcal manual 2 Table of contents Introduction... 3 Required inputs... 5 SECTION A Calculation of parameters... 8 SECTION B CAI calculation for FASTA

More information

Ruth Sundeen. Lesson 9 Part 1. Help Your Students Learn. Greetings and felicitations from Mrs. Ruth!

Ruth Sundeen. Lesson 9 Part 1. Help Your Students Learn. Greetings and felicitations from Mrs. Ruth! Ruth Sundeen Lesson 9 Part 1 Help Your Students Learn Ages: Eighth grade to high school senior Topics: Protein Synthesis Enzymes Experiment to demonstrate fragility of enzymes Greetings and felicitations

More information

Ms. Campbell Protein Synthesis Practice Questions Regents L.E.

Ms. Campbell Protein Synthesis Practice Questions Regents L.E. Name Student # Ms. Campbell Protein Synthesis Practice Questions Regents L.E. 1. A sequence of three nitrogenous bases in a messenger-rna molecule is known as a 1) codon 2) gene 3) polypeptide 4) nucleotide

More information

Academic Nucleic Acids and Protein Synthesis Test

Academic Nucleic Acids and Protein Synthesis Test Academic Nucleic Acids and Protein Synthesis Test Multiple Choice Identify the letter of the choice that best completes the statement or answers the question. 1. Each organism has a unique combination

More information

CCR Biology - Chapter 8 Practice Test - Summer 2012

CCR Biology - Chapter 8 Practice Test - Summer 2012 Name: Class: Date: CCR Biology - Chapter 8 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. What did Hershey and Chase know

More information

To be able to describe polypeptide synthesis including transcription and splicing

To be able to describe polypeptide synthesis including transcription and splicing Thursday 8th March COPY LO: To be able to describe polypeptide synthesis including transcription and splicing Starter Explain the difference between transcription and translation BATS Describe and explain

More information

Mutation. Mutation provides raw material to evolution. Different kinds of mutations have different effects

Mutation. Mutation provides raw material to evolution. Different kinds of mutations have different effects Mutation Mutation provides raw material to evolution Different kinds of mutations have different effects Mutational Processes Point mutation single nucleotide changes coding changes (missense mutations)

More information

Lab #5: DNA, RNA & Protein Synthesis. Heredity & Human Affairs (Biology 1605) Spring 2012

Lab #5: DNA, RNA & Protein Synthesis. Heredity & Human Affairs (Biology 1605) Spring 2012 Lab #5: DNA, RNA & Protein Synthesis Heredity & Human Affairs (Biology 1605) Spring 2012 DNA Stands for : Deoxyribonucleic Acid Double-stranded helix Made up of nucleotides Each nucleotide= 1. 5-carbon

More information

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet 1 UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet Exam in: MBV4010 Arbeidsmetoder i molekylærbiologi og biokjemi I MBV4010 Methods in molecular biology and biochemistry I Day of exam:

More information

II. DNA Deoxyribonucleic Acid Located in the nucleus of the cell Codes for your genes

II. DNA Deoxyribonucleic Acid Located in the nucleus of the cell Codes for your genes HEREDITY = passing on of characteristics from parents to offspring How?...DNA! I. DNA, Chromosomes, Chromatin, and Genes DNA = blueprint of life (has the instructions for making an organism) Chromatin=

More information

Thymine = orange Adenine = dark green Guanine = purple Cytosine = yellow Uracil = brown

Thymine = orange Adenine = dark green Guanine = purple Cytosine = yellow Uracil = brown 1 DNA Coloring - Transcription & Translation Transcription RNA, Ribonucleic Acid is very similar to DNA. RNA normally exists as a single strand (and not the double stranded double helix of DNA). It contains

More information

Protein Synthesis How Genes Become Constituent Molecules

Protein Synthesis How Genes Become Constituent Molecules Protein Synthesis Protein Synthesis How Genes Become Constituent Molecules Mendel and The Idea of Gene What is a Chromosome? A chromosome is a molecule of DNA 50% 50% 1. True 2. False True False Protein

More information

3120-1 - Page 1. Name:

3120-1 - Page 1. Name: Name: 1) Which series is arranged in correct order according to decreasing size of structures? A) DNA, nucleus, chromosome, nucleotide, nitrogenous base B) chromosome, nucleus, nitrogenous base, nucleotide,

More information

DNA & Protein Synthesis Exam

DNA & Protein Synthesis Exam DNA & Protein Synthesis Exam DO NOT WRITE ON EXAM EXAM # VER. B Multiple choice Directions: Answer the following questions based on the following diagram. (1pt. each) 5. The above nucleotide is purine

More information

Lecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides

Lecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides Lecture Series 7 From DNA to Protein: Genotype to Phenotype Reading Assignments Read Chapter 7 From DNA to Protein A. Genes and the Synthesis of Polypeptides Genes are made up of DNA and are expressed

More information

ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes

ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes Page 1 of 22 Introduction Indiana students enrolled in Biology I participated in the ISTEP+: Biology I Graduation Examination

More information

Chapter 17: From Gene to Protein

Chapter 17: From Gene to Protein Name Period This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect to spend at least 6 hours to truly master

More information

RNA & Protein Synthesis

RNA & Protein Synthesis RNA & Protein Synthesis Genes send messages to cellular machinery RNA Plays a major role in process Process has three phases (Genetic) Transcription (Genetic) Translation Protein Synthesis RNA Synthesis

More information

From DNA to Protein

From DNA to Protein Nucleus Control center of the cell contains the genetic library encoded in the sequences of nucleotides in molecules of DNA code for the amino acid sequences of all proteins determines which specific proteins

More information

http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets

http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets by Louise Brown Jasko John Anthony Campbell Jack Dennis Cassidy Michael Nickelsburg Stephen Prentis Rohm Objectives: 1) Using plastic beads, construct

More information

Hiding Data in DNA. 1 Introduction

Hiding Data in DNA. 1 Introduction Hiding Data in DNA Boris Shimanovsky *, Jessica Feng +, and Miodrag Potkonjak + * XAP Corporation + Dept. Computer Science, Univ. of California, Los Angeles Abstract. Just like disk or RAM, DNA and RNA

More information

Unit 9: DNA, RNA, and Proteins. Pig and elephant DNA just don t splice, but why?

Unit 9: DNA, RNA, and Proteins. Pig and elephant DNA just don t splice, but why? Unit 9: DNA, RNA, and Proteins Pig and elephant DNA just don t splice, but why? BONUS - History of DNA Structure of DNA 3.3.1 - Outline DNA nucleotide structure in terms of sugar (deoxyribose), base and

More information

Chapter 20: Biotechnology: DNA Technology & Genomics

Chapter 20: Biotechnology: DNA Technology & Genomics Biotechnology Chapter 20: Biotechnology: DNA Technology & Genomics The BIG Questions How can we use our knowledge of DNA to: o Diagnose disease or defect? o Cure disease or defect? o Change/improve organisms?

More information

Honors Biology Practice Questions #1. Name. 6. Seastars have a diploid number of 24 chromosomes. The haploid number would be

Honors Biology Practice Questions #1. Name. 6. Seastars have a diploid number of 24 chromosomes. The haploid number would be Honors Biology Practice Questions #1 1. Donkeys have 68 chromosomes in each body cell. If a donkey cell undergoes meiosis, how many chromosomes should be in each gamete? A. 18 B. 34 C. 68 D. 132 2. A sperm

More information

AP Biology TEST #5 - Chapters 11-14, 16 - REVIEW SHEET

AP Biology TEST #5 - Chapters 11-14, 16 - REVIEW SHEET NAME: AP Biology TEST #5 - Chapters 11-14, 16 - REVIEW SHEET 1. Griffith's experiments showing the transformation of R strain pneumococcus bacteria to S strain pneumococcus bacteria in the presence of

More information

Transcription Study Guide

Transcription Study Guide Transcription Study Guide This study guide is a written version of the material you have seen presented in the transcription unit. The cell s DNA contains the instructions for carrying out the work of

More information

Translation Study Guide

Translation Study Guide Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to

More information

Modeling DNA Replication and Protein Synthesis

Modeling DNA Replication and Protein Synthesis Skills Practice Lab Modeling DNA Replication and Protein Synthesis OBJECTIVES Construct and analyze a model of DNA. Use a model to simulate the process of replication. Use a model to simulate the process

More information

The Steps. 1. Transcription. 2. Transferal. 3. Translation

The Steps. 1. Transcription. 2. Transferal. 3. Translation Protein Synthesis Protein synthesis is simply the "making of proteins." Although the term itself is easy to understand, the multiple steps that a cell in a plant or animal must go through are not. In order

More information

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet 1 UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet Exam in: MBV4010 Arbeidsmetoder i molekylærbiologi og biokjemi I MBV4010 Methods in molecular biology and biochemistry I Day of exam:.

More information

T C T G G C C G A C C T;

T C T G G C C G A C C T; 1. (a) Gene is a (length) of DNA; Gene is a sequence of bases/chain of nucleotides; Triplet (base) code/read in three s; On sense/coding strand; Triplet coding for amino acid; Degenerate code; non-overlapping;

More information

1 Mutation and Genetic Change

1 Mutation and Genetic Change CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds

More information

Module 3 Questions. 7. Chemotaxis is an example of signal transduction. Explain, with the use of diagrams.

Module 3 Questions. 7. Chemotaxis is an example of signal transduction. Explain, with the use of diagrams. Module 3 Questions Section 1. Essay and Short Answers. Use diagrams wherever possible 1. With the use of a diagram, provide an overview of the general regulation strategies available to a bacterial cell.

More information

Insulin mrna to Protein Kit

Insulin mrna to Protein Kit Insulin mrna to Protein Kit A 3DMD Paper BioInformatics and Mini-Toober Folding Activity Teacher Key and Teacher Notes www. Insulin mrna to Protein Kit Contents Becoming Familiar with the Data... 3 Identifying

More information

Microbial Genetics (Chapter 8) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College. Eastern Campus

Microbial Genetics (Chapter 8) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College. Eastern Campus Microbial Genetics (Chapter 8) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology An Introduction

More information

Cellular Respiration Worksheet 1. 1. What are the 3 phases of the cellular respiration process? Glycolysis, Krebs Cycle, Electron Transport Chain.

Cellular Respiration Worksheet 1. 1. What are the 3 phases of the cellular respiration process? Glycolysis, Krebs Cycle, Electron Transport Chain. Cellular Respiration Worksheet 1 1. What are the 3 phases of the cellular respiration process? Glycolysis, Krebs Cycle, Electron Transport Chain. 2. Where in the cell does the glycolysis part of cellular

More information

Shu-Ping Lin, Ph.D. E-mail: splin@dragon.nchu.edu.tw

Shu-Ping Lin, Ph.D. E-mail: splin@dragon.nchu.edu.tw Amino Acids & Proteins Shu-Ping Lin, Ph.D. Institute te of Biomedical Engineering ing E-mail: splin@dragon.nchu.edu.tw Website: http://web.nchu.edu.tw/pweb/users/splin/ edu tw/pweb/users/splin/ Date: 10.13.2010

More information

Bio 102 Practice Problems Recombinant DNA and Biotechnology

Bio 102 Practice Problems Recombinant DNA and Biotechnology Bio 102 Practice Problems Recombinant DNA and Biotechnology Multiple choice: Unless otherwise directed, circle the one best answer: 1. Which of the following DNA sequences could be the recognition site

More information

Bio 102 Practice Problems Genetic Code and Mutation

Bio 102 Practice Problems Genetic Code and Mutation Bio 102 Practice Problems Genetic Code and Mutation Multiple choice: Unless otherwise directed, circle the one best answer: 1. Beadle and Tatum mutagenized Neurospora to find strains that required arginine

More information

Gene Finding. Slides by Carl Kingsford

Gene Finding. Slides by Carl Kingsford Gene Finding Slides by Carl Kingsford Genome of the Cow a sequence of 2.86 billion letters enough letters to fill a million pages of a typical book. TATGGAGCCAGGTGCCTGGGGCAACAAGACTGTGGTCACTGAATTCATCCTTCTTGGTCTAACAGAGAACATAG

More information

Concluding lesson. Student manual. What kind of protein are you? (Basic)

Concluding lesson. Student manual. What kind of protein are you? (Basic) Concluding lesson Student manual What kind of protein are you? (Basic) Part 1 The hereditary material of an organism is stored in a coded way on the DNA. This code consists of four different nucleotides:

More information

Sample Questions for Exam 3

Sample Questions for Exam 3 Sample Questions for Exam 3 1. All of the following occur during prometaphase of mitosis in animal cells except a. the centrioles move toward opposite poles. b. the nucleolus can no longer be seen. c.

More information

UNIT (12) MOLECULES OF LIFE: NUCLEIC ACIDS

UNIT (12) MOLECULES OF LIFE: NUCLEIC ACIDS UIT (12) MLECULE F LIFE: UCLEIC ACID ucleic acids are extremely large molecules that were first isolated from the nuclei of cells. Two kinds of nucleic acids are found in cells: RA (ribonucleic acid) is

More information

DNA pol RNA pol ARS trna Ribosome DNA mrna Protein Transcription Translation Replication A B Acceptor stem D-loop T C loop Anticodon loop Variable loop Relative trna gene copy number 0.0 0.2 0.4

More information

The sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized:

The sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized: Module 3F Protein Synthesis So far in this unit, we have examined: How genes are transmitted from one generation to the next Where genes are located What genes are made of How genes are replicated How

More information

Bio 102 Practice Problems Genetic Code and Mutation

Bio 102 Practice Problems Genetic Code and Mutation Bio 102 Practice Problems Genetic Code and Mutation Multiple choice: Unless otherwise directed, circle the one best answer: 1. Choose the one best answer: Beadle and Tatum mutagenized Neurospora to find

More information

CHAPTER 4: CELLULAR METABOLISM. 2. Distinguish between kinetic and potential energy, and give examples of each.

CHAPTER 4: CELLULAR METABOLISM. 2. Distinguish between kinetic and potential energy, and give examples of each. OBJECTIVES: 1. Compare and contrast the major divisions of metabolism, in terms of a general descriptive sentence, additional descriptive terms, how energy is involved, whether bonds or formed or broken,

More information

Microbial Genetics. Chapter 8. Structure and Function of the Genetic Material. Genotype and Phenotype. DNA and Chromosomes.

Microbial Genetics. Chapter 8. Structure and Function of the Genetic Material. Genotype and Phenotype. DNA and Chromosomes. Chapter 8 Microbial Genetics Structure and Function of the Genetic Material Chromosomes are cellular structures made up of genes that carry hereditary information. Genetics is the study of how genes carry

More information

Proteins. Amino Acids. Chapter 3. Molecular Diagnostics Fundamentals, Methods and Clinical Applications Second Edition 2/5/2013

Proteins. Amino Acids. Chapter 3. Molecular Diagnostics Fundamentals, Methods and Clinical Applications Second Edition 2/5/2013 Proteins Chapter 3 Amino Acids Nonpolar Alanine, Ala, A Isoleucine, Ile, I Leucine, Leu, L Methionine, Met, M Phenylalanine, Phe, F Tryptophan,Trp, W Valine, Val, V Negatively Charged (Acidic) Aspartic

More information

Chapter 17: From Gene to Protein

Chapter 17: From Gene to Protein AP Biology Reading Guide Fred and Theresa Holtzclaw Julia Keller 12d Chapter 17: From Gene to Protein 1. What is gene expression? Gene expression is the process by which DNA directs the synthesis of proteins

More information

DNA. Discovery of the DNA double helix

DNA. Discovery of the DNA double helix DNA Replication DNA Discovery of the DNA double helix A. 1950 s B. Rosalind Franklin - X-ray photo of DNA. C. Watson and Crick - described the DNA molecule from Franklin s X-ray. What is DNA? Question:

More information

CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA

CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA INTRODUCTION DNA : DNA is deoxyribose nucleic acid. It is made up of a base consisting of sugar, phosphate and one nitrogen base.the

More information

BCH401G Lecture 39 Andres

BCH401G Lecture 39 Andres BCH401G Lecture 39 Andres Lecture Summary: Ribosome: Understand its role in translation and differences between translation in prokaryotes and eukaryotes. Translation: Understand the chemistry of this

More information

Chapter 9. Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA

Chapter 9. Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA Chapter 9 Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA Q&A Interferons are species specific, so that interferons to be used in humans must be produced in human cells. Can you think

More information

BCOR 011, Exam 3. Multiple Choice: Select the best possible answer. Name KEY Section

BCOR 011, Exam 3. Multiple Choice: Select the best possible answer. Name KEY Section BCOR 011, Exam 3 Name KEY Section Multiple Choice: Select the best possible answer. 1. A parent cell divides to form two genetically identical daughter cells in the nuclear process of mitosis. For mitosis

More information

Genetics Test Biology I

Genetics Test Biology I Genetics Test Biology I Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Avery s experiments showed that bacteria are transformed by a. RNA. c. proteins.

More information

Mutations and Genetic Variability. 1. What is occurring in the diagram below?

Mutations and Genetic Variability. 1. What is occurring in the diagram below? Mutations and Genetic Variability 1. What is occurring in the diagram below? A. Sister chromatids are separating. B. Alleles are independently assorting. C. Genes are replicating. D. Segments of DNA are

More information

Chapter 11: Molecular Structure of DNA and RNA

Chapter 11: Molecular Structure of DNA and RNA Chapter 11: Molecular Structure of DNA and RNA Student Learning Objectives Upon completion of this chapter you should be able to: 1. Understand the major experiments that led to the discovery of DNA as

More information

12.1 Identifying the Substance of Genes

12.1 Identifying the Substance of Genes 12.1 Identifying the Substance of Genes Lesson Objectives Summarize the process of bacterial transformation. Describe the role of bacteriophages in identifying genetic material. Identify the role of DNA

More information

13.4 Gene Regulation and Expression

13.4 Gene Regulation and Expression 13.4 Gene Regulation and Expression Lesson Objectives Describe gene regulation in prokaryotes. Explain how most eukaryotic genes are regulated. Relate gene regulation to development in multicellular organisms.

More information

DNA is a double helix with two sugar phosphate backbones and nucleotide bases bridging the two chains.

DNA is a double helix with two sugar phosphate backbones and nucleotide bases bridging the two chains. BENG 100 Frontiers of Biomedical Engineering Professor Mark Saltzman Chapter 3 SUMMARY Nucleic acids are linear polymers made up of monomer units called nucleotides. Each nucleotide is composed of a pentose

More information

Nucleotides and Nucleic Acids

Nucleotides and Nucleic Acids Nucleotides and Nucleic Acids Brief History 1 1869 - Miescher Isolated nuclein from soiled bandages 1902 - Garrod Studied rare genetic disorder: Alkaptonuria; concluded that specific gene is associated

More information

Prep Time: 1 hour. Class Time: 45 minutes

Prep Time: 1 hour. Class Time: 45 minutes ACTIVITY OVERVIEW Abstract: Students use edible models of the DNA molecule to transcribe an mrna sequence, then translate it into a protein. Module: The Basics and Beyond Prior Knowledge Needed: A basic

More information

Basic Concepts of DNA, Proteins, Genes and Genomes

Basic Concepts of DNA, Proteins, Genes and Genomes Basic Concepts of DNA, Proteins, Genes and Genomes Kun-Mao Chao 1,2,3 1 Graduate Institute of Biomedical Electronics and Bioinformatics 2 Department of Computer Science and Information Engineering 3 Graduate

More information

Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION. Professor Bharat Patel Office: Science 2, 2.36 Email: b.patel@griffith.edu.

Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION. Professor Bharat Patel Office: Science 2, 2.36 Email: b.patel@griffith.edu. Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION Professor Bharat Patel Office: Science 2, 2.36 Email: b.patel@griffith.edu.au What is Gene Expression & Gene Regulation? 1. Gene Expression

More information

2007 7.013 Problem Set 1 KEY

2007 7.013 Problem Set 1 KEY 2007 7.013 Problem Set 1 KEY Due before 5 PM on FRIDAY, February 16, 2007. Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. Where in a eukaryotic cell do you

More information

Pipe Cleaner Proteins. Essential question: How does the structure of proteins relate to their function in the cell?

Pipe Cleaner Proteins. Essential question: How does the structure of proteins relate to their function in the cell? Pipe Cleaner Proteins GPS: SB1 Students will analyze the nature of the relationships between structures and functions in living cells. Essential question: How does the structure of proteins relate to their

More information

Lecture 26: Overview of deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) structure

Lecture 26: Overview of deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) structure Lecture 26: Overview of deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) structure Nucleic acids play an important role in the storage and expression of genetic information. They are divided into

More information

Protein Synthesis Simulation

Protein Synthesis Simulation Protein Synthesis Simulation Name(s) Date Period Benchmark: SC.912.L.16.5 as AA: Explain the basic processes of transcription and translation, and how they result in the expression of genes. (Assessed

More information

AP BIOLOGY 2009 SCORING GUIDELINES

AP BIOLOGY 2009 SCORING GUIDELINES AP BIOLOGY 2009 SCORING GUIDELINES Question 4 The flow of genetic information from DNA to protein in eukaryotic cells is called the central dogma of biology. (a) Explain the role of each of the following

More information

GENE REGULATION. Teacher Packet

GENE REGULATION. Teacher Packet AP * BIOLOGY GENE REGULATION Teacher Packet AP* is a trademark of the College Entrance Examination Board. The College Entrance Examination Board was not involved in the production of this material. Pictures

More information

2.1 Nucleic acids the molecules of life

2.1 Nucleic acids the molecules of life 1 2.1 Nucleic acids the molecules of life Nucleic acids information molecules of the cells form new cells stored in chromosomes in nucleus of the cell in the form of a code in DNA / parts of the code are

More information