Bio 102 Practice Problems Recombinant DNA and Biotechnology

Size: px
Start display at page:

Download "Bio 102 Practice Problems Recombinant DNA and Biotechnology"

Transcription

1 Bio 102 Practice Problems Recombinant DNA and Biotechnology Multiple choice: Unless otherwise directed, circle the one best answer: 1. Which of the following DNA sequences could be the recognition site for a restriction enzyme? A. TGCCGT B. TGCGCA C. TGCTGC D. All of the above. E. None of the above. 2. Which of the following is not needed for DNA sequencing by the method we discussed in class? A. Radioactive primer B. DNA polymerase C. Fluorescent dideoxy nucleotides D. Ordinary nucleotides (dntps) E. All of the above are required. 3. What is the key enzyme used in PCR? A. ATP synthase B. Taq DNA polymerase C. DNA ligase D. Restriction enzymes E. Sigma factor Short answer (show your work or thinking to get partial credit): 1. Recombinant human insulin, produced by bacteria carrying a cloned insulin gene, is now the major form of insulin used to treat diabetes. The human insulin gene encodes an mrna only 333 nucleotides long, but the entire gene spans more than 4000 nucleotides. There are three exons and two introns. a. If we were to clone this gene directly from the nuclear DNA, bacteria would not be able to express the insulin protein. Explain why this is true. This gene has introns; bacteria don't. If we cloned the gene directly, the bacteria would produce mrna that includes the introns and be unable to splice it. Therefore, no functional protein could be made. b. What technique should be used instead in order to get a functional insulin coding sequence cloned into bacteria? Describe briefly how this technique works. We should use cdna cloning. In this technique, we isolate mrna from the cytoplasm of a cell, so that it has already been spliced. We then use reverse transcriptase enzyme to make a DNA copy (cdna) of the mrna. This DNA can then be cloned, producing a bacteria-readable gene that lacks introns. c. Every cell in the human body has the same DNA, so every cell has an insulin gene. However, in order to use the technique you described in "b," you would have to start with cells from the pancreas--the only body cells that actually produce the insulin protein. Why are these the only cells that would work? We need insulin mrna in order to do cdna cloning. If the cells are the only ones that make insulin protein, then most likely they are also the only ones that make significant amounts of insulin mrna.

2 2. Human gene therapy remains a promising possibility but is still plagued by problems. In the table below are listed two possible vectors and two problems. For each combination, please briefly explain if the specific problem is expected to be encountered for the vector. Immune Response Insertional Mutagenesis Retroviral Vector Could be a problem; someone who s had a retroviral infection before could be immune to the vector, or if multiple treatments are necessary, development of immunity could be a big drawback. Could be a problem, because the retrovirus inserts DNA randomly into the cell s genome; it could hit a gene by chance. Liposome Should not be a problem. Proteins, not lipids, usually trigger the immune response. Liposomes usually deliver plasmids or other DNA that won t integrate into the genome. Shouldn t be a problem. 3. The diagram below represents a section of the human genome. The coding sequence of a gene, YFG, is shown by an arrow, and boxes indicate the locations of some regulatory sequences. Locations of recognition sequences (cut sites) for three common restriction enzymes (EcoRI, BamHI, and NcoI) are also marked. You would like to clone this gene in E. coli for further study. You have available the expression vector (plasmid) shown below: a. Why is it important for this plasmid to be an expression vector? Eukaryotic genes have regulatory signals like enhancers and TATA boxes that are not recognized by bacteria and lack the -10 and -35 sequences that bacterial RNA polymerase needs to start transcription. In addition, eukaryotic ribosomes find the correct AUG codon by scanning from the cap to the first AUG, while bacteria rely on a Shine-Dalgarno sequence in the mrna. These bacterial regulatory signals are provided by the expression vector. If we use a plasmid that did not have these signals, it's very unlikely that the bacteria would be able to transcribe and translate our gene.

3 b. Why is it important for this plasmid to have an antibiotic-resistance gene? This gives a way to select for bacteria that acquire the plasmid. The frequency of successful transformation is small, so we need a way to know that we got the clone into a cell. Only cells that acquire this plasmid will be able to grow in the presence of this antibiotic. c. What restriction enzyme would you use to clone this gene? Explain your choice. The plasmid has sites for all three restriction enzymes. However, EcoRI cuts the plasmid twice, so we would wind up chopping out a piece of the plasmid, including the needed Shine-Dalgarno region. This is a bad choice. BamHI is also a bad choice, because it cuts in the middle of the gene we want to clone. We want an enzyme that will leave our gene intact. NotI is the best choice. It will cut our gene out of the genome and makes a single cut for inserting it into the plasmid. Notice that it's not important that the enhancer and TATA sequences will be left behind; the plasmid provides the needed regulatory signals. 4. You would like to use PCR to amplify (make many copies of) the boxed section of the DNA sequence below: 5 ACGACCGATAGACGACGTAGGACTTACTTACTTACGTAGGCA 3 3 TGCTGGCTATCTGCTGCATCCTGAATGAATGAATGCATCCGT 5 You ask your lab partner to order a pair of primers that can be used in the PCR reaction. The sequences of the primers he orders are: Primer #1: 5 ATAGAC 3 Primer #2: 5 ACTTAC 3 a. Oops! Looks like you shouldn t have trusted your lab partner on this one. Which of the two primers is wrong, and why won t it work? Primer #1 is OK: it will bind to the bottom strand, and its 3 end will then be pointed in the right direction for Taq DNA polymerase to synthesize the desired DNA. Primer #2 won t work, because it binds to other end of the same strand and so its 3 end is pointed out away from the sequence to be copied: 5 ATAGAC-> 5 ACTTAC-> 3 TGCTGGCTATCTGCTGCATCCTGAATGAATGAATGCATCCGT 5 b. Give the sequence of a primer that will work and could be used instead of the wrong one. Be sure to indicate the 5 and 3 ends. We need a primer that will bind to the top strand, with its 3 end pointed toward the left so that the other strand can be copied. For example, 5 GTAAGT 3 : 5 ACGACCGATAGACGACGTAGGACTTACTTACTTACGTAGGCA 3 <-TGAATG 5 5 ATAGAC-> 3 TGCTGGCTATCTGCTGCATCCTGAATGAATGAATGCATCCGT 5

4 5. You are trying to find the gene responsible for a human genetic disorder. You have mapped the gene to a particular chromosome region, and examining the human genome sequence for that region gives you the nucleotide sequence below: 5 CATACTTACTACTAGATTACGATTAGACGATTAGGATG GCC GAC TCG TGC AGT AAC AGC ATG ACC GAG GCC TAGACCAGATTAGGAGCCGGACCAGGACGGACCAGCGACT 3 a. Assuming you are reading the non-coding strand and that there are no introns, find an open reading frame (ORF) in this region. Circle the point where translation will start, and put a box around the point where translation will stop. Then give the number of amino acids in the protein this gene would encode: 12 amino acids (start codon encodes an amino acid; stop codon doesn t) b. If you wanted to express this gene in E. coli, what would need to be present in your cloning vector to ensure that it will be transcribed and translated? The gene s promoter sequence won t be recognized by E. coli s sigma factor, so you ll need a prokaryotic promoter ( 10 and 35 sequences). E. coli ribosomes can only find the correct start codon by first binding the Shine-Dalgarno sequence, so the vector should also have this sequence positioned just before the desired start codon. c. How might the protein produced by E. coli differ from the protein produced from the same gene in a human cell? The amino-acid sequence (primary structure) will be the same. However, eukaryotic proteins are often modified in the ER or Golgi: carbohydrates added, phosphate groups added, etc. These modifications probably won t happen in E. coli. Also, it s possible that the protein won t be correctly folded, if some specific protein or condition in the eukaryotic cell is needed for folding. 6. You have cloned a cdna encoding a human hormone, and you hope to produce the hormone in bacteria in order to treat a severe genetic disorder. Unfortunately, when you insert this DNA into a plasmid and transform it into the bacteria, you get no hormone production. Give two valid reasons for your failure, and suggest a possible solution in each case. (1) Hormone must be modified after synthesis; bacteria lack ER and Golgi. Solution: determine the needed modification and try to reproduce it chemically, clone needed enzymes or use a eukaryotic host. (2) cdna has no promoter and can t be transcribed. Solution: insert it into an expression vector that includes a promoter. (3) cdna from a eukaryotic cell doesn t have a Shine-Dalgarno sequence needed for translation initiation in bacteria. Solution: insert it into an expression vector that includes a promoter. (4) cdna is made from mrna, and the mrna for the hormone will only be present in a cell that normally produces the hormone. Could be that the source of the DNA needs to be changed. (5) The hormone might be toxic to bacteria. Solution: could try a different cell as the host. 7. Circle the DNA sequence(s) below which could potentially be a recognition site for a restriction enzyme. 5 ATTTTA 3 5 CGCG 3 3 TAAAAT 5 3 GCGC 5 5 GGATCC 3 5 AGGAGG 3 3 CCTAGG 5 3 TCCTCC 5

5 8. A Bio 102 student gets so excited about the tyrosinase experiment that she decides to try to clone the tyrosinase gene. She grinds up some potato, extracts the DNA from it and digests the DNA with two different restriction enzymes (separately, not together): EcoRI and BamHI. She then obtains a cloning vector and digests it with the same two enzymes. She then runs a gel, which is shown at the right. a. Which enzyme would she want to use for cloning the potato DNA: EcoRI, or BamHI? Explain why you made your choice. BamHI, because it only cuts the plasmid once if you cut the plasmid twice, then both pieces must go back together along with your insert in order to get a functional recombinant plasmid. b. Notice that the cloning vector made nice, tight bands on the gel, but the potato DNA just looks like a smear with no distinct bands. However, this is just what the student expected, so she s not worried about it at all. Explain why this is the expected result. Plasmids are small and might have only one or two cut sites for a particular enzyme. The potato genome is huge and will have hundreds or thousands of sites for that enzyme. So we expect many, many more fragments, leading to the smeary appearance. That s OK, though, because after cloning all the fragments (to make a library), we ll have a way to identify the one correct clone. c. The student now mixes the potato DNA (digested with the enzyme you specified in part A) with cloning vector DNA (digested with the same enzyme). She then adds the mixture to E. coli cells that have been treated with CaCl 2, heats briefly to 42 C, adds growth medium and incubates for an hour. What would be her next step? Be as specific as possible. Now the cells would be put on an antibiotic-containing plate. This will kill any cell that didn t get a plasmid and allow those that did to grow into colonies. d. Unfortunately, after doing the next step as you specified, she doesn t get a single bacterial colony. Not even one! When she reviews her procedure, she realizes she left out a critical step. What did she forget, and why would this be necessary? She forgot to add the ligase! Ligase enzyme is needed to join the potato DNA with the cloning vector to make a single, circular recombinant DNA molecule.

6 9. Suppose you want to clone the gene for human Hexokinase, so that you can use bacteria to produce the protein and obtain it in pure form for further study of its activity. a. Your first task is to isolate the hexokinase gene from the human genome. Assuming you have some human DNA on hand and access to the genomic databases on the Web, what technique might you use to obtain pure hexokinase DNA? Since you can use the human genome database to determine the sequence of the enzyme, you can design primers that could be used to amplify only the hexokinase gene from a human DNA sample by PCR. b. In your initial attempt, you succeed in obtaining hexokinase DNA and ligating it into a plasmid vector, but when you transform the recombinant plasmid into bacteria, you get no hexokinase protein produced at all. When you discuss your problem with your friend, she suggests that you might want to start with mrna instead of with DNA. What problem can be overcome by starting with mrna instead? The hexokinase gene, like most human genes, probably contains introns. Bacteria can t splice out introns, so the bacteria couldn t make the correctly processed mrna (with an uninterrupted coding sequence), so they can t make the hexokinase protein starting with the complete human gene. c. What will you need to do with your mrna before you can make a new recombinant plasmid? Use reverse transcriptase to make a DNA copy of it (convert it to cdna). d. What else would you need to provide in order for the bacteria to correctly transcribe and translate the human hexokinase gene? The cdna won t include a promoter (-10 and -35 sequences, for bacteria) or a Shine-Dalgarno sequence, so the bacteria may not correctly recognize the gene unless these are added. An expression vector is commonly used for cloning cdna for this reason. e. After consulting genome databases, you find that the human hexokinase amino-acid sequence begins with Met-Trp-Lys-Trp- Trp-Met. But the protein made from your plasmid begins with Met-Trp-Met-Trp-Trp-Met! A mutation must have occurred! Below, write the DNA sequence of the non-template strand for the beginning of the actual (unmutated) hexokinase gene. Don t forget 5 and 3 ends. There is only one codon for Met, AUG, and only one codon for Trp, UGG. So the mrna sequence for the un-mutated gene must be: 5 -AUG-UGG-(Lys)-UGG-UGG-AUG. But, there are two possible codons for Lys: AAA and AAG. How could we know which one it was? Well, in the mutated version, Lys is changed to Met (AUG). AAG could change to AUG with only one mutation, while AAA would need two mutations to change to AUG. So it s most likely that the Lys codon was AAG. Now we have 5 - AUG-UGG-AAG- UGG-UGG-AUG for the mrna. Now, the question asks us for the non-template strand of the DNA. The non-template strand looks like the mrna, but of course it would have T s, not U s. So: 5 -ATGTGGAAGTGGTGGATG. f. Perhaps you could salvage your recombinant protein by treating it with a mutagen in order to get a reversion mutation that restores the correct amino-acid sequence! Which of the following mutagens might work? Circle all that apply. 1) ethidium bromide (makes one-base insertions or deletions) 2) aminopurine (causes A G substitutions) 3) imidazolecarboxamide (causes A T substitutions) This could work because it could change the Met codon (TAC on the template strand) to TTC, which would be AAG (Lys) in the mrna. 4) aflatoxin B 1 (allows any nucleotide to base-pair with a T during replication) This could work because it could affect the T in the ATG Met codon; if T paired with T, we would get TTG on the template strand, producing an AAC Lys codon.

7 10. Explain one significant problem with using retroviruses for gene therapy. (1) Because they insert DNA randomly into host DNA, they could produce a mutation (2) Because they contain a promoter, they could affect expression of other genes near the insertion Matching: 1. In our example of cloning insulin, we used several different enzymes. Match each enzyme below with its function in the cloning process. F Reverse transcriptase a. Separating strands of DNA for PCR b. Causing sticky ends to hydrogen bond G Restriction enzyme c. Copying a specific region of DNA D DNA ligase d. Covalently joining a DNA fragment to a cloning vector e. Transcribing the recombinant gene C Taq DNA polymerase f. Making a DNA copy of RNA g. Cutting DNA backbone at a specific sequence J DNA helicase h. Replicating plasmid j. Not used in cloning 2. Matching. Match the enzymes on the left with their roles in gene cloning on the right. You may use the letters once, more than once or not at all, but only one letter per blank. E F A B F DNA ligase DNA polymerase Restriction enzyme Reverse transcriptase Helicase a. Cut expression vector to produce sticky ends b. Produce cdna from mrna c. Separate strands of double-stranded DNA d. Produce many copies of a specific DNA sequence e. Make covalent bonds between two DNA molecules f. Not used in gene cloning

Structure and Function of DNA

Structure and Function of DNA Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four

More information

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology

More information

Biotechnology: DNA Technology & Genomics

Biotechnology: DNA Technology & Genomics Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 The BIG Questions How can we use our knowledge of DNA to: diagnose disease or defect? cure disease or defect? change/improve organisms? What

More information

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,

More information

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna

More information

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!! DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other

More information

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins

More information

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d. 13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both

More information

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes

More information

restriction enzymes 350 Home R. Ward: Spring 2001

restriction enzymes 350 Home R. Ward: Spring 2001 restriction enzymes 350 Home Restriction Enzymes (endonucleases): molecular scissors that cut DNA Properties of widely used Type II restriction enzymes: recognize a single sequence of bases in dsdna, usually

More information

Recombinant DNA and Biotechnology

Recombinant DNA and Biotechnology Recombinant DNA and Biotechnology Chapter 18 Lecture Objectives What Is Recombinant DNA? How Are New Genes Inserted into Cells? What Sources of DNA Are Used in Cloning? What Other Tools Are Used to Study

More information

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled Biology 101 Chapter 14 Name: Fill-in-the-Blanks Which base follows the next in a strand of DNA is referred to. as the base (1) Sequence. The region of DNA that calls for the assembly of specific amino

More information

Recombinant DNA Unit Exam

Recombinant DNA Unit Exam Recombinant DNA Unit Exam Question 1 Restriction enzymes are extensively used in molecular biology. Below are the recognition sites of two of these enzymes, BamHI and BclI. a) BamHI, cleaves after the

More information

Transcription and Translation of DNA

Transcription and Translation of DNA Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes

More information

Genetics Module B, Anchor 3

Genetics Module B, Anchor 3 Genetics Module B, Anchor 3 Key Concepts: - An individual s characteristics are determines by factors that are passed from one parental generation to the next. - During gamete formation, the alleles for

More information

AP BIOLOGY 2007 SCORING GUIDELINES

AP BIOLOGY 2007 SCORING GUIDELINES AP BIOLOGY 2007 SCORING GUIDELINES Question 4 A bacterial plasmid is 100 kb in length. The plasmid DNA was digested to completion with two restriction enzymes in three separate treatments: EcoRI, HaeIII,

More information

Protein Synthesis How Genes Become Constituent Molecules

Protein Synthesis How Genes Become Constituent Molecules Protein Synthesis Protein Synthesis How Genes Become Constituent Molecules Mendel and The Idea of Gene What is a Chromosome? A chromosome is a molecule of DNA 50% 50% 1. True 2. False True False Protein

More information

1 Mutation and Genetic Change

1 Mutation and Genetic Change CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds

More information

2006 7.012 Problem Set 3 KEY

2006 7.012 Problem Set 3 KEY 2006 7.012 Problem Set 3 KEY Due before 5 PM on FRIDAY, October 13, 2006. Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. Which reaction is catalyzed by each

More information

Sample Questions for Exam 3

Sample Questions for Exam 3 Sample Questions for Exam 3 1. All of the following occur during prometaphase of mitosis in animal cells except a. the centrioles move toward opposite poles. b. the nucleolus can no longer be seen. c.

More information

CCR Biology - Chapter 9 Practice Test - Summer 2012

CCR Biology - Chapter 9 Practice Test - Summer 2012 Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible

More information

DNA Scissors: Introduction to Restriction Enzymes

DNA Scissors: Introduction to Restriction Enzymes DNA Scissors: Introduction to Restriction Enzymes Objectives At the end of this activity, students should be able to 1. Describe a typical restriction site as a 4- or 6-base- pair palindrome; 2. Describe

More information

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,

More information

Recombinant DNA Technology

Recombinant DNA Technology Recombinant DNA Technology Dates in the Development of Gene Cloning: 1965 - plasmids 1967 - ligase 1970 - restriction endonucleases 1972 - first experiments in gene splicing 1974 - worldwide moratorium

More information

RNA & Protein Synthesis

RNA & Protein Synthesis RNA & Protein Synthesis Genes send messages to cellular machinery RNA Plays a major role in process Process has three phases (Genetic) Transcription (Genetic) Translation Protein Synthesis RNA Synthesis

More information

Bio 102 Practice Problems Chromosomes and DNA Replication

Bio 102 Practice Problems Chromosomes and DNA Replication Bio 102 Practice Problems Chromosomes and DNA Replication Multiple choice: Unless otherwise directed, circle the one best answer: 1. Which one of the following enzymes is NT a key player in the process

More information

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results

More information

The Steps. 1. Transcription. 2. Transferal. 3. Translation

The Steps. 1. Transcription. 2. Transferal. 3. Translation Protein Synthesis Protein synthesis is simply the "making of proteins." Although the term itself is easy to understand, the multiple steps that a cell in a plant or animal must go through are not. In order

More information

DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA

DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA DNA Fingerprinting Unless they are identical twins, individuals have unique DNA DNA fingerprinting The name used for the unambiguous identifying technique that takes advantage of differences in DNA sequence

More information

HCS604.03 Exercise 1 Dr. Jones Spring 2005. Recombinant DNA (Molecular Cloning) exercise:

HCS604.03 Exercise 1 Dr. Jones Spring 2005. Recombinant DNA (Molecular Cloning) exercise: HCS604.03 Exercise 1 Dr. Jones Spring 2005 Recombinant DNA (Molecular Cloning) exercise: The purpose of this exercise is to learn techniques used to create recombinant DNA or clone genes. You will clone

More information

PRACTICE TEST QUESTIONS

PRACTICE TEST QUESTIONS PART A: MULTIPLE CHOICE QUESTIONS PRACTICE TEST QUESTIONS DNA & PROTEIN SYNTHESIS B 1. One of the functions of DNA is to A. secrete vacuoles. B. make copies of itself. C. join amino acids to each other.

More information

The E. coli Insulin Factory

The E. coli Insulin Factory The E. coli Insulin Factory BACKGROUND Bacteria have not only their normal DNA, they also have pieces of circular DNA called plasmids. Plasmids are a wonderfully ally for biologists who desire to get bacteria

More information

Module 3 Questions. 7. Chemotaxis is an example of signal transduction. Explain, with the use of diagrams.

Module 3 Questions. 7. Chemotaxis is an example of signal transduction. Explain, with the use of diagrams. Module 3 Questions Section 1. Essay and Short Answers. Use diagrams wherever possible 1. With the use of a diagram, provide an overview of the general regulation strategies available to a bacterial cell.

More information

Provincial Exam Questions. 9. Give one role of each of the following nucleic acids in the production of an enzyme.

Provincial Exam Questions. 9. Give one role of each of the following nucleic acids in the production of an enzyme. Provincial Exam Questions Unit: Cell Biology: Protein Synthesis (B7 & B8) 2010 Jan 3. Describe the process of translation. (4 marks) 2009 Sample 8. What is the role of ribosomes in protein synthesis? A.

More information

Complex multicellular organisms are produced by cells that switch genes on and off during development.

Complex multicellular organisms are produced by cells that switch genes on and off during development. Home Control of Gene Expression Gene Regulation Is Necessary? By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection favoring

More information

Gene Finding CMSC 423

Gene Finding CMSC 423 Gene Finding CMSC 423 Finding Signals in DNA We just have a long string of A, C, G, Ts. How can we find the signals encoded in it? Suppose you encountered a language you didn t know. How would you decipher

More information

To be able to describe polypeptide synthesis including transcription and splicing

To be able to describe polypeptide synthesis including transcription and splicing Thursday 8th March COPY LO: To be able to describe polypeptide synthesis including transcription and splicing Starter Explain the difference between transcription and translation BATS Describe and explain

More information

Protein Synthesis. Page 41 Page 44 Page 47 Page 42 Page 45 Page 48 Page 43 Page 46 Page 49. Page 41. DNA RNA Protein. Vocabulary

Protein Synthesis. Page 41 Page 44 Page 47 Page 42 Page 45 Page 48 Page 43 Page 46 Page 49. Page 41. DNA RNA Protein. Vocabulary Protein Synthesis Vocabulary Transcription Translation Translocation Chromosomal mutation Deoxyribonucleic acid Frame shift mutation Gene expression Mutation Point mutation Page 41 Page 41 Page 44 Page

More information

Bio 102 Practice Problems Genetic Code and Mutation

Bio 102 Practice Problems Genetic Code and Mutation Bio 102 Practice Problems Genetic Code and Mutation Multiple choice: Unless otherwise directed, circle the one best answer: 1. Beadle and Tatum mutagenized Neurospora to find strains that required arginine

More information

Transfection-Transfer of non-viral genetic material into eukaryotic cells. Infection/ Transduction- Transfer of viral genetic material into cells.

Transfection-Transfer of non-viral genetic material into eukaryotic cells. Infection/ Transduction- Transfer of viral genetic material into cells. Transfection Key words: Transient transfection, Stable transfection, transfection methods, vector, plasmid, origin of replication, reporter gene/ protein, cloning site, promoter and enhancer, signal peptide,

More information

Translation Study Guide

Translation Study Guide Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to

More information

Chapter 18 Regulation of Gene Expression

Chapter 18 Regulation of Gene Expression Chapter 18 Regulation of Gene Expression 18.1. Gene Regulation Is Necessary By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection

More information

Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION. Professor Bharat Patel Office: Science 2, 2.36 Email: b.patel@griffith.edu.

Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION. Professor Bharat Patel Office: Science 2, 2.36 Email: b.patel@griffith.edu. Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION Professor Bharat Patel Office: Science 2, 2.36 Email: b.patel@griffith.edu.au What is Gene Expression & Gene Regulation? 1. Gene Expression

More information

ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes

ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes Page 1 of 22 Introduction Indiana students enrolled in Biology I participated in the ISTEP+: Biology I Graduation Examination

More information

DNA Replication in Prokaryotes

DNA Replication in Prokaryotes OpenStax-CNX module: m44488 1 DNA Replication in Prokaryotes OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section,

More information

Gene Cloning. Reference. T.A. Brown, Gene Cloning, Chapman and Hall. S.B. Primrose, Molecular Biotechnology, Blackwell

Gene Cloning. Reference. T.A. Brown, Gene Cloning, Chapman and Hall. S.B. Primrose, Molecular Biotechnology, Blackwell Gene Cloning 2004 Seungwook Kim Chem. & Bio. Eng. Reference T.A. Brown, Gene Cloning, Chapman and Hall S.B. Primrose, Molecular Biotechnology, Blackwell Why Gene Cloning is Important? A century ago, Gregor

More information

Chapter 6 DNA Replication

Chapter 6 DNA Replication Chapter 6 DNA Replication Each strand of the DNA double helix contains a sequence of nucleotides that is exactly complementary to the nucleotide sequence of its partner strand. Each strand can therefore

More information

Ms. Campbell Protein Synthesis Practice Questions Regents L.E.

Ms. Campbell Protein Synthesis Practice Questions Regents L.E. Name Student # Ms. Campbell Protein Synthesis Practice Questions Regents L.E. 1. A sequence of three nitrogenous bases in a messenger-rna molecule is known as a 1) codon 2) gene 3) polypeptide 4) nucleotide

More information

Translation. Translation: Assembly of polypeptides on a ribosome

Translation. Translation: Assembly of polypeptides on a ribosome Translation Translation: Assembly of polypeptides on a ribosome Living cells devote more energy to the synthesis of proteins than to any other aspect of metabolism. About a third of the dry mass of a cell

More information

Lecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides

Lecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides Lecture Series 7 From DNA to Protein: Genotype to Phenotype Reading Assignments Read Chapter 7 From DNA to Protein A. Genes and the Synthesis of Polypeptides Genes are made up of DNA and are expressed

More information

AP BIOLOGY 2009 SCORING GUIDELINES

AP BIOLOGY 2009 SCORING GUIDELINES AP BIOLOGY 2009 SCORING GUIDELINES Question 4 The flow of genetic information from DNA to protein in eukaryotic cells is called the central dogma of biology. (a) Explain the role of each of the following

More information

Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein

Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein Assignment 3 Michele Owens Vocabulary Gene: A sequence of DNA that instructs a cell to produce a particular protein Promoter a control sequence near the start of a gene Coding sequence the sequence of

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources 1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools

More information

AP Biology TEST #5 - Chapters 11-14, 16 - REVIEW SHEET

AP Biology TEST #5 - Chapters 11-14, 16 - REVIEW SHEET NAME: AP Biology TEST #5 - Chapters 11-14, 16 - REVIEW SHEET 1. Griffith's experiments showing the transformation of R strain pneumococcus bacteria to S strain pneumococcus bacteria in the presence of

More information

GENE REGULATION. Teacher Packet

GENE REGULATION. Teacher Packet AP * BIOLOGY GENE REGULATION Teacher Packet AP* is a trademark of the College Entrance Examination Board. The College Entrance Examination Board was not involved in the production of this material. Pictures

More information

How many of you have checked out the web site on protein-dna interactions?

How many of you have checked out the web site on protein-dna interactions? How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss

More information

CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA

CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA INTRODUCTION DNA : DNA is deoxyribose nucleic acid. It is made up of a base consisting of sugar, phosphate and one nitrogen base.the

More information

Thymine = orange Adenine = dark green Guanine = purple Cytosine = yellow Uracil = brown

Thymine = orange Adenine = dark green Guanine = purple Cytosine = yellow Uracil = brown 1 DNA Coloring - Transcription & Translation Transcription RNA, Ribonucleic Acid is very similar to DNA. RNA normally exists as a single strand (and not the double stranded double helix of DNA). It contains

More information

DNA (genetic information in genes) RNA (copies of genes) proteins (functional molecules) directionality along the backbone 5 (phosphate) to 3 (OH)

DNA (genetic information in genes) RNA (copies of genes) proteins (functional molecules) directionality along the backbone 5 (phosphate) to 3 (OH) DNA, RNA, replication, translation, and transcription Overview Recall the central dogma of biology: DNA (genetic information in genes) RNA (copies of genes) proteins (functional molecules) DNA structure

More information

Molecular Genetics. RNA, Transcription, & Protein Synthesis

Molecular Genetics. RNA, Transcription, & Protein Synthesis Molecular Genetics RNA, Transcription, & Protein Synthesis Section 1 RNA AND TRANSCRIPTION Objectives Describe the primary functions of RNA Identify how RNA differs from DNA Describe the structure and

More information

Bacterial Transformation and Plasmid Purification. Chapter 5: Background

Bacterial Transformation and Plasmid Purification. Chapter 5: Background Bacterial Transformation and Plasmid Purification Chapter 5: Background History of Transformation and Plasmids Bacterial methods of DNA transfer Transformation: when bacteria take up DNA from their environment

More information

BCH401G Lecture 39 Andres

BCH401G Lecture 39 Andres BCH401G Lecture 39 Andres Lecture Summary: Ribosome: Understand its role in translation and differences between translation in prokaryotes and eukaryotes. Translation: Understand the chemistry of this

More information

Genetic Technology. Name: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question.

Genetic Technology. Name: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question. Name: Class: Date: Genetic Technology Multiple Choice Identify the choice that best completes the statement or answers the question. 1. An application of using DNA technology to help environmental scientists

More information

4. DNA replication Pages: 979-984 Difficulty: 2 Ans: C Which one of the following statements about enzymes that interact with DNA is true?

4. DNA replication Pages: 979-984 Difficulty: 2 Ans: C Which one of the following statements about enzymes that interact with DNA is true? Chapter 25 DNA Metabolism Multiple Choice Questions 1. DNA replication Page: 977 Difficulty: 2 Ans: C The Meselson-Stahl experiment established that: A) DNA polymerase has a crucial role in DNA synthesis.

More information

Control of Gene Expression

Control of Gene Expression Home Gene Regulation Is Necessary? Control of Gene Expression By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection favoring

More information

Genetics Test Biology I

Genetics Test Biology I Genetics Test Biology I Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Avery s experiments showed that bacteria are transformed by a. RNA. c. proteins.

More information

From DNA to Protein

From DNA to Protein Nucleus Control center of the cell contains the genetic library encoded in the sequences of nucleotides in molecules of DNA code for the amino acid sequences of all proteins determines which specific proteins

More information

RNA and Protein Synthesis

RNA and Protein Synthesis Name lass Date RN and Protein Synthesis Information and Heredity Q: How does information fl ow from DN to RN to direct the synthesis of proteins? 13.1 What is RN? WHT I KNOW SMPLE NSWER: RN is a nucleic

More information

HiPer RT-PCR Teaching Kit

HiPer RT-PCR Teaching Kit HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The

More information

Gene Models & Bed format: What they represent.

Gene Models & Bed format: What they represent. GeneModels&Bedformat:Whattheyrepresent. Gene models are hypotheses about the structure of transcripts produced by a gene. Like all models, they may be correct, partly correct, or entirely wrong. Typically,

More information

1.5 page 3 DNA Replication S. Preston 1

1.5 page 3 DNA Replication S. Preston 1 AS Unit 1: Basic Biochemistry and Cell Organisation Name: Date: Topic 1.5 Nucleic Acids and their functions Page 3 l. DNA Replication 1. Go through PowerPoint 2. Read notes p2 and then watch the animation

More information

The Techniques of Molecular Biology: Forensic DNA Fingerprinting

The Techniques of Molecular Biology: Forensic DNA Fingerprinting Revised Fall 2011 The Techniques of Molecular Biology: Forensic DNA Fingerprinting The techniques of molecular biology are used to manipulate the structure and function of molecules such as DNA and proteins

More information

INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B

INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS

More information

DNA, RNA, Protein synthesis, and Mutations. Chapters 12-13.3

DNA, RNA, Protein synthesis, and Mutations. Chapters 12-13.3 DNA, RNA, Protein synthesis, and Mutations Chapters 12-13.3 1A)Identify the components of DNA and explain its role in heredity. DNA s Role in heredity: Contains the genetic information of a cell that can

More information

Lab # 12: DNA and RNA

Lab # 12: DNA and RNA 115 116 Concepts to be explored: Structure of DNA Nucleotides Amino Acids Proteins Genetic Code Mutation RNA Transcription to RNA Translation to a Protein Figure 12. 1: DNA double helix Introduction Long

More information

13.4 Gene Regulation and Expression

13.4 Gene Regulation and Expression 13.4 Gene Regulation and Expression Lesson Objectives Describe gene regulation in prokaryotes. Explain how most eukaryotic genes are regulated. Relate gene regulation to development in multicellular organisms.

More information

Control of Gene Expression

Control of Gene Expression Control of Gene Expression What is Gene Expression? Gene expression is the process by which informa9on from a gene is used in the synthesis of a func9onal gene product. What is Gene Expression? Figure

More information

Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources

Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources Appendix 2 Molecular Biology Core Curriculum Websites and Other Resources Chapter 1 - The Molecular Basis of Cancer 1. Inside Cancer http://www.insidecancer.org/ From the Dolan DNA Learning Center Cold

More information

Specific problems. The genetic code. The genetic code. Adaptor molecules match amino acids to mrna codons

Specific problems. The genetic code. The genetic code. Adaptor molecules match amino acids to mrna codons Tutorial II Gene expression: mrna translation and protein synthesis Piergiorgio Percipalle, PhD Program Control of gene transcription and RNA processing mrna translation and protein synthesis KAROLINSKA

More information

Name: Date: Period: DNA Unit: DNA Webquest

Name: Date: Period: DNA Unit: DNA Webquest Name: Date: Period: DNA Unit: DNA Webquest Part 1 History, DNA Structure, DNA Replication DNA History http://www.dnaftb.org/dnaftb/1/concept/index.html Read the text and answer the following questions.

More information

13.2 Ribosomes & Protein Synthesis

13.2 Ribosomes & Protein Synthesis 13.2 Ribosomes & Protein Synthesis Introduction: *A specific sequence of bases in DNA carries the directions for forming a polypeptide, a chain of amino acids (there are 20 different types of amino acid).

More information

Section 16.1 Producing DNA fragments

Section 16.1 Producing DNA fragments Section 16.1 Producing DNA fragments Recombinant DNA combined DNA of two different organisms The process of using DNA technology to make certain proteins is as follows: 1.) Isolation of the DNA fragments

More information

Basic Concepts Recombinant DNA Use with Chapter 13, Section 13.2

Basic Concepts Recombinant DNA Use with Chapter 13, Section 13.2 Name Date lass Master 19 Basic oncepts Recombinant DN Use with hapter, Section.2 Formation of Recombinant DN ut leavage Splicing opyright lencoe/mcraw-hill, a division of he Mcraw-Hill ompanies, Inc. Bacterial

More information

MUTATION, DNA REPAIR AND CANCER

MUTATION, DNA REPAIR AND CANCER MUTATION, DNA REPAIR AND CANCER 1 Mutation A heritable change in the genetic material Essential to the continuity of life Source of variation for natural selection New mutations are more likely to be harmful

More information

Genetic Engineering and Biotechnology

Genetic Engineering and Biotechnology 1 So, what is biotechnology?? The use of living organisms to carry out defined chemical processes for industrial or commercial application. The office of Technology Assessment of the U.S. Congress defines

More information

Compiled and/or written by Amy B. Vento and David R. Gillum

Compiled and/or written by Amy B. Vento and David R. Gillum Fact Sheet Describing Recombinant DNA and Elements Utilizing Recombinant DNA Such as Plasmids and Viral Vectors, and the Application of Recombinant DNA Techniques in Molecular Biology Compiled and/or written

More information

NO CALCULATORS OR CELL PHONES ALLOWED

NO CALCULATORS OR CELL PHONES ALLOWED Biol 205 Exam 1 TEST FORM A Spring 2008 NAME Fill out both sides of the Scantron Sheet. On Side 2 be sure to indicate that you have TEST FORM A The answers to Part I should be placed on the SCANTRON SHEET.

More information

CCR Biology - Chapter 8 Practice Test - Summer 2012

CCR Biology - Chapter 8 Practice Test - Summer 2012 Name: Class: Date: CCR Biology - Chapter 8 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. What did Hershey and Chase know

More information

GenBank, Entrez, & FASTA

GenBank, Entrez, & FASTA GenBank, Entrez, & FASTA Nucleotide Sequence Databases First generation GenBank is a representative example started as sort of a museum to preserve knowledge of a sequence from first discovery great repositories,

More information

European Medicines Agency

European Medicines Agency European Medicines Agency July 1996 CPMP/ICH/139/95 ICH Topic Q 5 B Quality of Biotechnological Products: Analysis of the Expression Construct in Cell Lines Used for Production of r-dna Derived Protein

More information

Regents Biology REGENTS REVIEW: PROTEIN SYNTHESIS

Regents Biology REGENTS REVIEW: PROTEIN SYNTHESIS Period Date REGENTS REVIEW: PROTEIN SYNTHESIS 1. The diagram at the right represents a portion of a type of organic molecule present in the cells of organisms. What will most likely happen if there is

More information

Mitochondrial DNA Analysis

Mitochondrial DNA Analysis Mitochondrial DNA Analysis Lineage Markers Lineage markers are passed down from generation to generation without changing Except for rare mutation events They can help determine the lineage (family tree)

More information

Replication Study Guide

Replication Study Guide Replication Study Guide This study guide is a written version of the material you have seen presented in the replication unit. Self-reproduction is a function of life that human-engineered systems have

More information

GENE CLONING AND RECOMBINANT DNA TECHNOLOGY

GENE CLONING AND RECOMBINANT DNA TECHNOLOGY GENE CLONING AND RECOMBINANT DNA TECHNOLOGY What is recombinant DNA? DNA from 2 different sources (often from 2 different species) are combined together in vitro. Recombinant DNA forms the basis of cloning.

More information

The sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized:

The sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized: Module 3F Protein Synthesis So far in this unit, we have examined: How genes are transmitted from one generation to the next Where genes are located What genes are made of How genes are replicated How

More information

Eukaryotes. www.njctl.org PSI Biology Eukaryotes & Gene Expression

Eukaryotes. www.njctl.org PSI Biology Eukaryotes & Gene Expression Eukaryotes The Eukaryotic Cell Classwork 1. Identify two characteristics that are shared by all cells. 2. Suppose you are investigating a cell that contains a nucleus. Would you categorize this cell as

More information

DNA. Discovery of the DNA double helix

DNA. Discovery of the DNA double helix DNA Replication DNA Discovery of the DNA double helix A. 1950 s B. Rosalind Franklin - X-ray photo of DNA. C. Watson and Crick - described the DNA molecule from Franklin s X-ray. What is DNA? Question:

More information

Viruses. Viral components: Capsid. Chapter 10: Viruses. Viral components: Nucleic Acid. Viral components: Envelope

Viruses. Viral components: Capsid. Chapter 10: Viruses. Viral components: Nucleic Acid. Viral components: Envelope Viruses Chapter 10: Viruses Lecture Exam #3 Wednesday, November 22 nd (This lecture WILL be on Exam #3) Dr. Amy Rogers Office Hours: MW 9-10 AM Too small to see with a light microscope Visible with electron

More information

RT-PCR: Two-Step Protocol

RT-PCR: Two-Step Protocol RT-PCR: Two-Step Protocol We will provide both one-step and two-step protocols for RT-PCR. We recommend the twostep protocol for this class. In the one-step protocol, the components of RT and PCR are mixed

More information