Bio 102 Practice Problems Recombinant DNA and Biotechnology

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "Bio 102 Practice Problems Recombinant DNA and Biotechnology"

Transcription

1 Bio 102 Practice Problems Recombinant DNA and Biotechnology Multiple choice: Unless otherwise directed, circle the one best answer: 1. Which of the following DNA sequences could be the recognition site for a restriction enzyme? A. TGCCGT B. TGCGCA C. TGCTGC D. All of the above. E. None of the above. 2. Which of the following is not needed for DNA sequencing by the method we discussed in class? A. Radioactive primer B. DNA polymerase C. Fluorescent dideoxy nucleotides D. Ordinary nucleotides (dntps) E. All of the above are required. 3. What is the key enzyme used in PCR? A. ATP synthase B. Taq DNA polymerase C. DNA ligase D. Restriction enzymes E. Sigma factor Short answer (show your work or thinking to get partial credit): 1. Recombinant human insulin, produced by bacteria carrying a cloned insulin gene, is now the major form of insulin used to treat diabetes. The human insulin gene encodes an mrna only 333 nucleotides long, but the entire gene spans more than 4000 nucleotides. There are three exons and two introns. a. If we were to clone this gene directly from the nuclear DNA, bacteria would not be able to express the insulin protein. Explain why this is true. This gene has introns; bacteria don't. If we cloned the gene directly, the bacteria would produce mrna that includes the introns and be unable to splice it. Therefore, no functional protein could be made. b. What technique should be used instead in order to get a functional insulin coding sequence cloned into bacteria? Describe briefly how this technique works. We should use cdna cloning. In this technique, we isolate mrna from the cytoplasm of a cell, so that it has already been spliced. We then use reverse transcriptase enzyme to make a DNA copy (cdna) of the mrna. This DNA can then be cloned, producing a bacteria-readable gene that lacks introns. c. Every cell in the human body has the same DNA, so every cell has an insulin gene. However, in order to use the technique you described in "b," you would have to start with cells from the pancreas--the only body cells that actually produce the insulin protein. Why are these the only cells that would work? We need insulin mrna in order to do cdna cloning. If the cells are the only ones that make insulin protein, then most likely they are also the only ones that make significant amounts of insulin mrna.

2 2. Human gene therapy remains a promising possibility but is still plagued by problems. In the table below are listed two possible vectors and two problems. For each combination, please briefly explain if the specific problem is expected to be encountered for the vector. Immune Response Insertional Mutagenesis Retroviral Vector Could be a problem; someone who s had a retroviral infection before could be immune to the vector, or if multiple treatments are necessary, development of immunity could be a big drawback. Could be a problem, because the retrovirus inserts DNA randomly into the cell s genome; it could hit a gene by chance. Liposome Should not be a problem. Proteins, not lipids, usually trigger the immune response. Liposomes usually deliver plasmids or other DNA that won t integrate into the genome. Shouldn t be a problem. 3. The diagram below represents a section of the human genome. The coding sequence of a gene, YFG, is shown by an arrow, and boxes indicate the locations of some regulatory sequences. Locations of recognition sequences (cut sites) for three common restriction enzymes (EcoRI, BamHI, and NcoI) are also marked. You would like to clone this gene in E. coli for further study. You have available the expression vector (plasmid) shown below: a. Why is it important for this plasmid to be an expression vector? Eukaryotic genes have regulatory signals like enhancers and TATA boxes that are not recognized by bacteria and lack the -10 and -35 sequences that bacterial RNA polymerase needs to start transcription. In addition, eukaryotic ribosomes find the correct AUG codon by scanning from the cap to the first AUG, while bacteria rely on a Shine-Dalgarno sequence in the mrna. These bacterial regulatory signals are provided by the expression vector. If we use a plasmid that did not have these signals, it's very unlikely that the bacteria would be able to transcribe and translate our gene.

3 b. Why is it important for this plasmid to have an antibiotic-resistance gene? This gives a way to select for bacteria that acquire the plasmid. The frequency of successful transformation is small, so we need a way to know that we got the clone into a cell. Only cells that acquire this plasmid will be able to grow in the presence of this antibiotic. c. What restriction enzyme would you use to clone this gene? Explain your choice. The plasmid has sites for all three restriction enzymes. However, EcoRI cuts the plasmid twice, so we would wind up chopping out a piece of the plasmid, including the needed Shine-Dalgarno region. This is a bad choice. BamHI is also a bad choice, because it cuts in the middle of the gene we want to clone. We want an enzyme that will leave our gene intact. NotI is the best choice. It will cut our gene out of the genome and makes a single cut for inserting it into the plasmid. Notice that it's not important that the enhancer and TATA sequences will be left behind; the plasmid provides the needed regulatory signals. 4. You would like to use PCR to amplify (make many copies of) the boxed section of the DNA sequence below: 5 ACGACCGATAGACGACGTAGGACTTACTTACTTACGTAGGCA 3 3 TGCTGGCTATCTGCTGCATCCTGAATGAATGAATGCATCCGT 5 You ask your lab partner to order a pair of primers that can be used in the PCR reaction. The sequences of the primers he orders are: Primer #1: 5 ATAGAC 3 Primer #2: 5 ACTTAC 3 a. Oops! Looks like you shouldn t have trusted your lab partner on this one. Which of the two primers is wrong, and why won t it work? Primer #1 is OK: it will bind to the bottom strand, and its 3 end will then be pointed in the right direction for Taq DNA polymerase to synthesize the desired DNA. Primer #2 won t work, because it binds to other end of the same strand and so its 3 end is pointed out away from the sequence to be copied: 5 ATAGAC-> 5 ACTTAC-> 3 TGCTGGCTATCTGCTGCATCCTGAATGAATGAATGCATCCGT 5 b. Give the sequence of a primer that will work and could be used instead of the wrong one. Be sure to indicate the 5 and 3 ends. We need a primer that will bind to the top strand, with its 3 end pointed toward the left so that the other strand can be copied. For example, 5 GTAAGT 3 : 5 ACGACCGATAGACGACGTAGGACTTACTTACTTACGTAGGCA 3 <-TGAATG 5 5 ATAGAC-> 3 TGCTGGCTATCTGCTGCATCCTGAATGAATGAATGCATCCGT 5

4 5. You are trying to find the gene responsible for a human genetic disorder. You have mapped the gene to a particular chromosome region, and examining the human genome sequence for that region gives you the nucleotide sequence below: 5 CATACTTACTACTAGATTACGATTAGACGATTAGGATG GCC GAC TCG TGC AGT AAC AGC ATG ACC GAG GCC TAGACCAGATTAGGAGCCGGACCAGGACGGACCAGCGACT 3 a. Assuming you are reading the non-coding strand and that there are no introns, find an open reading frame (ORF) in this region. Circle the point where translation will start, and put a box around the point where translation will stop. Then give the number of amino acids in the protein this gene would encode: 12 amino acids (start codon encodes an amino acid; stop codon doesn t) b. If you wanted to express this gene in E. coli, what would need to be present in your cloning vector to ensure that it will be transcribed and translated? The gene s promoter sequence won t be recognized by E. coli s sigma factor, so you ll need a prokaryotic promoter ( 10 and 35 sequences). E. coli ribosomes can only find the correct start codon by first binding the Shine-Dalgarno sequence, so the vector should also have this sequence positioned just before the desired start codon. c. How might the protein produced by E. coli differ from the protein produced from the same gene in a human cell? The amino-acid sequence (primary structure) will be the same. However, eukaryotic proteins are often modified in the ER or Golgi: carbohydrates added, phosphate groups added, etc. These modifications probably won t happen in E. coli. Also, it s possible that the protein won t be correctly folded, if some specific protein or condition in the eukaryotic cell is needed for folding. 6. You have cloned a cdna encoding a human hormone, and you hope to produce the hormone in bacteria in order to treat a severe genetic disorder. Unfortunately, when you insert this DNA into a plasmid and transform it into the bacteria, you get no hormone production. Give two valid reasons for your failure, and suggest a possible solution in each case. (1) Hormone must be modified after synthesis; bacteria lack ER and Golgi. Solution: determine the needed modification and try to reproduce it chemically, clone needed enzymes or use a eukaryotic host. (2) cdna has no promoter and can t be transcribed. Solution: insert it into an expression vector that includes a promoter. (3) cdna from a eukaryotic cell doesn t have a Shine-Dalgarno sequence needed for translation initiation in bacteria. Solution: insert it into an expression vector that includes a promoter. (4) cdna is made from mrna, and the mrna for the hormone will only be present in a cell that normally produces the hormone. Could be that the source of the DNA needs to be changed. (5) The hormone might be toxic to bacteria. Solution: could try a different cell as the host. 7. Circle the DNA sequence(s) below which could potentially be a recognition site for a restriction enzyme. 5 ATTTTA 3 5 CGCG 3 3 TAAAAT 5 3 GCGC 5 5 GGATCC 3 5 AGGAGG 3 3 CCTAGG 5 3 TCCTCC 5

5 8. A Bio 102 student gets so excited about the tyrosinase experiment that she decides to try to clone the tyrosinase gene. She grinds up some potato, extracts the DNA from it and digests the DNA with two different restriction enzymes (separately, not together): EcoRI and BamHI. She then obtains a cloning vector and digests it with the same two enzymes. She then runs a gel, which is shown at the right. a. Which enzyme would she want to use for cloning the potato DNA: EcoRI, or BamHI? Explain why you made your choice. BamHI, because it only cuts the plasmid once if you cut the plasmid twice, then both pieces must go back together along with your insert in order to get a functional recombinant plasmid. b. Notice that the cloning vector made nice, tight bands on the gel, but the potato DNA just looks like a smear with no distinct bands. However, this is just what the student expected, so she s not worried about it at all. Explain why this is the expected result. Plasmids are small and might have only one or two cut sites for a particular enzyme. The potato genome is huge and will have hundreds or thousands of sites for that enzyme. So we expect many, many more fragments, leading to the smeary appearance. That s OK, though, because after cloning all the fragments (to make a library), we ll have a way to identify the one correct clone. c. The student now mixes the potato DNA (digested with the enzyme you specified in part A) with cloning vector DNA (digested with the same enzyme). She then adds the mixture to E. coli cells that have been treated with CaCl 2, heats briefly to 42 C, adds growth medium and incubates for an hour. What would be her next step? Be as specific as possible. Now the cells would be put on an antibiotic-containing plate. This will kill any cell that didn t get a plasmid and allow those that did to grow into colonies. d. Unfortunately, after doing the next step as you specified, she doesn t get a single bacterial colony. Not even one! When she reviews her procedure, she realizes she left out a critical step. What did she forget, and why would this be necessary? She forgot to add the ligase! Ligase enzyme is needed to join the potato DNA with the cloning vector to make a single, circular recombinant DNA molecule.

6 9. Suppose you want to clone the gene for human Hexokinase, so that you can use bacteria to produce the protein and obtain it in pure form for further study of its activity. a. Your first task is to isolate the hexokinase gene from the human genome. Assuming you have some human DNA on hand and access to the genomic databases on the Web, what technique might you use to obtain pure hexokinase DNA? Since you can use the human genome database to determine the sequence of the enzyme, you can design primers that could be used to amplify only the hexokinase gene from a human DNA sample by PCR. b. In your initial attempt, you succeed in obtaining hexokinase DNA and ligating it into a plasmid vector, but when you transform the recombinant plasmid into bacteria, you get no hexokinase protein produced at all. When you discuss your problem with your friend, she suggests that you might want to start with mrna instead of with DNA. What problem can be overcome by starting with mrna instead? The hexokinase gene, like most human genes, probably contains introns. Bacteria can t splice out introns, so the bacteria couldn t make the correctly processed mrna (with an uninterrupted coding sequence), so they can t make the hexokinase protein starting with the complete human gene. c. What will you need to do with your mrna before you can make a new recombinant plasmid? Use reverse transcriptase to make a DNA copy of it (convert it to cdna). d. What else would you need to provide in order for the bacteria to correctly transcribe and translate the human hexokinase gene? The cdna won t include a promoter (-10 and -35 sequences, for bacteria) or a Shine-Dalgarno sequence, so the bacteria may not correctly recognize the gene unless these are added. An expression vector is commonly used for cloning cdna for this reason. e. After consulting genome databases, you find that the human hexokinase amino-acid sequence begins with Met-Trp-Lys-Trp- Trp-Met. But the protein made from your plasmid begins with Met-Trp-Met-Trp-Trp-Met! A mutation must have occurred! Below, write the DNA sequence of the non-template strand for the beginning of the actual (unmutated) hexokinase gene. Don t forget 5 and 3 ends. There is only one codon for Met, AUG, and only one codon for Trp, UGG. So the mrna sequence for the un-mutated gene must be: 5 -AUG-UGG-(Lys)-UGG-UGG-AUG. But, there are two possible codons for Lys: AAA and AAG. How could we know which one it was? Well, in the mutated version, Lys is changed to Met (AUG). AAG could change to AUG with only one mutation, while AAA would need two mutations to change to AUG. So it s most likely that the Lys codon was AAG. Now we have 5 - AUG-UGG-AAG- UGG-UGG-AUG for the mrna. Now, the question asks us for the non-template strand of the DNA. The non-template strand looks like the mrna, but of course it would have T s, not U s. So: 5 -ATGTGGAAGTGGTGGATG. f. Perhaps you could salvage your recombinant protein by treating it with a mutagen in order to get a reversion mutation that restores the correct amino-acid sequence! Which of the following mutagens might work? Circle all that apply. 1) ethidium bromide (makes one-base insertions or deletions) 2) aminopurine (causes A G substitutions) 3) imidazolecarboxamide (causes A T substitutions) This could work because it could change the Met codon (TAC on the template strand) to TTC, which would be AAG (Lys) in the mrna. 4) aflatoxin B 1 (allows any nucleotide to base-pair with a T during replication) This could work because it could affect the T in the ATG Met codon; if T paired with T, we would get TTG on the template strand, producing an AAC Lys codon.

7 10. Explain one significant problem with using retroviruses for gene therapy. (1) Because they insert DNA randomly into host DNA, they could produce a mutation (2) Because they contain a promoter, they could affect expression of other genes near the insertion Matching: 1. In our example of cloning insulin, we used several different enzymes. Match each enzyme below with its function in the cloning process. F Reverse transcriptase a. Separating strands of DNA for PCR b. Causing sticky ends to hydrogen bond G Restriction enzyme c. Copying a specific region of DNA D DNA ligase d. Covalently joining a DNA fragment to a cloning vector e. Transcribing the recombinant gene C Taq DNA polymerase f. Making a DNA copy of RNA g. Cutting DNA backbone at a specific sequence J DNA helicase h. Replicating plasmid j. Not used in cloning 2. Matching. Match the enzymes on the left with their roles in gene cloning on the right. You may use the letters once, more than once or not at all, but only one letter per blank. E F A B F DNA ligase DNA polymerase Restriction enzyme Reverse transcriptase Helicase a. Cut expression vector to produce sticky ends b. Produce cdna from mrna c. Separate strands of double-stranded DNA d. Produce many copies of a specific DNA sequence e. Make covalent bonds between two DNA molecules f. Not used in gene cloning

Recombinant DNA technology (genetic engineering) involves combining genes from different sources into new cells that can express the genes.

Recombinant DNA technology (genetic engineering) involves combining genes from different sources into new cells that can express the genes. Recombinant DNA technology (genetic engineering) involves combining genes from different sources into new cells that can express the genes. Recombinant DNA technology has had-and will havemany important

More information

Chapter 20: Biotechnology: DNA Technology & Genomics

Chapter 20: Biotechnology: DNA Technology & Genomics Biotechnology Chapter 20: Biotechnology: DNA Technology & Genomics The BIG Questions How can we use our knowledge of DNA to: o Diagnose disease or defect? o Cure disease or defect? o Change/improve organisms?

More information

Chapter 10 Manipulating Genes

Chapter 10 Manipulating Genes How DNA Molecules Are Analyzed Chapter 10 Manipulating Genes Until the development of recombinant DNA techniques, crucial clues for understanding how cell works remained lock in the genome. Important advances

More information

Chapter 12 - DNA Technology

Chapter 12 - DNA Technology Bio 100 DNA Technology 1 Chapter 12 - DNA Technology Among bacteria, there are 3 mechanisms for transferring genes from one cell to another cell: transformation, transduction, and conjugation 1. Transformation

More information

DNA TECHNOLOGY- methods for studying and manipulating genetic material.

DNA TECHNOLOGY- methods for studying and manipulating genetic material. 1 DNA TECHNOLOGY- methods for studying and manipulating genetic material. BIOTECHNOLOGY, the manipulation of organisms or their components to make useful products. Biotechnology today usually refers to

More information

Structure and Function of DNA

Structure and Function of DNA Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four

More information

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology

More information

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Biotechnology and reporter genes Here, a lentivirus is used to carry foreign DNA into chickens. A reporter gene (GFP)indicates that foreign DNA has been successfully transferred. Recombinant DNA continued

More information

SESSION 2. Possible answer:

SESSION 2. Possible answer: UPDATED CLONE THAT GENE ACTIVITY 2014 TEACHER GUIDE SESSION 2 Key ideas: When creating a recombinant plasmid, it is important to examine the sequences of the plasmid DNA and of the human DNA that contains

More information

Ch. 12: DNA and RNA 12.1 DNA Chromosomes and DNA Replication

Ch. 12: DNA and RNA 12.1 DNA Chromosomes and DNA Replication Ch. 12: DNA and RNA 12.1 DNA A. To understand genetics, biologists had to learn the chemical makeup of the gene Genes are made of DNA DNA stores and transmits the genetic information from one generation

More information

Genetics Faculty of Agriculture and Veterinary Medicine

Genetics Faculty of Agriculture and Veterinary Medicine Genetics 10201232 Faculty of Agriculture and Veterinary Medicine Instructor: Dr. Jihad Abdallah Topic 15:Recombinant DNA Technology 1 Recombinant DNA Technology Recombinant DNA Technology is the use of

More information

Biotechnology: DNA Technology & Genomics

Biotechnology: DNA Technology & Genomics Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 The BIG Questions How can we use our knowledge of DNA to: diagnose disease or defect? cure disease or defect? change/improve organisms? What

More information

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna

More information

The correct answer is c B. Answer b is incorrect. Type II enzymes recognize and cut a specific site, not at random sites.

The correct answer is c B. Answer b is incorrect. Type II enzymes recognize and cut a specific site, not at random sites. 1. A recombinant DNA molecules is one that is a. produced through the process of crossing over that occurs in meiosis b. constructed from DNA from different sources c. constructed from novel combinations

More information

Transcription & Translation. Part of Protein Synthesis

Transcription & Translation. Part of Protein Synthesis Transcription & Translation Part of Protein Synthesis Three processes Initiation Transcription Elongation Termination Initiation The RNA polymerase binds to the DNA molecule upstream of the gene at the

More information

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,

More information

Recombinant DNA Technology

Recombinant DNA Technology PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology

More information

Chapter 17: From Gene to Protein

Chapter 17: From Gene to Protein Name Period This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect to spend at least 6 hours to truly master

More information

NAME: Microbiology BI234 MUST be written and will not be accepted as a typed document.

NAME: Microbiology BI234 MUST be written and will not be accepted as a typed document. Chapter 8 Study Guide What is the study of genetics, and what topics does it focus on? What is a genome? NAME: Microbiology BI234 MUST be written and will not be accepted as a typed document. Describe

More information

CHAPTER 8 RECOMBINANT DNA and GENETIC ENGINEERING

CHAPTER 8 RECOMBINANT DNA and GENETIC ENGINEERING CHAPTER 8 RECOMBINANT DNA and GENETIC ENGINEERING Questions to be addressed: How are recombinant DNA molecules generated in vitro? How is recombinant DNA amplified? What analytical techniques are used

More information

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!! DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other

More information

From DNA to Protein. Chapter 14

From DNA to Protein. Chapter 14 From DNA to Protein Chapter 14 Impacts, Issues: Ricin and your Ribosomes Ricin is toxic because it inactivates ribosomes, the organelles which assemble amino acids into proteins, critical to life processes

More information

DNA replication. DNA RNA Protein

DNA replication. DNA RNA Protein DNA replication The central dogma of molecular biology transcription translation DNA RNA Protein replication Revers transcriptase The information stored by DNA: - protein structure - the regulation of

More information

Chapter 9. Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA

Chapter 9. Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA Chapter 9 Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA Q&A Interferons are species specific, so that interferons to be used in humans must be produced in human cells. Can you think

More information

Today-applications: Medicine-better health Pharmaceutical-production of antibiotics Foods-wine, cheese, beer Agriculture-selective breeding

Today-applications: Medicine-better health Pharmaceutical-production of antibiotics Foods-wine, cheese, beer Agriculture-selective breeding I. Genetic Engineering modification of DNA of organisms to produce new genes with new characteristics -genes are small compared to chromosomes -need methods to get gene-sized pieces of DNA -direct manipulation

More information

Bioinformatics: Network Analysis

Bioinformatics: Network Analysis Bioinformatics: Network Analysis Molecular Cell Biology: A Brief Review COMP 572 (BIOS 572 / BIOE 564) - Fall 2013 Luay Nakhleh, Rice University 1 The Tree of Life 2 Prokaryotic vs. Eukaryotic Cell Structure

More information

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins

More information

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d. 13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both

More information

Biotechnology and Recombinant DNA

Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA Recombinant DNA procedures - an overview Biotechnology: The use of microorganisms, cells, or cell components to make a product. Foods, antibiotics, vitamins, enzymes Recombinant

More information

DNA: Molecule of Life

DNA: Molecule of Life DNA: Molecule of Life History DNA Structure Protein Synthesis Gene Regulation History of DNA H I S T O By the 1940 s, scientists knew that chromosomes consisted of both DNA and protein but did not know

More information

Section 1 Workbook (unit 2) ANSWERS

Section 1 Workbook (unit 2) ANSWERS Section 1 Workbook (unit 2) ANSWERS Complete the following table: nucleotide DNA RN Name: B5. Describe DNA replication 1) Label each base given in the diagram below and describe the 4 primary characteristics

More information

Chapter 10: Protein Synthesis. Biology

Chapter 10: Protein Synthesis. Biology Chapter 10: Protein Synthesis Biology Let s Review What are proteins? Chains of amino acids Some are enzymes Some are structural components of cells and tissues More Review What are ribosomes? Cell structures

More information

B5 B8 ANWERS DNA & ) DNA

B5 B8 ANWERS DNA & ) DNA Review sheet for test B5 B8 ANWERS DNA review 1. What bonds hold complementary bases between 2 strands of DNA together? Hydrogen bonds 2. What bonds exist between sugars and phosphates? Covalent bonds

More information

Study Guide Chapter 12

Study Guide Chapter 12 Study Guide Chapter 12 1. Know ALL of your vocabulary words! 2. Name the following scientists with their contributions to Discovering DNA: a. Strains can be transformed (or changed) into other forms while

More information

Transcription Animations

Transcription Animations Transcription Animations Name: Lew Ports Biology Place http://www.lewport.wnyric.org/jwanamaker/animations/protein%20synthesis%20-%20long.html Protein is the making of proteins from the information found

More information

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes

More information

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled Biology 101 Chapter 14 Name: Fill-in-the-Blanks Which base follows the next in a strand of DNA is referred to. as the base (1) Sequence. The region of DNA that calls for the assembly of specific amino

More information

Tools and Techniques. Chapter 10. Genetic Engineering. Restriction endonuclease. 1. Enzymes

Tools and Techniques. Chapter 10. Genetic Engineering. Restriction endonuclease. 1. Enzymes Chapter 10. Genetic Engineering Tools and Techniques 1. Enzymes 2. 3. Nucleic acid hybridization 4. Synthesizing DNA 5. Polymerase Chain Reaction 1 2 1. Enzymes Restriction endonuclease Ligase Reverse

More information

Biochem 717 Gene Cloning. Prof Amer Jamil Dept of Biochemistry University of Agriculture Faisalabad

Biochem 717 Gene Cloning. Prof Amer Jamil Dept of Biochemistry University of Agriculture Faisalabad Biochem 717 Gene Cloning Prof Amer Jamil Dept of Biochemistry University of Agriculture Faisalabad How to construct a recombinant DNA molecule? DNA isolation Cutting of DNA molecule with the help of restriction

More information

Biol 101 Exam 5: Molecular Genetics Fall 2008

Biol 101 Exam 5: Molecular Genetics Fall 2008 MULTIPLE CHOICE. This exam has 60 questions. All answers go on the SCANTRON provided. Choose the one alternative that best completes the statement or answers the question. 1) The genetic material of all

More information

Recombinant DNA and Biotechnology

Recombinant DNA and Biotechnology Recombinant DNA and Biotechnology Chapter 18 Lecture Objectives What Is Recombinant DNA? How Are New Genes Inserted into Cells? What Sources of DNA Are Used in Cloning? What Other Tools Are Used to Study

More information

restriction enzymes 350 Home R. Ward: Spring 2001

restriction enzymes 350 Home R. Ward: Spring 2001 restriction enzymes 350 Home Restriction Enzymes (endonucleases): molecular scissors that cut DNA Properties of widely used Type II restriction enzymes: recognize a single sequence of bases in dsdna, usually

More information

SAM Teacher s Guide DNA to Proteins

SAM Teacher s Guide DNA to Proteins SAM Teacher s Guide DNA to Proteins Note: Answers to activity and homework questions are only included in the Teacher Guides available after registering for the SAM activities, and not in this sample version.

More information

Lecture 13. Molecular Cloning

Lecture 13. Molecular Cloning Lecture 13 Molecular Cloning Recombinant DNA technology depends on the ability to produce large numbers of identical DNA molecules (clones). Clones are typically generated by placing a DNA fragment of

More information

Genetics Module B, Anchor 3

Genetics Module B, Anchor 3 Genetics Module B, Anchor 3 Key Concepts: - An individual s characteristics are determines by factors that are passed from one parental generation to the next. - During gamete formation, the alleles for

More information

Unit 6 ~ Learning Guide

Unit 6 ~ Learning Guide Unit 6 ~ Learning Guide Name: INSTRUCTIONS Complete the following notes and questions as you work through the related lessons. You are required to have this package completed BEFORE you write your unit

More information

Complementary Base Pairs: A and T. DNA contains complementary base pairs in which adenine is always linked by two hydrogen bonds to thymine (A T).

Complementary Base Pairs: A and T. DNA contains complementary base pairs in which adenine is always linked by two hydrogen bonds to thymine (A T). Complementary Base Pairs: A and T DNA contains complementary base pairs in which adenine is always linked by two hydrogen bonds to thymine (A T). Complementary Base Pairs: G and C DNA contains complementary

More information

From Gene to Protein. Chapter 17. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for

From Gene to Protein. Chapter 17. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for Chapter 17 From Gene to Protein PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp

More information

BIOLOGICAL BACKGROUND THE CENTRAL DOGMA OF MOLECULAR BIOLOGY

BIOLOGICAL BACKGROUND THE CENTRAL DOGMA OF MOLECULAR BIOLOGY BIOLOGICAL BACKGROUND Central Dogma DNA and RNA Structure Replication, Transcription and Translation Techniques of Molecular Genetics Using restriction enzymes Using PCR THE CENTRAL DOGMA OF MOLECULAR

More information

BIOTECHNOLOGY. What can we do with DNA?

BIOTECHNOLOGY. What can we do with DNA? BIOTECHNOLOGY What can we do with DNA? Biotechnology Manipulation of biological organisms or their components for research and industrial purpose Usually manipulate DNA itself How to study individual gene?

More information

Transcription Activity Guide

Transcription Activity Guide Transcription Activity Guide Teacher Key Ribonucleic Acid (RNA) Introduction Central Dogma: DNA to RNA to Protein Almost all dynamic functions in a living organism depend on proteins. Proteins are molecular

More information

Solutions to Problem Set 5

Solutions to Problem Set 5 MIT Biology Department 7.012: Introductory Biology - Fall 2004 Instructors: Professor Eric Lander, Professor Robert A. Weinberg, Dr. Claudette Gardel Question 1 Solutions to 7.012 Problem Set 5 Restriction

More information

Biotechnology Test Test

Biotechnology Test Test Log In Sign Up Biotechnology Test Test 15 Matching Questions Regenerate Test 1. Plasmid 2. PCR Process 3. humulin 4. pluripotent 5. polymerase chain reaction (PCR) a b Is much smaller than the human genome,

More information

Solutions for Recombinant DNA Unit Exam

Solutions for Recombinant DNA Unit Exam Solutions for Recombinant DNA Unit Exam Question 1 Restriction enzymes are extensively used in molecular biology. Below are the recognition sites of two of these enzymes, BamHI and BclI. a) BamHI, cleaves

More information

Genetics. Chapter 9. Chromosome. Genes Three categories. Flow of Genetics/Information The Central Dogma. DNA RNA Protein

Genetics. Chapter 9. Chromosome. Genes Three categories. Flow of Genetics/Information The Central Dogma. DNA RNA Protein Chapter 9 Topics - Genetics - Flow of Genetics/Information - Regulation - Mutation - Recombination gene transfer Genetics Genome - the sum total of genetic information in a organism Genotype - the A's,

More information

Transcription and Translation of DNA

Transcription and Translation of DNA Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes

More information

1. Which of the following correctly organizes genetic material from the broadest category to the most specific category?

1. Which of the following correctly organizes genetic material from the broadest category to the most specific category? DNA and Genetics 1. Which of the following correctly organizes genetic material from the broadest category to the most specific category? A. genome chromosome gene DNA molecule B. genome chromosome DNA

More information

Protein Synthesis How Genes Become Constituent Molecules

Protein Synthesis How Genes Become Constituent Molecules Protein Synthesis Protein Synthesis How Genes Become Constituent Molecules Mendel and The Idea of Gene What is a Chromosome? A chromosome is a molecule of DNA 50% 50% 1. True 2. False True False Protein

More information

2.7 DNA replication, transcription and translation

2.7 DNA replication, transcription and translation 2.7 DNA replication, transcription and translation Essential Idea: Genetic information in DNA can be accurately copied and can be translated to make the proteins needed by the cell. The image shows an

More information

Sample Questions for Exam 3

Sample Questions for Exam 3 Sample Questions for Exam 3 1. All of the following occur during prometaphase of mitosis in animal cells except a. the centrioles move toward opposite poles. b. the nucleolus can no longer be seen. c.

More information

POGIL Cell Biology Activity 6 DNA Replication MODEL 1: "Replication Bubble"

POGIL Cell Biology Activity 6 DNA Replication MODEL 1: Replication Bubble POGIL Cell Biology Activity 6 DNA Replication MODEL 1: "Replication Bubble" The circle is an E. coli chromosome at the beginning of DNA synthesis. The original DNA strands are called "parental strands".

More information

Recombinant DNA Unit Exam

Recombinant DNA Unit Exam Recombinant DNA Unit Exam Question 1 Restriction enzymes are extensively used in molecular biology. Below are the recognition sites of two of these enzymes, BamHI and BclI. a) BamHI, cleaves after the

More information

Recipient Cell. DNA Foreign DNA. Recombinant DNA

Recipient Cell. DNA Foreign DNA. Recombinant DNA Module 4B Biotechnology In this module, we will examine some of the techniques scientists have developed to study and manipulate the DNA of living organisms. Objective # 7 Explain what genetic recombination

More information

Name Class Date. KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype. frameshift mutation

Name Class Date. KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype. frameshift mutation Unit 7 Study Guide Section 8.7: Mutations KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype. VOCABULARY mutation point mutation frameshift mutation mutagen MAIN IDEA: Some mutations

More information

Microbiology / Active Lecture Questions Chapter 9 Biotechnology & Recombinant DNA 1 Chapter 9 Biotechnology & Recombinant DNA

Microbiology / Active Lecture Questions Chapter 9 Biotechnology & Recombinant DNA 1 Chapter 9 Biotechnology & Recombinant DNA 1 2 Restriction enzymes were first discovered with the observation that a. DNA is restricted to the nucleus. b. phage DNA is destroyed in a host cell. c. foreign DNA is kept out of a cell. d. foreign DNA

More information

AP BIOLOGY 2007 SCORING GUIDELINES

AP BIOLOGY 2007 SCORING GUIDELINES AP BIOLOGY 2007 SCORING GUIDELINES Question 4 A bacterial plasmid is 100 kb in length. The plasmid DNA was digested to completion with two restriction enzymes in three separate treatments: EcoRI, HaeIII,

More information

1 Mutation and Genetic Change

1 Mutation and Genetic Change CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds

More information

It took a while for biologists to figure out that genetic information was carried on DNA.

It took a while for biologists to figure out that genetic information was carried on DNA. DNA Finally, we want to understand how all of the things we've talked about (genes, alleles, meiosis, etc.) come together at the molecular level. Ultimately, what is an allele? What is a gene? How does

More information

Recombinant DNA Technology

Recombinant DNA Technology Recombinant DNA Technology Dates in the Development of Gene Cloning: 1965 - plasmids 1967 - ligase 1970 - restriction endonucleases 1972 - first experiments in gene splicing 1974 - worldwide moratorium

More information

Genetics Notes C. Molecular Genetics

Genetics Notes C. Molecular Genetics Genetics Notes C Molecular Genetics Vocabulary central dogma of molecular biology Chargaff's rules messenger RNA (mrna) ribosomal RNA (rrna) transfer RNA (trna) Your DNA, or deoxyribonucleic acid, contains

More information

AP Biology Review Packet 4: Viruses, Bacteria and Expression & DNA Technology

AP Biology Review Packet 4: Viruses, Bacteria and Expression & DNA Technology AP Biology Review Packet 4: Viruses, Bacteria and Expression & DNA Technology 3A1- DNA, and in some cases RNA, is the primary source of heritable information. 3B1- Gene Regulation results in differential

More information

Name Period _. Regents Biology Date _ REVIEW 5: GENETICS

Name Period _. Regents Biology Date _ REVIEW 5: GENETICS Name Period _ Regents Biology Date _ REVIEW 5: GENETICS 1. Chromosomes: a. Humans have 46 chromosomes, or _23 _ homologous pairs. Homologous: _Chromosomes of the same position and size b. Chromosome pairs

More information

3. comparison with proteins of known function

3. comparison with proteins of known function Lectures 26 and 27 recombinant DNA technology I. oal of genetics A. historically - easy to isolate total DNA - difficult to isolate individual gene B. recombinant DNA technology C. why get the gene? 1.

More information

CCR Biology - Chapter 9 Practice Test - Summer 2012

CCR Biology - Chapter 9 Practice Test - Summer 2012 Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible

More information

What s the Point? --- Point, Frameshift, Inversion, & Deletion Mutations

What s the Point? --- Point, Frameshift, Inversion, & Deletion Mutations What s the Point? --- Point, Frameshift, Inversion, & Deletion Mutations http://members.cox.net/amgough/mutation_chromosome_translocation.gif Introduction: In biology, mutations are changes to the base

More information

DNA & Protein Synthesis Exam

DNA & Protein Synthesis Exam DNA & Protein Synthesis Exam DO NOT WRITE ON EXAM EXAM # VER. B Multiple choice Directions: Answer the following questions based on the following diagram. (1pt. each) 5. The above nucleotide is purine

More information

Woods Biol Hmwk DNA & Genetic Engineering (key) Pg. 1

Woods Biol Hmwk DNA & Genetic Engineering (key) Pg. 1 Woods Biol Hmwk-6 10-1 DNA & Genetic Engineering (key) Pg. 1 NOTE: Unless otherwise indicated in the problem, DNA will be from the Template strand. Figure 1: Look carefully at Fig s 1 & 2 to determine

More information

Isolation and Electrophoresis of Plasmid DNA

Isolation and Electrophoresis of Plasmid DNA Name Date Isolation and Electrophoresis of Plasmid DNA Prior to lab you should be able to: o Explain what cloning a gene accomplishes for a geneticist. o Describe what a plasmid is. o Describe the function

More information

Unit 6 Study Guide Protein Name pg I can tell the difference between mrna, trna, and rrna.

Unit 6 Study Guide Protein Name pg I can tell the difference between mrna, trna, and rrna. Unit 6 Study Guide Protein Name pg. 1 1. I can tell the difference between mrna, trna, and rrna. Messenger RNA (mrna) acts as a copy of the instructions for making a protein. mrna carries these instructions

More information

Appendix D: Pre-lab Assignments and Gel Electrophoresis Worksheet

Appendix D: Pre-lab Assignments and Gel Electrophoresis Worksheet Appendix D: Pre-lab Assignments and Gel Electrophoresis Worksheet PCR Pre-Lab (pg. 1-3) PCR Pre-Lab Answers (pg. 4-7) RNAi Pre-Lab (pg. 8) RNAi Pre-Lab Answers (pg. 9-10 Gel Electrophoresis Worksheet (pg.

More information

11/19/2008. Gene analysis. Sequencing PCR. Northern-blot RT PCR. Western-blot Sequencing. in situ hybridization. Southern-blot

11/19/2008. Gene analysis. Sequencing PCR. Northern-blot RT PCR. Western-blot Sequencing. in situ hybridization. Southern-blot Recombinant technology Gene analysis Sequencing PCR RNA Northern-blot RT PCR Protein Western-blot Sequencing Southern-blot in situ hybridization in situ hybridization Function analysis Histochemical analysis

More information

RNA & Protein Synthesis

RNA & Protein Synthesis RNA & Protein Synthesis Genes send messages to cellular machinery RNA Plays a major role in process Process has three phases (Genetic) Transcription (Genetic) Translation Protein Synthesis RNA Synthesis

More information

2006 7.012 Problem Set 3 KEY

2006 7.012 Problem Set 3 KEY 2006 7.012 Problem Set 3 KEY Due before 5 PM on FRIDAY, October 13, 2006. Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. Which reaction is catalyzed by each

More information

BNFO601: Introduction to Bioinformatics Protein Overexpression: Structure vs. Function

BNFO601: Introduction to Bioinformatics Protein Overexpression: Structure vs. Function BNFO601: Introduction to Bioinformatics Protein Overexpression: Structure vs. Function I. Overview of protein overexpression Take a look at that Pepsi (non-diet): high fructose corn syrup. Well, corn syrup

More information

Ingenious Genes Curriculum Links for AQA AS (7401) and A-Level Biology (7402)

Ingenious Genes Curriculum Links for AQA AS (7401) and A-Level Biology (7402) Ingenious Genes Curriculum Links for AQA AS (7401) and A-Level Biology (7402) 3.1.1 Monomers and Polymers 3.1.4 Proteins 3.1.5 Nucleic acids are important information-carrying molecules 3.2.1 Cell structure

More information

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results

More information

AP Biology -- John Burroughs School -- M. Bahe

AP Biology -- John Burroughs School -- M. Bahe Objectives for Test Eight: Chapter 13 14, 15.2, 17.1 DNA, Protein Synthesis, Gene Regulation & Biotechnology You should be able to: 1. Identify the scientists who contributed pieces of the genetic puzzle,"

More information

The Steps. 1. Transcription. 2. Transferal. 3. Translation

The Steps. 1. Transcription. 2. Transferal. 3. Translation Protein Synthesis Protein synthesis is simply the "making of proteins." Although the term itself is easy to understand, the multiple steps that a cell in a plant or animal must go through are not. In order

More information

DNA Scissors: Introduction to Restriction Enzymes

DNA Scissors: Introduction to Restriction Enzymes DNA Scissors: Introduction to Restriction Enzymes Objectives At the end of this activity, students should be able to 1. Describe a typical restriction site as a 4- or 6-base- pair palindrome; 2. Describe

More information

STANDARD 2 Students will demonstrate appropriate safety procedures and equipment use in the laboratory.

STANDARD 2 Students will demonstrate appropriate safety procedures and equipment use in the laboratory. BIOTECHNOLOGY Levels: 11-12 Units of Credit: 1.0 CIP Code: 51.1201 Prerequisite: Biology or Chemistry Skill Certificates: #708 COURSE DESCRIPTION is an exploratory course designed to create an awareness

More information

No growth: Mutant cells cannot grow and divide Minimal medium. Classes of Neurospora crassa. Class I mutants Class II mutants Class III mutants

No growth: Mutant cells cannot grow and divide Minimal medium. Classes of Neurospora crassa. Class I mutants Class II mutants Class III mutants EXPERIMENT Growth: Wild-type cells growing and dividing No growth: Mutant cells cannot grow and divide Minimal medium RESULTS Minimal medium (MM) (control) Wild type Classes of Neurospora crassa Class

More information

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,

More information

Bio 102 Practice Problems Chromosomes and DNA Replication

Bio 102 Practice Problems Chromosomes and DNA Replication Bio 102 Practice Problems Chromosomes and DNA Replication Multiple choice: Unless otherwise directed, circle the one best answer: 1. Which one of the following enzymes is NT a key player in the process

More information

DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA

DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA DNA Fingerprinting Unless they are identical twins, individuals have unique DNA DNA fingerprinting The name used for the unambiguous identifying technique that takes advantage of differences in DNA sequence

More information

AP BIOLOGY 2009 SCORING GUIDELINES (Form B)

AP BIOLOGY 2009 SCORING GUIDELINES (Form B) AP BIOLOGY 2009 SCORING GUIDELINES (Form B) Question 1 Describe how a plasmid can be genetically modified to include a piece of foreign DNA that alters the phenotype of bacterial cells transformed with

More information

HCS604.03 Exercise 1 Dr. Jones Spring 2005. Recombinant DNA (Molecular Cloning) exercise:

HCS604.03 Exercise 1 Dr. Jones Spring 2005. Recombinant DNA (Molecular Cloning) exercise: HCS604.03 Exercise 1 Dr. Jones Spring 2005 Recombinant DNA (Molecular Cloning) exercise: The purpose of this exercise is to learn techniques used to create recombinant DNA or clone genes. You will clone

More information

PRACTICE TEST QUESTIONS

PRACTICE TEST QUESTIONS PART A: MULTIPLE CHOICE QUESTIONS PRACTICE TEST QUESTIONS DNA & PROTEIN SYNTHESIS B 1. One of the functions of DNA is to A. secrete vacuoles. B. make copies of itself. C. join amino acids to each other.

More information

16 Protein Synthesis: Transcription and Translation

16 Protein Synthesis: Transcription and Translation 16 Protein Synthesis: Transcription and Translation Ge n e s c a r r y t h e information that, along with environmental factors, determines an organism s traits. How does this work? Although the complete

More information

DNA, genes and chromosomes

DNA, genes and chromosomes DNA, genes and chromosomes Learning objectives By the end of this learning material you would have learnt about the components of a DNA and the process of DNA replication, gene types and sequencing and

More information

MOLECULAR BIOLOGY OVERVIEW NUCLEIC ACIDS: THE BASICS

MOLECULAR BIOLOGY OVERVIEW NUCLEIC ACIDS: THE BASICS MOLECULAR BIOLOGY OVERVIEW NUCLEIC ACIDS: THE BASICS Richard L. Hodinka, Ph.D. University of South Carolina School of Medicine Greenville Greenville Health System, Greenville, SC hodinka@greenvillemed.sc.edu

More information