Bio 102 Practice Problems Recombinant DNA and Biotechnology

Size: px
Start display at page:

Download "Bio 102 Practice Problems Recombinant DNA and Biotechnology"

Transcription

1 Bio 102 Practice Problems Recombinant DNA and Biotechnology Multiple choice: Unless otherwise directed, circle the one best answer: 1. Which of the following DNA sequences could be the recognition site for a restriction enzyme? A. TGCCGT B. TGCGCA C. TGCTGC D. All of the above. E. None of the above. 2. Which of the following is not needed for DNA sequencing by the method we discussed in class? A. Radioactive primer B. DNA polymerase C. Fluorescent dideoxy nucleotides D. Ordinary nucleotides (dntps) E. All of the above are required. 3. What is the key enzyme used in PCR? A. ATP synthase B. Taq DNA polymerase C. DNA ligase D. Restriction enzymes E. Sigma factor Short answer (show your work or thinking to get partial credit): 1. Recombinant human insulin, produced by bacteria carrying a cloned insulin gene, is now the major form of insulin used to treat diabetes. The human insulin gene encodes an mrna only 333 nucleotides long, but the entire gene spans more than 4000 nucleotides. There are three exons and two introns. a. If we were to clone this gene directly from the nuclear DNA, bacteria would not be able to express the insulin protein. Explain why this is true. This gene has introns; bacteria don't. If we cloned the gene directly, the bacteria would produce mrna that includes the introns and be unable to splice it. Therefore, no functional protein could be made. b. What technique should be used instead in order to get a functional insulin coding sequence cloned into bacteria? Describe briefly how this technique works. We should use cdna cloning. In this technique, we isolate mrna from the cytoplasm of a cell, so that it has already been spliced. We then use reverse transcriptase enzyme to make a DNA copy (cdna) of the mrna. This DNA can then be cloned, producing a bacteria-readable gene that lacks introns. c. Every cell in the human body has the same DNA, so every cell has an insulin gene. However, in order to use the technique you described in "b," you would have to start with cells from the pancreas--the only body cells that actually produce the insulin protein. Why are these the only cells that would work? We need insulin mrna in order to do cdna cloning. If the cells are the only ones that make insulin protein, then most likely they are also the only ones that make significant amounts of insulin mrna.

2 2. Human gene therapy remains a promising possibility but is still plagued by problems. In the table below are listed two possible vectors and two problems. For each combination, please briefly explain if the specific problem is expected to be encountered for the vector. Immune Response Insertional Mutagenesis Retroviral Vector Could be a problem; someone who s had a retroviral infection before could be immune to the vector, or if multiple treatments are necessary, development of immunity could be a big drawback. Could be a problem, because the retrovirus inserts DNA randomly into the cell s genome; it could hit a gene by chance. Liposome Should not be a problem. Proteins, not lipids, usually trigger the immune response. Liposomes usually deliver plasmids or other DNA that won t integrate into the genome. Shouldn t be a problem. 3. The diagram below represents a section of the human genome. The coding sequence of a gene, YFG, is shown by an arrow, and boxes indicate the locations of some regulatory sequences. Locations of recognition sequences (cut sites) for three common restriction enzymes (EcoRI, BamHI, and NcoI) are also marked. You would like to clone this gene in E. coli for further study. You have available the expression vector (plasmid) shown below: a. Why is it important for this plasmid to be an expression vector? Eukaryotic genes have regulatory signals like enhancers and TATA boxes that are not recognized by bacteria and lack the -10 and -35 sequences that bacterial RNA polymerase needs to start transcription. In addition, eukaryotic ribosomes find the correct AUG codon by scanning from the cap to the first AUG, while bacteria rely on a Shine-Dalgarno sequence in the mrna. These bacterial regulatory signals are provided by the expression vector. If we use a plasmid that did not have these signals, it's very unlikely that the bacteria would be able to transcribe and translate our gene.

3 b. Why is it important for this plasmid to have an antibiotic-resistance gene? This gives a way to select for bacteria that acquire the plasmid. The frequency of successful transformation is small, so we need a way to know that we got the clone into a cell. Only cells that acquire this plasmid will be able to grow in the presence of this antibiotic. c. What restriction enzyme would you use to clone this gene? Explain your choice. The plasmid has sites for all three restriction enzymes. However, EcoRI cuts the plasmid twice, so we would wind up chopping out a piece of the plasmid, including the needed Shine-Dalgarno region. This is a bad choice. BamHI is also a bad choice, because it cuts in the middle of the gene we want to clone. We want an enzyme that will leave our gene intact. NotI is the best choice. It will cut our gene out of the genome and makes a single cut for inserting it into the plasmid. Notice that it's not important that the enhancer and TATA sequences will be left behind; the plasmid provides the needed regulatory signals. 4. You would like to use PCR to amplify (make many copies of) the boxed section of the DNA sequence below: 5 ACGACCGATAGACGACGTAGGACTTACTTACTTACGTAGGCA 3 3 TGCTGGCTATCTGCTGCATCCTGAATGAATGAATGCATCCGT 5 You ask your lab partner to order a pair of primers that can be used in the PCR reaction. The sequences of the primers he orders are: Primer #1: 5 ATAGAC 3 Primer #2: 5 ACTTAC 3 a. Oops! Looks like you shouldn t have trusted your lab partner on this one. Which of the two primers is wrong, and why won t it work? Primer #1 is OK: it will bind to the bottom strand, and its 3 end will then be pointed in the right direction for Taq DNA polymerase to synthesize the desired DNA. Primer #2 won t work, because it binds to other end of the same strand and so its 3 end is pointed out away from the sequence to be copied: 5 ATAGAC-> 5 ACTTAC-> 3 TGCTGGCTATCTGCTGCATCCTGAATGAATGAATGCATCCGT 5 b. Give the sequence of a primer that will work and could be used instead of the wrong one. Be sure to indicate the 5 and 3 ends. We need a primer that will bind to the top strand, with its 3 end pointed toward the left so that the other strand can be copied. For example, 5 GTAAGT 3 : 5 ACGACCGATAGACGACGTAGGACTTACTTACTTACGTAGGCA 3 <-TGAATG 5 5 ATAGAC-> 3 TGCTGGCTATCTGCTGCATCCTGAATGAATGAATGCATCCGT 5

4 5. You are trying to find the gene responsible for a human genetic disorder. You have mapped the gene to a particular chromosome region, and examining the human genome sequence for that region gives you the nucleotide sequence below: 5 CATACTTACTACTAGATTACGATTAGACGATTAGGATG GCC GAC TCG TGC AGT AAC AGC ATG ACC GAG GCC TAGACCAGATTAGGAGCCGGACCAGGACGGACCAGCGACT 3 a. Assuming you are reading the non-coding strand and that there are no introns, find an open reading frame (ORF) in this region. Circle the point where translation will start, and put a box around the point where translation will stop. Then give the number of amino acids in the protein this gene would encode: 12 amino acids (start codon encodes an amino acid; stop codon doesn t) b. If you wanted to express this gene in E. coli, what would need to be present in your cloning vector to ensure that it will be transcribed and translated? The gene s promoter sequence won t be recognized by E. coli s sigma factor, so you ll need a prokaryotic promoter ( 10 and 35 sequences). E. coli ribosomes can only find the correct start codon by first binding the Shine-Dalgarno sequence, so the vector should also have this sequence positioned just before the desired start codon. c. How might the protein produced by E. coli differ from the protein produced from the same gene in a human cell? The amino-acid sequence (primary structure) will be the same. However, eukaryotic proteins are often modified in the ER or Golgi: carbohydrates added, phosphate groups added, etc. These modifications probably won t happen in E. coli. Also, it s possible that the protein won t be correctly folded, if some specific protein or condition in the eukaryotic cell is needed for folding. 6. You have cloned a cdna encoding a human hormone, and you hope to produce the hormone in bacteria in order to treat a severe genetic disorder. Unfortunately, when you insert this DNA into a plasmid and transform it into the bacteria, you get no hormone production. Give two valid reasons for your failure, and suggest a possible solution in each case. (1) Hormone must be modified after synthesis; bacteria lack ER and Golgi. Solution: determine the needed modification and try to reproduce it chemically, clone needed enzymes or use a eukaryotic host. (2) cdna has no promoter and can t be transcribed. Solution: insert it into an expression vector that includes a promoter. (3) cdna from a eukaryotic cell doesn t have a Shine-Dalgarno sequence needed for translation initiation in bacteria. Solution: insert it into an expression vector that includes a promoter. (4) cdna is made from mrna, and the mrna for the hormone will only be present in a cell that normally produces the hormone. Could be that the source of the DNA needs to be changed. (5) The hormone might be toxic to bacteria. Solution: could try a different cell as the host. 7. Circle the DNA sequence(s) below which could potentially be a recognition site for a restriction enzyme. 5 ATTTTA 3 5 CGCG 3 3 TAAAAT 5 3 GCGC 5 5 GGATCC 3 5 AGGAGG 3 3 CCTAGG 5 3 TCCTCC 5

5 8. A Bio 102 student gets so excited about the tyrosinase experiment that she decides to try to clone the tyrosinase gene. She grinds up some potato, extracts the DNA from it and digests the DNA with two different restriction enzymes (separately, not together): EcoRI and BamHI. She then obtains a cloning vector and digests it with the same two enzymes. She then runs a gel, which is shown at the right. a. Which enzyme would she want to use for cloning the potato DNA: EcoRI, or BamHI? Explain why you made your choice. BamHI, because it only cuts the plasmid once if you cut the plasmid twice, then both pieces must go back together along with your insert in order to get a functional recombinant plasmid. b. Notice that the cloning vector made nice, tight bands on the gel, but the potato DNA just looks like a smear with no distinct bands. However, this is just what the student expected, so she s not worried about it at all. Explain why this is the expected result. Plasmids are small and might have only one or two cut sites for a particular enzyme. The potato genome is huge and will have hundreds or thousands of sites for that enzyme. So we expect many, many more fragments, leading to the smeary appearance. That s OK, though, because after cloning all the fragments (to make a library), we ll have a way to identify the one correct clone. c. The student now mixes the potato DNA (digested with the enzyme you specified in part A) with cloning vector DNA (digested with the same enzyme). She then adds the mixture to E. coli cells that have been treated with CaCl 2, heats briefly to 42 C, adds growth medium and incubates for an hour. What would be her next step? Be as specific as possible. Now the cells would be put on an antibiotic-containing plate. This will kill any cell that didn t get a plasmid and allow those that did to grow into colonies. d. Unfortunately, after doing the next step as you specified, she doesn t get a single bacterial colony. Not even one! When she reviews her procedure, she realizes she left out a critical step. What did she forget, and why would this be necessary? She forgot to add the ligase! Ligase enzyme is needed to join the potato DNA with the cloning vector to make a single, circular recombinant DNA molecule.

6 9. Suppose you want to clone the gene for human Hexokinase, so that you can use bacteria to produce the protein and obtain it in pure form for further study of its activity. a. Your first task is to isolate the hexokinase gene from the human genome. Assuming you have some human DNA on hand and access to the genomic databases on the Web, what technique might you use to obtain pure hexokinase DNA? Since you can use the human genome database to determine the sequence of the enzyme, you can design primers that could be used to amplify only the hexokinase gene from a human DNA sample by PCR. b. In your initial attempt, you succeed in obtaining hexokinase DNA and ligating it into a plasmid vector, but when you transform the recombinant plasmid into bacteria, you get no hexokinase protein produced at all. When you discuss your problem with your friend, she suggests that you might want to start with mrna instead of with DNA. What problem can be overcome by starting with mrna instead? The hexokinase gene, like most human genes, probably contains introns. Bacteria can t splice out introns, so the bacteria couldn t make the correctly processed mrna (with an uninterrupted coding sequence), so they can t make the hexokinase protein starting with the complete human gene. c. What will you need to do with your mrna before you can make a new recombinant plasmid? Use reverse transcriptase to make a DNA copy of it (convert it to cdna). d. What else would you need to provide in order for the bacteria to correctly transcribe and translate the human hexokinase gene? The cdna won t include a promoter (-10 and -35 sequences, for bacteria) or a Shine-Dalgarno sequence, so the bacteria may not correctly recognize the gene unless these are added. An expression vector is commonly used for cloning cdna for this reason. e. After consulting genome databases, you find that the human hexokinase amino-acid sequence begins with Met-Trp-Lys-Trp- Trp-Met. But the protein made from your plasmid begins with Met-Trp-Met-Trp-Trp-Met! A mutation must have occurred! Below, write the DNA sequence of the non-template strand for the beginning of the actual (unmutated) hexokinase gene. Don t forget 5 and 3 ends. There is only one codon for Met, AUG, and only one codon for Trp, UGG. So the mrna sequence for the un-mutated gene must be: 5 -AUG-UGG-(Lys)-UGG-UGG-AUG. But, there are two possible codons for Lys: AAA and AAG. How could we know which one it was? Well, in the mutated version, Lys is changed to Met (AUG). AAG could change to AUG with only one mutation, while AAA would need two mutations to change to AUG. So it s most likely that the Lys codon was AAG. Now we have 5 - AUG-UGG-AAG- UGG-UGG-AUG for the mrna. Now, the question asks us for the non-template strand of the DNA. The non-template strand looks like the mrna, but of course it would have T s, not U s. So: 5 -ATGTGGAAGTGGTGGATG. f. Perhaps you could salvage your recombinant protein by treating it with a mutagen in order to get a reversion mutation that restores the correct amino-acid sequence! Which of the following mutagens might work? Circle all that apply. 1) ethidium bromide (makes one-base insertions or deletions) 2) aminopurine (causes A G substitutions) 3) imidazolecarboxamide (causes A T substitutions) This could work because it could change the Met codon (TAC on the template strand) to TTC, which would be AAG (Lys) in the mrna. 4) aflatoxin B 1 (allows any nucleotide to base-pair with a T during replication) This could work because it could affect the T in the ATG Met codon; if T paired with T, we would get TTG on the template strand, producing an AAC Lys codon.

7 10. Explain one significant problem with using retroviruses for gene therapy. (1) Because they insert DNA randomly into host DNA, they could produce a mutation (2) Because they contain a promoter, they could affect expression of other genes near the insertion Matching: 1. In our example of cloning insulin, we used several different enzymes. Match each enzyme below with its function in the cloning process. F Reverse transcriptase a. Separating strands of DNA for PCR b. Causing sticky ends to hydrogen bond G Restriction enzyme c. Copying a specific region of DNA D DNA ligase d. Covalently joining a DNA fragment to a cloning vector e. Transcribing the recombinant gene C Taq DNA polymerase f. Making a DNA copy of RNA g. Cutting DNA backbone at a specific sequence J DNA helicase h. Replicating plasmid j. Not used in cloning 2. Matching. Match the enzymes on the left with their roles in gene cloning on the right. You may use the letters once, more than once or not at all, but only one letter per blank. E F A B F DNA ligase DNA polymerase Restriction enzyme Reverse transcriptase Helicase a. Cut expression vector to produce sticky ends b. Produce cdna from mrna c. Separate strands of double-stranded DNA d. Produce many copies of a specific DNA sequence e. Make covalent bonds between two DNA molecules f. Not used in gene cloning

Bio 102 Practice Problems Recombinant DNA and Biotechnology

Bio 102 Practice Problems Recombinant DNA and Biotechnology Bio 102 Practice Problems Recombinant DNA and Biotechnology Multiple choice: Unless otherwise directed, circle the one best answer: 1. Which of the following DNA sequences could be the recognition site

More information

Name 12 Technology and the Human Genome Test Date Study Guide You must know: The terminology of biotechnology The steps in gene cloning with special

Name 12 Technology and the Human Genome Test Date Study Guide You must know: The terminology of biotechnology The steps in gene cloning with special Name 12 Technology and the Human Genome Test Date Study Guide You must know: The terminology of biotechnology The steps in gene cloning with special attention to the biotechnology tools that make cloning

More information

Recombinant DNA technology (genetic engineering) involves combining genes from different sources into new cells that can express the genes.

Recombinant DNA technology (genetic engineering) involves combining genes from different sources into new cells that can express the genes. Recombinant DNA technology (genetic engineering) involves combining genes from different sources into new cells that can express the genes. Recombinant DNA technology has had-and will havemany important

More information

Chapter 12 - DNA Technology

Chapter 12 - DNA Technology Bio 100 DNA Technology 1 Chapter 12 - DNA Technology Among bacteria, there are 3 mechanisms for transferring genes from one cell to another cell: transformation, transduction, and conjugation 1. Transformation

More information

Chapter 10 Manipulating Genes

Chapter 10 Manipulating Genes How DNA Molecules Are Analyzed Chapter 10 Manipulating Genes Until the development of recombinant DNA techniques, crucial clues for understanding how cell works remained lock in the genome. Important advances

More information

Chapter 20: Biotechnology: DNA Technology & Genomics

Chapter 20: Biotechnology: DNA Technology & Genomics Biotechnology Chapter 20: Biotechnology: DNA Technology & Genomics The BIG Questions How can we use our knowledge of DNA to: o Diagnose disease or defect? o Cure disease or defect? o Change/improve organisms?

More information

E. coli RNA Polymerase Sequences of E. coli Promoters. Promoter sequences from 10 bacteriophage and bacterial genes

E. coli RNA Polymerase Sequences of E. coli Promoters. Promoter sequences from 10 bacteriophage and bacterial genes E. coli RNA Polymerase Sequences of E. coli Promoters Promoter sequences from 10 bacteriophage and bacterial genes Transcription by E. coli RNA Polymerase Transcription by E. coli RNA Polymerase Transcription

More information

DNA TECHNOLOGY- methods for studying and manipulating genetic material.

DNA TECHNOLOGY- methods for studying and manipulating genetic material. 1 DNA TECHNOLOGY- methods for studying and manipulating genetic material. BIOTECHNOLOGY, the manipulation of organisms or their components to make useful products. Biotechnology today usually refers to

More information

Recombinant DNA and Biotechnology. Nucleic acid function: Central Dogma

Recombinant DNA and Biotechnology. Nucleic acid function: Central Dogma Recombinant DNA and Biotechnology Nucleic acid function: Central Dogma 1 The structure of the information: GENE: prokaryotes eukaryotes 5' Flanking +1 Coding Region Teminator 3'-flanking Promoter Other

More information

Section 12 3 RNA and Protein Synthesis

Section 12 3 RNA and Protein Synthesis Name Class Date Section 12 3 RNA and Protein Synthesis (pages 300 306) Key Concepts What are the three main types of RNA? What is transcription? What is translation? The Structure of RNA (page 300) 1.

More information

Lab 6: Biotechnology Multiple Choice Questions

Lab 6: Biotechnology Multiple Choice Questions Lab 6: Biotechnology Multiple Choice Questions 1. The enzyme that is found in retroviruses and that is required for the synthesis of DNA from RNA is DNA polymerase III RNA polymerase restriction endonuclease

More information

Genetic Code genetic code codons

Genetic Code genetic code codons Genetic Code The genetic code is a sequence of amino acids in an mrna that determine the amino acid order for the protein, consists of sets of three bases (triplets) along the mrna called codons. has a

More information

Structure and Function of DNA

Structure and Function of DNA Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four

More information

Name Date Class. The Central Dogma of Biology

Name Date Class. The Central Dogma of Biology Concept Mapping CHAPTER 12 The Central Dogma of Biology Complete the events chain showing the events that occur as DNA codes for RNA, which guides the synthesis of proteins, the central dogma of biology.

More information

BIO10 ch DNA Replication & Protein Synthesis 76. Chapter DNA Replication & Protein Synthesis

BIO10 ch DNA Replication & Protein Synthesis 76. Chapter DNA Replication & Protein Synthesis BIO10 ch11 12DNAReplication&ProteinSynthesis 76 Chapter 11-12 DNA Replication & Protein Synthesis Questions you should be able to answer after this lecture. 1. WHAT IS DNA? 2. Where in cell cycle does

More information

E9. The map is shown here.

E9. The map is shown here. E1. Sticky ends, which are complementary in their DNA sequence, will promote the binding of DNA fragments to each other. This binding is due to hydrogen bonding. E2. Remember that AT base pairs form two

More information

Principi di genetica - Robert J. Brooker Copyright 2010 The McGraw-Hill Companies srl

Principi di genetica - Robert J. Brooker Copyright 2010 The McGraw-Hill Companies srl CHAPTER 18 - Answers to Conceptual Questions C1. Answer: First, cloned genes can be used for DNA sequencing. This has allowed researchers to understand genetics at the molecular level. Second, cloned genes

More information

MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question.

MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. 1) The ʺone gene-one polypeptideʺ theory states that A) the synthesis of each enzyme is catalyzed

More information

CHAPTER 14 LECTURE NOTES: RECOMBINANT DNA TECHNOLOGY

CHAPTER 14 LECTURE NOTES: RECOMBINANT DNA TECHNOLOGY CHAPTER 14 LECTURE NOTES: RECOMBINANT DNA TECHNOLOGY I. General Info A. Landmarks in modern genetics 1. Rediscovery of Mendel s work 2. Chromosomal theory of inheritance 3. DNA as the genetic material

More information

Biotechnology. This isn t a baaaaaaaddd chapter!!! I m funnier the 2nd time!!!

Biotechnology. This isn t a baaaaaaaddd chapter!!! I m funnier the 2nd time!!! Biotechnology This isn t a baaaaaaaddd chapter!!! I m funnier the 2nd time!!! Genetic Engineering Genetic engineering involves manipulating genes for practical purposes Gene cloning leads to the production

More information

CHAPTER 7 From DNA to Protein

CHAPTER 7 From DNA to Protein CHAPTER 7 From DNA to Protein DNA doesn t direct protein synthesis itself, but acts rather like manger, delegating the various tasks required to a team of workers. When a particular proteins is needed

More information

The Structure & Function of DNA

The Structure & Function of DNA Chapter 10 The Structure & Function of DNA California State Standards covered by this chapter: Name Date Period Cell Biology 1. The fundamental life processes of plants and animals depend on a variety

More information

Biotechnology: DNA Technology & Genomics

Biotechnology: DNA Technology & Genomics Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 1 The BIG Questions How can we use our knowledge of DNA to: diagnose disease or defect? cure disease or defect? change/improve organisms?

More information

Name Class Date. f. a change in the genetic material 11. codon

Name Class Date. f. a change in the genetic material 11. codon Chapter 12 DNA and RNA Chapter Vocabulary Review Labeling Diagrams On the lines provided, identify each kind of RNA. Ribosome Amino acid Uracil 1. 2. 3. Matching On the lines provided, write the letter

More information

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology

More information

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Biotechnology and reporter genes Here, a lentivirus is used to carry foreign DNA into chickens. A reporter gene (GFP)indicates that foreign DNA has been successfully transferred. Recombinant DNA continued

More information

Name Class Date. KEY CONCEPT DNA was identified as the genetic material through a series of experiments.

Name Class Date. KEY CONCEPT DNA was identified as the genetic material through a series of experiments. Section 1: Identifying DNA as the Genetic Material KEY CONCEPT DNA was identified as the genetic material through a series of experiments. VOCABULARY bacteriophage MAIN IDEA: Griffith finds a transforming

More information

DNA and RNA. Griffith and Transformation (pages ) Avery and DNA (page 289) Chapter 12. Name Class Date

DNA and RNA. Griffith and Transformation (pages ) Avery and DNA (page 289) Chapter 12. Name Class Date Chapter 12 DNA and RNA Section 12 1 DNA (pages 287 294) This section tells about the experiments that helped scientists discover the relationship between genes and DNA. It also describes the chemical structure

More information

Bio Molecular Genetics Review Name: Period: Date:

Bio Molecular Genetics Review Name: Period: Date: AP Bio Molecular Genetics Review Name: Period: Date: 1. Suppose that in studies of genes on the same chromosome you find the following recombination frequencies: In this case it would be proper to say

More information

Figure During transcription, RNA nucleotides base-pair one by one with DNA

Figure During transcription, RNA nucleotides base-pair one by one with DNA Objectives Describe the process of DNA transcription. Explain how an RNA message is edited. Describe how RNA is translated to a protein. Summarize protein synthesis. Key Terms messenger RNA (mrna) RNA

More information

Ch. 12: DNA and RNA 12.1 DNA Chromosomes and DNA Replication

Ch. 12: DNA and RNA 12.1 DNA Chromosomes and DNA Replication Ch. 12: DNA and RNA 12.1 DNA A. To understand genetics, biologists had to learn the chemical makeup of the gene Genes are made of DNA DNA stores and transmits the genetic information from one generation

More information

Genetics Faculty of Agriculture and Veterinary Medicine

Genetics Faculty of Agriculture and Veterinary Medicine Genetics 10201232 Faculty of Agriculture and Veterinary Medicine Instructor: Dr. Jihad Abdallah Topic 15:Recombinant DNA Technology 1 Recombinant DNA Technology Recombinant DNA Technology is the use of

More information

SESSION 2. Possible answer:

SESSION 2. Possible answer: UPDATED CLONE THAT GENE ACTIVITY 2014 TEACHER GUIDE SESSION 2 Key ideas: When creating a recombinant plasmid, it is important to examine the sequences of the plasmid DNA and of the human DNA that contains

More information

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna

More information

Eukaryotic Gene Expression Practice Problems

Eukaryotic Gene Expression Practice Problems Eukaryotic Gene Expression Practice Problems 1. Explain the central dogma of cell biology. 2. What is gene expression? 3. Transcription is the process of copying a sequence of DNA into a complementary

More information

Section 12 1 DNA (pages )

Section 12 1 DNA (pages ) Chapter 12 DNA and RNA Section 12 1 DNA (pages 287 294) Key Concepts What did scientists discover about the relationship between genes and DNA? What is the overall structure of the DNAmolecule? 9. Transformation

More information

Lecture 10. mrna: Transcription Translation Start Translation Stop Transcription Start (AUG) (UAG, UAA, or UGA) Terminator S-D Sequence

Lecture 10. mrna: Transcription Translation Start Translation Stop Transcription Start (AUG) (UAG, UAA, or UGA) Terminator S-D Sequence Lecture 10 Analysis of Gene Sequences Anatomy of a bacterial gene: Promoter Coding Sequence (no stop codons) mrna: Transcription Translation Start Translation Stop Transcription Start (AUG) (UAG, UAA,

More information

Biotechnology: DNA Technology & Genomics

Biotechnology: DNA Technology & Genomics Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 The BIG Questions How can we use our knowledge of DNA to: diagnose disease or defect? cure disease or defect? change/improve organisms? What

More information

The correct answer is c B. Answer b is incorrect. Type II enzymes recognize and cut a specific site, not at random sites.

The correct answer is c B. Answer b is incorrect. Type II enzymes recognize and cut a specific site, not at random sites. 1. A recombinant DNA molecules is one that is a. produced through the process of crossing over that occurs in meiosis b. constructed from DNA from different sources c. constructed from novel combinations

More information

Guided Reading Activities

Guided Reading Activities Name Period Chapter 10: Molecular Biology of the Gene Guided Reading Activities Big idea: The structure of the genetic material Answer the following questions as you read modules 10.1 10.3: 1. The study

More information

CHAPTER 8 MICROBIAL GENETICS. What is genetics? Terminology

CHAPTER 8 MICROBIAL GENETICS. What is genetics? Terminology CHAPTER 8 MICROBIAL GENETICS What is genetics? The science of heredity; includes the study of genes, how they carry information, how they are replicated, how they are expressed Terminology Genetics: Study

More information

How Genes Work. Chapter 9. Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display

How Genes Work. Chapter 9. Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display How Genes Work Chapter 9 DNA or Protein? Mendel s work left a key question unanswered: What is a gene? The work of Sutton and Morgan established that genes reside on chromosomes But chromosomes contain

More information

Transcription & Translation. Part of Protein Synthesis

Transcription & Translation. Part of Protein Synthesis Transcription & Translation Part of Protein Synthesis Three processes Initiation Transcription Elongation Termination Initiation The RNA polymerase binds to the DNA molecule upstream of the gene at the

More information

Restriction Enzymes Gel Electrophoresis Southern Blot technique Polymerase Chain Reaction DNA Sequencing

Restriction Enzymes Gel Electrophoresis Southern Blot technique Polymerase Chain Reaction DNA Sequencing Molecular Genetics Restriction Enzymes Gel Electrophoresis Southern Blot technique Polymerase Chain Reaction DNA Sequencing Solving Crime Determining Paternity Gene Cloning Restriction enzymes are used

More information

Solutions to Molecular Biology Unit Exam

Solutions to Molecular Biology Unit Exam Solutions to Molecular Biology Unit Exam Question 1 Consider the following origin of replication that is found on a chromosome. The sequence of region 1 is shown below. 5 3 ori Region 1 top bottom 3 5

More information

Chapter 10 Analyzing Genes and Genomes

Chapter 10 Analyzing Genes and Genomes Chapter 10 Analyzing Genes and Genomes Copyright Garland Science 2010 These slides were made to provide direction when reading Chapter 10 in Essential Cell Biology please read the sections corresponding

More information

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,

More information

Unit 7: Molecular Genetics & DNA Technology Guided Reading Questions (100 pts total)

Unit 7: Molecular Genetics & DNA Technology Guided Reading Questions (100 pts total) Name: AP Biology Biology, Campbell and Reece, 7th Edition Adapted from chapter reading guides originally created by Lynn Miriello Chapter 16 The Molecular Basis of Inheritance Unit 7: Molecular Genetics

More information

The Genetic Code There are 20 amino acids, but there are only four nucleotide bases in DNA. How many nucleotides correspond to an amino acid?

The Genetic Code There are 20 amino acids, but there are only four nucleotide bases in DNA. How many nucleotides correspond to an amino acid? CH 17 Transcription & Translation Basic Principles of Transcription & Translation RNA is the bridge between genes and the proteins for which they code. Transcription is the synthesis of RNA under the direction

More information

DNA TECHNOLOGY & GENE REGULATION PRACTICE TEST

DNA TECHNOLOGY & GENE REGULATION PRACTICE TEST DNA TECHNOLOGY & GENE REGULATION PRACTICE TEST 1. In recombinant DNA experiments, is used to cut pieces of DNA and joins the resulting fragments to form recombinant DNA. a. A restriction enzyme, DNA ligase

More information

25.6 Replication of DNA

25.6 Replication of DNA 25.6 Replication of DNA DNA replication begins in the nucleus with partial unwinding of the double helix; this process involves enzymes known as helicases. The unwinding occurs simultaneously in many specific

More information

Recombinant DNA Technology

Recombinant DNA Technology PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology

More information

Today-applications: Medicine-better health Pharmaceutical-production of antibiotics Foods-wine, cheese, beer Agriculture-selective breeding

Today-applications: Medicine-better health Pharmaceutical-production of antibiotics Foods-wine, cheese, beer Agriculture-selective breeding I. Genetic Engineering modification of DNA of organisms to produce new genes with new characteristics -genes are small compared to chromosomes -need methods to get gene-sized pieces of DNA -direct manipulation

More information

TYPES OF CLONING VECTORS

TYPES OF CLONING VECTORS TYPES OF CLONING VECTORS CLONING VECTORS Different types of cloning vectors are used for different types of cloning experiments. The vector is chosen according to the size and type of DNA to be cloned

More information

Chapter 20 DNA Technology & Genomics

Chapter 20 DNA Technology & Genomics Chapter 20 DNA Technology & Genomics Focus of Chapter An introduction to the methods and developments in: Recombinant DNA Genetic Engineering Biotechnology Recombinant DNA DNA in which genes from different

More information

What is the rationale for studying GMO? Gene Cloning

What is the rationale for studying GMO? Gene Cloning Genetically modified organisms (GMO) Lectures covering the basic methods, applications and ethics of gene cloning and expression in microbes, plants and animals. Biotechnology "The industrial use of living

More information

DNA & Molecular Genetics (Prokaryotes & Eukaryotes)

DNA & Molecular Genetics (Prokaryotes & Eukaryotes) DNA & Molecular Genetics (Prokaryotes & Eukaryotes) 1. The essence of heredity is the ability of cells to use the information in their DNA to bring about the production of particular, thereby affecting

More information

I. DNA Replication A. Nucleotides added to each original template strand

I. DNA Replication A. Nucleotides added to each original template strand I. DNA Replication A. Nucleotides added to each original template strand 1. added in 5 to 3 direction 2. The two strands of DNA are anti-parallel a. run in opposite directions 3. DNA polymerase a. Form

More information

Summary 12 1 DNA RNA and Protein Synthesis Chromosomes and DNA Replication. Name Class Date

Summary 12 1 DNA RNA and Protein Synthesis Chromosomes and DNA Replication. Name Class Date Pearson Education, Inc. All rights reserved. Name Class Date Chapter 12 Summary DNA and RNA 12 1 DNA To understand genetics, biologists had to learn the chemical structure of the gene. Frederick Griffith

More information

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!! DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other

More information

From DNA to Protein. Chapter 14

From DNA to Protein. Chapter 14 From DNA to Protein Chapter 14 Impacts, Issues: Ricin and your Ribosomes Ricin is toxic because it inactivates ribosomes, the organelles which assemble amino acids into proteins, critical to life processes

More information

Chapter 9. Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA

Chapter 9. Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA Chapter 9 Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA Q&A Interferons are species specific, so that interferons to be used in humans must be produced in human cells. Can you think

More information

DNA replication. DNA RNA Protein

DNA replication. DNA RNA Protein DNA replication The central dogma of molecular biology transcription translation DNA RNA Protein replication Revers transcriptase The information stored by DNA: - protein structure - the regulation of

More information

CHAPTER 8 RECOMBINANT DNA and GENETIC ENGINEERING

CHAPTER 8 RECOMBINANT DNA and GENETIC ENGINEERING CHAPTER 8 RECOMBINANT DNA and GENETIC ENGINEERING Questions to be addressed: How are recombinant DNA molecules generated in vitro? How is recombinant DNA amplified? What analytical techniques are used

More information

Bioinformatics: Network Analysis

Bioinformatics: Network Analysis Bioinformatics: Network Analysis Molecular Cell Biology: A Brief Review COMP 572 (BIOS 572 / BIOE 564) - Fall 2013 Luay Nakhleh, Rice University 1 The Tree of Life 2 Prokaryotic vs. Eukaryotic Cell Structure

More information

Chapter 17: From Gene to Protein

Chapter 17: From Gene to Protein Name Period This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect to spend at least 6 hours to truly master

More information

CHAPTER 13 GENE TECHNOLOGY

CHAPTER 13 GENE TECHNOLOGY CHAPTER 13 GENE TECHNOLOGY MULTIPLE CHOICE 1. Restriction enzymes are specific in their identification of a. base sequences. c. proteins. b. amino acids. d. chromosomes. A DIF: 1 OBJ: 13-1.2 2. Fragments

More information

4. Each amino acid in a protein is specified by a. multiple genes b. a promoter c. a codon d. a molecule of mrna

4. Each amino acid in a protein is specified by a. multiple genes b. a promoter c. a codon d. a molecule of mrna 1. The experiments with nutritional mutants in Neurospora by Beadle and Tatum provided evidence that a. bread mold can be grown in a lab on minimal media b. X-rays can damage DNA c. cells need enzymes

More information

Function: DNA is fragmented (digested; cut) at specific sites

Function: DNA is fragmented (digested; cut) at specific sites ENZYMES TOOLS FOR RECOMBINANT DNA TECHNOLOGY Restriction endonucleases (REs); Function: DNA is fragmented (digested; cut) at specific sites -found in bacteria and serve to degrade invading DNA -recognize

More information

Chapter 20 DNA Technology and Genomics Guided Reading 1. Define the following terms:

Chapter 20 DNA Technology and Genomics Guided Reading 1. Define the following terms: AP Biology TEXT: Biology, Campbell and Reece 7 th Edition Name Chapter 20 DNA Technology and Genomics Guided Reading 1. Define the following terms: a. Recombinant DNA b. Genetic engineering c. Biotechnology

More information

NAME: Microbiology BI234 MUST be written and will not be accepted as a typed document.

NAME: Microbiology BI234 MUST be written and will not be accepted as a typed document. Chapter 8 Study Guide What is the study of genetics, and what topics does it focus on? What is a genome? NAME: Microbiology BI234 MUST be written and will not be accepted as a typed document. Describe

More information

Problem Set 4. 10:35 AM February 3, 2011

Problem Set 4. 10:35 AM February 3, 2011 BIO322: Genetics Douglas J. Burks Department of Biology Wilmington College of Ohio Problem Set 4 Due @ 10:35 AM February 3, 2011 Chapter 6 Problems: 4, 10, 12, 19, and a. Problem #4. Nitrogen and carbon

More information

Chapter 14 Protein Synthesis

Chapter 14 Protein Synthesis 1 Chapter 14 Protein Synthesis Go to: http://www.accessexcellence.org/ab/gg/#anchor-chromosomes-23240 Go through the various sites and review DNA synthesis Go to: http://www.accessexcellence.org/ab/gg/protein_synthesis.html

More information

XXII DNA cloning and sequencing. Outline

XXII DNA cloning and sequencing. Outline XXII DNA cloning and sequencing 1) Deriving DNA for cloning Outline 2) Vectors; forming recombinant DNA; cloning DNA; and screening for clones containing recombinant DNA [replica plating and autoradiography;

More information

Chapter 20. Biotechnology: DNA Technology & Genomics. The BIG Questions

Chapter 20. Biotechnology: DNA Technology & Genomics. The BIG Questions What do you notice about these phrases? radar racecar Madam I m Adam Able was I ere I saw Elba a man, a plan, a canal, Panama Was it a bar or a bat I saw? Chapter 20. Biotechnology: DNA Technology & Genomics

More information

Slide 1 of 39. End Show Copyright Pearson Prentice Hall. Slide 3 of 39. End Show Copyright Pearson Prentice Hall. Slide 5 of 39

Slide 1 of 39. End Show Copyright Pearson Prentice Hall. Slide 3 of 39. End Show Copyright Pearson Prentice Hall. Slide 5 of 39 12-3 RNA and Protein Synthesis Essential Question What is transcription and translation and how do they take place? 1 of 39 2 of 39 12 3 RNA and Protein Synthesis The Structure of RNA Genes are coded DNA

More information

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins

More information

cell. 3. a transfer ofmaterial from the host cell. 4. the reduction of the host cell. 5. the transformation of the host cell. 2. reject the virus.

cell. 3. a transfer ofmaterial from the host cell. 4. the reduction of the host cell. 5. the transformation of the host cell. 2. reject the virus. Version 001 Bacterial/Viral Genetics mahon (26) 1 This print-out should have 28 questions. Multiple-choice questions may continue on the next column or page find all choices before answering. Holt Bio

More information

expressed in E. coli. Since E. coli does not have eukaryotic introns, screens based on protein

expressed in E. coli. Since E. coli does not have eukaryotic introns, screens based on protein Reverse genetics - From protein or RNA to gene Up until now, we ve been following the classical genetic approach to creating an inventory of components, the path from mutation to gene. With the gene in

More information

Chapter 10: Protein Synthesis. Biology

Chapter 10: Protein Synthesis. Biology Chapter 10: Protein Synthesis Biology Let s Review What are proteins? Chains of amino acids Some are enzymes Some are structural components of cells and tissues More Review What are ribosomes? Cell structures

More information

Biotechnology: What is it?

Biotechnology: What is it? Biotechnology Biotechnology: What is it? Manipulation of organisms at the molecular level Recombinant DNA- DNA from two different sources (often different species) combined in vitro Analyzing DNA Molecules

More information

Gene expression is regulated by the cell, and mutations can affect this expression.

Gene expression is regulated by the cell, and mutations can affect this expression. Section 4: Gene expression is regulated by the cell, and mutations can affect this expression. K What I Know W What I Want to Find Out L What I Learned Vocabulary Review prokaryote New gene regulation

More information

Ch. 10 The Structure and Function of DNA Study Guide

Ch. 10 The Structure and Function of DNA Study Guide Ch. 10 The Structure and Function of DNA Study Guide Instructions: Circle the one best choice that answers the questions or completes the statement. For the true/false questions, circle True or False.

More information

Hersheyand Chase s experiment used different radioactive isotopes to label the DNA and

Hersheyand Chase s experiment used different radioactive isotopes to label the DNA and 1 Hersheyand Chase s experiment used different radioactive isotopes to label the DNA and protein in T2. Hershey and Chase s first trial on figuring out which molecules were the genetic material consisted

More information

Section 1 Workbook (unit 2) ANSWERS

Section 1 Workbook (unit 2) ANSWERS Section 1 Workbook (unit 2) ANSWERS Complete the following table: nucleotide DNA RN Name: B5. Describe DNA replication 1) Label each base given in the diagram below and describe the 4 primary characteristics

More information

Molecular Biology Unit Exam

Molecular Biology Unit Exam Molecular Biology Unit Exam Question 1 Consider the following origin of replication that is found on a chromosome. The sequence of region 1 is shown below. 5 3 ori Region 1 top bottom 3 5 Region 1: 5 CTGACTGACA

More information

Genetic code, transcription and translation. Adapted from the lesson Introduction to genome biology S. Dudoit and R. Gentleman University of Berkeley

Genetic code, transcription and translation. Adapted from the lesson Introduction to genome biology S. Dudoit and R. Gentleman University of Berkeley Genetic code, transcription and translation Adapted from the lesson Introduction to genome biology S. Dudoit and R. Gentleman University of Berkeley Chromosomes and DNA DNA structure A deoxyribonucleic

More information

Name Class Date. For Questions 1 5, complete each statement by writing in the correct word or words.

Name Class Date. For Questions 1 5, complete each statement by writing in the correct word or words. 15.2 Recombinant DNA Lesson Objectives Explain how scientists manipulate DNA. Describe the importance of recombinant DNA. Define transgenic and describe the usefulness of some transgenic organisms to humans.

More information

CHAPTER 9 BIOTECHNOLOGY AND RECOMBINANT DNA

CHAPTER 9 BIOTECHNOLOGY AND RECOMBINANT DNA CHAPTER 9 BIOTECHNOLOGY AND RECOMBINANT DNA Introduction to Biotechnology Biotechnology is the use of microorganisms, cells, or cell components to make a product. a. Recombinant DNA technology aka genetic

More information

Chapter 17: From Gene to Protein

Chapter 17: From Gene to Protein AP Biology Reading Guide Name Chapter 17: From Gene to Protein This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time,

More information

Lecture 15: Translation and Transcription

Lecture 15: Translation and Transcription Lecture 15: Translation and Transcription Making proteins requires that genetic information is transcribed from DNA into RNA and then translated into protein. The overall process can be viewed as two separate

More information

DNA: Molecule of Life

DNA: Molecule of Life DNA: Molecule of Life History DNA Structure Protein Synthesis Gene Regulation History of DNA H I S T O By the 1940 s, scientists knew that chromosomes consisted of both DNA and protein but did not know

More information

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d. 13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both

More information

Biotechnology and Recombinant DNA

Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA Recombinant DNA procedures - an overview Biotechnology: The use of microorganisms, cells, or cell components to make a product. Foods, antibiotics, vitamins, enzymes Recombinant

More information

AP BIOLOGY Cells Activity #6 VIRUSES LIFE OF A VIRUS ANATOMY OF A VIRUS. Cell Activity #6 Page 1 of 9

AP BIOLOGY Cells Activity #6 VIRUSES LIFE OF A VIRUS ANATOMY OF A VIRUS. Cell Activity #6 Page 1 of 9 AP BIOLOGY Cells Activity #6 LIFE OF A VIRUS VIRUSES ANATOMY OF A VIRUS Cell Activity #6 Page 1 of 9 REPLICATION CYCLES FOR DNA VIRUSES LYTIC CYCLE LYSOGENIC CYCLE Cell Activity #6 Page 2 of 9 RNA VIRUSES

More information

Activity 17.1 Modeling Transcription and Translation: What Processes Produce RNA from DNA and Protein from mrna?

Activity 17.1 Modeling Transcription and Translation: What Processes Produce RNA from DNA and Protein from mrna? Activity 17.1 Modeling Transcription and Translation: What Processes Produce RNA from DNA and Protein from mrna? Create a model of the processes of transcription and translation. Your model should be a

More information

Biochem 717 Gene Cloning. Prof Amer Jamil Dept of Biochemistry University of Agriculture Faisalabad

Biochem 717 Gene Cloning. Prof Amer Jamil Dept of Biochemistry University of Agriculture Faisalabad Biochem 717 Gene Cloning Prof Amer Jamil Dept of Biochemistry University of Agriculture Faisalabad How to construct a recombinant DNA molecule? DNA isolation Cutting of DNA molecule with the help of restriction

More information

BIOLOGY 200 SPRING QUARTER 2015 EXAM 1-PRACTICE QUESTIONS KEY. Codon Table!

BIOLOGY 200 SPRING QUARTER 2015 EXAM 1-PRACTICE QUESTIONS KEY. Codon Table! BIOLOGY 200 SPRING QUARTER 2015 EXAM 1-PRACTICE QUESTIONS KEY Codon Table! STOP STOP STOP NOTE: We have included the Bloom s level for each practice question (written in blue after each question). This

More information

1. The diagram below shows the synthesis of a polynucleotide by the formation of a phosphodiester bond.

1. The diagram below shows the synthesis of a polynucleotide by the formation of a phosphodiester bond. 1. The diagram below shows the synthesis of a polynucleotide by the formation of a phosphodiester bond. Which statement best describes how the nucleotides are joined to form the polynucleotide? (A) The

More information

B5 B8 ANWERS DNA & ) DNA

B5 B8 ANWERS DNA & ) DNA Review sheet for test B5 B8 ANWERS DNA review 1. What bonds hold complementary bases between 2 strands of DNA together? Hydrogen bonds 2. What bonds exist between sugars and phosphates? Covalent bonds

More information