3/31 Using DNA to Track Your Ancestors
|
|
- Aubrey Heath
- 7 years ago
- Views:
Transcription
1 1/9/16 11:49 AM 3/31 Using DNA to Track Your Ancestors DNA analysis: General Procedure (slide 1) Amplify sections of the DNA Separate DNA fragments by length and visualize Compare the DNA pattern between two individuals Types of DNA analysis (slide 2) Compare sequenced genomes (Slide 3) o Architecture
2 o Dependent on methods o Finding orthologs o rrna gene Scientists use DNA to trace Life s Time line Time Tree compare last common ancestor between two species o Genomics advances o Rapid DNA sequencing o Ability to compare genomes o Ability to compute evolutionary distance from sequence changes (Allan Wilson) o Statistical advances o Baysian probabilities o Markov paths Microsatellite Regions Tandem repeated DNA motifs that range in length from two to five nucleotides, and are typically repeated 5-50 times
3 TATATATATA Dinucleotide repeat/ 5 times Neutral regions-fix mutations Replication slippage changes repeat number 1/1000 replications PCR amplification (slide 3) Amplifying DNA by PCR Using two primers that bracket a particular microsatellite, or VNTR, sequence produces a different pair of DNA bands from each individual.
4 One bands contains the repeated VNTR sequence from the individual's mother and the other from the individual's father. DNA bands obtained from a set of different PCR reactions each of which amplifies the DNA from a different VNTR sequence "fingerprint" to identify each individual nearly uniquely. The starting material for the PCR reaction can be a single hair that was left at the scene of a crime. Single nucleotide polymorphisms (Slide 4) Change of a single base (variation) at a known location o 8.8 x 10 5 SNPs/ 2.7 x 10 9 bp in human DNA Detected on SNP chips
5 o An array containing immobilized allelespecific oligonucleotide (ASO) probes. o Fragmented nucleic acid sequences of target, labeled with fluorescent dyes. o A detection system that records and interprets the hybridization signal. o Ancient hominid DNA-Whole DNA approach (Slide 6)
6 o Homo heidelbergensis-ancestor of H.neanderthal,H.denisova, and H. sapiens o New species yet to be discovered Neanderthal and Denisovan % of genome Haplogroups (Slide 7) Defined by a unique SNP Haplotypes Identical mutations within the Haplogroup
7 Eve and her 7 Daughters (Slide 8) Mitochondrial Eve:matrilineal most recent common ancestor (MRCA) of all currently
8 living humans o mtdna inherited by both male and female offspring o lived between 99,000 and 200,000 years ago,most likely in East Africa Alan Wilson (molecular clock) 1986 mt work
9 o Post-doc Wesley Brown-Mutation in mtdna is fast 1%/million years Large variation among human subjects o Grad student Rebecca Cann Collected mt DNA based on ethnicity (100 samples)
10 o Grad student Mark Stoneking Collected mt DNA samples from aboriginal Australians New Guineans and!kung o All current mtdna derived from a specific women in East Africa Common misconceptions o Not the only women o Not a fixed individual over time o Not necessarily a contemporary of Y chromosome Adam o Not the most recent ancestor shared by all humans Human MRCA 5000 years ago ú A few thousand years before MRCA, all humans then alive left no descendants alive today or were common ancestors of all
11 humans alive today (identical ancestor point) each present-day human has exactly the same set of genealogical ancestors" alive at the "identical ancestors point" o Not the biblical eve Y-chromosome Adam (Slide 9) Almost all males inherit Y chromosome from a single male
12 o Lived 200,000 years ago Emergence of anatomically modern H. sapiens Lived before Eve Lived in North-west Africa Both Y and mt studies support out of Africa Hypothesis Commercial Genealogy Companies (slide 10) Services available 111 segments of your Y chromosome Some or all of your mitochondrial DNA Most of your 22 non-sex chromosomes (1 million markers) Ancestory.com Originally Sorenson Molecular Genealogy Foundation (1999) Started by a Mormon billionaire to look at DNA from Norway
13 Associated with the Mormon family History Centers-Giant database of genealogy data Collected DNA from Norway, Africa, Asia, Kyrgyztan, Mongolia greater than 100,000 samples Acquired by ancestory.com (2112) Documented lineages of more than 700,000 sites on the genome including mtdna and the Y chromosome Family Tree DNA(2000) Bennett Greenspan based on two genetics cases in media of shared Y chromosome Male descendants of Thomas Jefferson and Sally Hemings Many Cohen males of Ashkenazic and Sephardic origin (Cohen Modal Haplotypehaplogroup J) Diaspora marker for descendants of Aaron
14 Appears in other haplotypes not associated with Cohen Multiple lineages among Cohen Y-chromosome Levi (son of Jacob) Haplogroup E1b1b1 common in Eastern Europeans Haplogroups J1 and 2 and E1b1b1 are prevalent among Jewish populations Samaritan Cohens Distinct religious and cultural sect Broke away from mainstream Jews in 5BCE Maintain extensive genealogical records Belong to haplogroup E1b1b1 All crowd sourced Family Tree DNA largest collection of mt and Y chromosome data What genealogical information is written in the DNA (TheGeneticGenealogist.com YourGeneticGenealogist.com)
15 Place of origin Religious origins Geographic origins Adoptees to find families Baby switches in hospitals Abandoned infants Genetic based social networks Companies track genetic cousins and specific segments of the genome o Alert customers to large shared segments-identity by descent o Trace back from autosomal DNA 5 generations o Identify 3d cousins 90% prob o 4 th cousin with 50% prob o 5 th cousin with 10% prob o documented examples of 8 th cousins
16 o Large enough group of descendants in a single family line, rebuild the genome of the group s common ancestor o Theoretically, rebuild the population of a city in 1850
The Story of Human Evolution Part 1: From ape-like ancestors to modern humans
The Story of Human Evolution Part 1: From ape-like ancestors to modern humans Slide 1 The Story of Human Evolution This powerpoint presentation tells the story of who we are and where we came from - how
More informationFrom Africa to Aotearoa Part 1: Out of Africa
From Africa to Aotearoa Part 1: Out of Africa The spread of modern humans out of Africa started around 65,000 years ago, and ended with the settlement of New Zealand 750 years ago. These PowerPoint presentations
More informationForensic DNA Testing Terminology
Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.
More informationThe sample is taken with a simple mouth swab no blood is involved. There will be instructions included on how to take the sample.
DNA testing Thanks for your enquiry about DNA testing. I oversee the Scottish DNA Project on behalf of the University of Strathclyde, Glasgow and act as representative for Family Tree DNA who host our
More informationMitochondrial DNA Analysis
Mitochondrial DNA Analysis Lineage Markers Lineage markers are passed down from generation to generation without changing Except for rare mutation events They can help determine the lineage (family tree)
More informationY Chromosome Markers
Y Chromosome Markers Lineage Markers Autosomal chromosomes recombine with each meiosis Y and Mitochondrial DNA does not This means that the Y and mtdna remains constant from generation to generation Except
More informationChapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company
Genetic engineering: humans Gene replacement therapy or gene therapy Many technical and ethical issues implications for gene pool for germ-line gene therapy what traits constitute disease rather than just
More informationGene Mapping Techniques
Gene Mapping Techniques OBJECTIVES By the end of this session the student should be able to: Define genetic linkage and recombinant frequency State how genetic distance may be estimated State how restriction
More informationSingle Nucleotide Polymorphisms (SNPs)
Single Nucleotide Polymorphisms (SNPs) Additional Markers 13 core STR loci Obtain further information from additional markers: Y STRs Separating male samples Mitochondrial DNA Working with extremely degraded
More informationGenetic Variation and Human Evolution Lynn B. Jorde, Ph.D. Department of Human Genetics University of Utah School of Medicine.
Genetic Variation and Human Evolution Lynn B. Jorde, Ph.D. Department of Human Genetics University of Utah School of Medicine. The past two decades have witnessed an explosion of human genetic data. Innumerable
More informationBiology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA
Page 1 of 5 Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA Genetics Exercise: Understanding how meiosis affects genetic inheritance and DNA patterns
More informationMCB41: Second Midterm Spring 2009
MCB41: Second Midterm Spring 2009 Before you start, print your name and student identification number (S.I.D) at the top of each page. There are 7 pages including this page. You will have 50 minutes for
More informationI Have the Results of My Genetic Genealogy Test, Now What?
I Have the Results of My Genetic Genealogy Test, Now What? Version 2.1 1 I Have the Results of My Genetic Genealogy Test, Now What? Chapter 1: What Is (And Isn t) Genetic Genealogy? Chapter 2: How Do I
More informationSome ancestors are difficult to trace. Adoptions illegitimacies, name changes and migrations can present brick walls in our research that seem
Some ancestors are difficult to trace. Adoptions illegitimacies, name changes and migrations can present brick walls in our research that seem impregnable. In other cases, documentation that would shed
More informationTracing the evolution of the genus Homo is important for understanding the ancestry of humans; the only living species of Homo.
Section 3: Tracing the evolution of the genus Homo is important for understanding the ancestry of humans; the only living species of Homo. K What I Know W What I Want to Find Out L What I Learned Essential
More informationGENETIC GENEALOGY AND DNA TESTING
GENETIC GENEALOGY AND DNA TESTING by Ted Steele This publication may be ordered from: St. Louis Genealogical Society P. O. Box 432010 St. Louis, MO 63143 Copyright 2013 St. Louis Genealogical Society All
More information2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.
1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence
More informationCommonly Used STR Markers
Commonly Used STR Markers Repeats Satellites 100 to 1000 bases repeated Minisatellites VNTR variable number tandem repeat 10 to 100 bases repeated Microsatellites STR short tandem repeat 2 to 6 bases repeated
More informationThe Human Genome Project
The Human Genome Project Brief History of the Human Genome Project Physical Chromosome Maps Genetic (or Linkage) Maps DNA Markers Sequencing and Annotating Genomic DNA What Have We learned from the HGP?
More informationDNA Testing for Genealogy - What Can It Do For You??
DNA Testing for Genealogy - What Can It Do For You?? Paper courtesy of Roberta Estes, www.dnaexplain.com, e-mail Roberta at Roberta@dnaexplain.com. Graphics courtesy of Family Tree DNA, www.familytreedna.com.
More information14.3 Studying the Human Genome
14.3 Studying the Human Genome Lesson Objectives Summarize the methods of DNA analysis. State the goals of the Human Genome Project and explain what we have learned so far. Lesson Summary Manipulating
More informationRethinking Polynesian Origins: Human Settlement of the Pacific
LENScience Senior Biology Seminar Series Rethinking Polynesian Origins: Human Settlement of the Pacific Michal Denny, and Lisa Matisoo-Smith Our Polynesian ancestors are renowned as some of the world s
More informationInnovations in Molecular Epidemiology
Innovations in Molecular Epidemiology Molecular Epidemiology Measure current rates of active transmission Determine whether recurrent tuberculosis is attributable to exogenous reinfection Determine whether
More informationLecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology
Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,
More informationCHROMOSOMES Dr. Fern Tsien, Dept. of Genetics, LSUHSC, NO, LA
CHROMOSOMES Dr. Fern Tsien, Dept. of Genetics, LSUHSC, NO, LA Cytogenetics is the study of chromosomes and their structure, inheritance, and abnormalities. Chromosome abnormalities occur in approximately:
More informationLecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs)
Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs) Single nucleotide polymorphisms or SNPs (pronounced "snips") are DNA sequence variations that occur
More informationNORSE VIKING HERITAGE
NORSE VIKING HERITAGE My mother's maiden name is WILLIAMSON. Her ancestors in the paternal line came from the Shetland Islands. The Shetland Islands were settled by Norse Vikings beginning before 800 AD.
More informationMatthew Kaplan and Taylor Edwards. University of Arizona Tucson, Arizona
Matthew Kaplan and Taylor Edwards University of Arizona Tucson, Arizona Unresolved paternity Consent for testing Ownership of Samples Uncovering genetic disorders SRY Reversal / Klinefelter s Syndrome
More informationLevel 3 Biology, 2012
90719 907190 3SUPERVISOR S Level 3 Biology, 2012 90719 Describe trends in human evolution 2.00 pm Tuesday 13 November 2012 Credits: Three Check that the National Student Number (NSN) on your admission
More informationFact Sheet 14 EPIGENETICS
This fact sheet describes epigenetics which refers to factors that can influence the way our genes are expressed in the cells of our body. In summary Epigenetics is a phenomenon that affects the way cells
More informationDNA and Forensic Science
DNA and Forensic Science Micah A. Luftig * Stephen Richey ** I. INTRODUCTION This paper represents a discussion of the fundamental principles of DNA technology as it applies to forensic testing. A brief
More informationElsevier Editorial System(tm) for Forensic Science International: Genetics Manuscript Draft
Elsevier Editorial System(tm) for Forensic Science International: Genetics Manuscript Draft Manuscript Number: Title: A comment on the Paper: A comparison of Y-chromosomal lineage dating using either resequencing
More informationPaternity Testing. Chapter 23
Paternity Testing Chapter 23 Kinship and Paternity DNA analysis can also be used for: Kinship testing determining whether individuals are related Paternity testing determining the father of a child Missing
More informationWorksheet - COMPARATIVE MAPPING 1
Worksheet - COMPARATIVE MAPPING 1 The arrangement of genes and other DNA markers is compared between species in Comparative genome mapping. As early as 1915, the geneticist J.B.S Haldane reported that
More informationAlgorithms in Computational Biology (236522) spring 2007 Lecture #1
Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office
More informationThis fact sheet describes how genes affect our health when they follow a well understood pattern of genetic inheritance known as autosomal recessive.
11111 This fact sheet describes how genes affect our health when they follow a well understood pattern of genetic inheritance known as autosomal recessive. In summary Genes contain the instructions for
More informationCCR Biology - Chapter 9 Practice Test - Summer 2012
Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible
More informationGenetics Module B, Anchor 3
Genetics Module B, Anchor 3 Key Concepts: - An individual s characteristics are determines by factors that are passed from one parental generation to the next. - During gamete formation, the alleles for
More informationThe following chapter is called "Preimplantation Genetic Diagnosis (PGD)".
Slide 1 Welcome to chapter 9. The following chapter is called "Preimplantation Genetic Diagnosis (PGD)". The author is Dr. Maria Lalioti. Slide 2 The learning objectives of this chapter are: To learn the
More informationThe Techniques of Molecular Biology: Forensic DNA Fingerprinting
Revised Fall 2011 The Techniques of Molecular Biology: Forensic DNA Fingerprinting The techniques of molecular biology are used to manipulate the structure and function of molecules such as DNA and proteins
More informationAll your base(s) are belong to us
All your base(s) are belong to us The dawn of the high-throughput DNA sequencing era 25C3 Magnus Manske The place Sanger Center, Cambridge, UK Basic biology Level of complexity Genome Single (all chromosomes
More informationThe Chinese University of Hong Kong School of Life Sciences Biochemistry Program CUGEN Ltd.
The Chinese University of Hong Kong School of Life Sciences Biochemistry Program CUGEN Ltd. DNA Forensic and Agarose Gel Electrophoresis 1 OBJECTIVES Prof. Stephen K.W. Tsui, Dr. Patrick Law and Miss Fion
More informationGene mutation and molecular medicine Chapter 15
Gene mutation and molecular medicine Chapter 15 Lecture Objectives What Are Mutations? How Are DNA Molecules and Mutations Analyzed? How Do Defective Proteins Lead to Diseases? What DNA Changes Lead to
More informationSNP Essentials The same SNP story
HOW SNPS HELP RESEARCHERS FIND THE GENETIC CAUSES OF DISEASE SNP Essentials One of the findings of the Human Genome Project is that the DNA of any two people, all 3.1 billion molecules of it, is more than
More informationIntroduction to transcriptome analysis using High Throughput Sequencing technologies (HTS)
Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) A typical RNA Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,
More informationHuman Genome and Human Genome Project. Louxin Zhang
Human Genome and Human Genome Project Louxin Zhang A Primer to Genomics Cells are the fundamental working units of every living systems. DNA is made of 4 nucleotide bases. The DNA sequence is the particular
More informationUse of the Agilent 2100 Bioanalyzer and the DNA 500 LabChip in the Analysis of PCR Amplified Mitochondrial DNA Application
Use of the Agilent 2100 Bioanalyzer and the DNA LabChip in the Analysis of PCR Amplified Mitochondrial DNA Application Homeland Security/Forensics Author Mark Jensen Agilent Technologies, Inc. 2850 Centerville
More informationGenetic Technology. Name: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question.
Name: Class: Date: Genetic Technology Multiple Choice Identify the choice that best completes the statement or answers the question. 1. An application of using DNA technology to help environmental scientists
More informationA Primer of Genome Science THIRD
A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:
More informationDNA: A Person s Ultimate Fingerprint
A partnership between the UAB Center for Community Outreach Development and McWane Center DNA: A Person s Ultimate Fingerprint This project is supported by a Science Education Partnership Award (SEPA)
More informationBob Jesberg. Boston, MA April 3, 2014
DNA, Replication and Transcription Bob Jesberg NSTA Conference Boston, MA April 3, 2014 1 Workshop Agenda Looking at DNA and Forensics The DNA, Replication i and Transcription i Set DNA Ladder The Double
More informationAnnex to the Accreditation Certificate D-PL-13372-01-00 according to DIN EN ISO/IEC 17025:2005
Deutsche Akkreditierungsstelle GmbH German Accreditation Body Annex to the Accreditation Certificate D-PL-13372-01-00 according to DIN EN ISO/IEC 17025:2005 Period of validity: 26.03.2012 to 25.03.2017
More informationGenetics Test Biology I
Genetics Test Biology I Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Avery s experiments showed that bacteria are transformed by a. RNA. c. proteins.
More informationDevelopment of two Novel DNA Analysis methods to Improve Workflow Efficiency for Challenging Forensic Samples
Development of two Novel DNA Analysis methods to Improve Workflow Efficiency for Challenging Forensic Samples Sudhir K. Sinha, Ph.D.*, Anne H. Montgomery, M.S., Gina Pineda, M.S., and Hiromi Brown, Ph.D.
More informationDifficult DNA Templates Sequencing. Primer Walking Service
Difficult DNA Templates Sequencing Primer Walking Service Result 16/18s (ITS 5.8s) rrna Sequencing Phylogenetic tree 16s rrna Region ITS rrna Region ITS and 26s rrna Region Order and Result Cloning Service
More informationOverview of Genetic Testing and Screening
Integrating Genetics into Your Practice Webinar Series Overview of Genetic Testing and Screening Genetic testing is an important tool in the screening and diagnosis of many conditions. New technology is
More informationPRINCIPLES OF POPULATION GENETICS
PRINCIPLES OF POPULATION GENETICS FOURTH EDITION Daniel L. Hartl Harvard University Andrew G. Clark Cornell University UniversitSts- und Landesbibliothek Darmstadt Bibliothek Biologie Sinauer Associates,
More informationEdlund, H., Allen, M. (2009) Y chromosomal STR analysis using Pyrosequencing technology. Forensic Science International: Genetics, 3(2):119-124
Till min familj List of Papers This thesis is based on the following papers, which are referred to in the text by their Roman numerals. I II III IV Edlund, H., Allen, M. (2009) Y chromosomal STR analysis
More informationName Class Date. binomial nomenclature. MAIN IDEA: Linnaeus developed the scientific naming system still used today.
Section 1: The Linnaean System of Classification 17.1 Reading Guide KEY CONCEPT Organisms can be classified based on physical similarities. VOCABULARY taxonomy taxon binomial nomenclature genus MAIN IDEA:
More informationSummary. 16 1 Genes and Variation. 16 2 Evolution as Genetic Change. Name Class Date
Chapter 16 Summary Evolution of Populations 16 1 Genes and Variation Darwin s original ideas can now be understood in genetic terms. Beginning with variation, we now know that traits are controlled by
More informationGenetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis
Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype
More informationData Analysis for Ion Torrent Sequencing
IFU022 v140202 Research Use Only Instructions For Use Part III Data Analysis for Ion Torrent Sequencing MANUFACTURER: Multiplicom N.V. Galileilaan 18 2845 Niel Belgium Revision date: August 21, 2014 Page
More informationCrime Scenes and Genes
Glossary Agarose Biotechnology Cell Chromosome DNA (deoxyribonucleic acid) Electrophoresis Gene Micro-pipette Mutation Nucleotide Nucleus PCR (Polymerase chain reaction) Primer STR (short tandem repeats)
More informationGenomes and SNPs in Malaria and Sickle Cell Anemia
Genomes and SNPs in Malaria and Sickle Cell Anemia Introduction to Genome Browsing with Ensembl Ensembl The vast amount of information in biological databases today demands a way of organising and accessing
More informationBiology Final Exam Study Guide: Semester 2
Biology Final Exam Study Guide: Semester 2 Questions 1. Scientific method: What does each of these entail? Investigation and Experimentation Problem Hypothesis Methods Results/Data Discussion/Conclusion
More informationDNA PROFILING IN FORENSIC SCIENCE
DA PROFILIG I FORESIC SCIECE DA is the chemical code that is found in every cell of an individual's body, and is unique to each individual. Because it is unique, the ability to examine DA found at a crime
More informationDNA Sequence Analysis
DNA Sequence Analysis Two general kinds of analysis Screen for one of a set of known sequences Determine the sequence even if it is novel Screening for a known sequence usually involves an oligonucleotide
More informationInformation leaflet. Centrum voor Medische Genetica. Version 1/20150504 Design by Ben Caljon, UZ Brussel. Universitair Ziekenhuis Brussel
Information on genome-wide genetic testing Array Comparative Genomic Hybridization (array CGH) Single Nucleotide Polymorphism array (SNP array) Massive Parallel Sequencing (MPS) Version 120150504 Design
More informationDNA Fingerprinting. Unless they are identical twins, individuals have unique DNA
DNA Fingerprinting Unless they are identical twins, individuals have unique DNA DNA fingerprinting The name used for the unambiguous identifying technique that takes advantage of differences in DNA sequence
More informationHow many of you have checked out the web site on protein-dna interactions?
How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss
More informationSICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE
AP Biology Date SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE LEARNING OBJECTIVES Students will gain an appreciation of the physical effects of sickle cell anemia, its prevalence in the population,
More informationBecker Muscular Dystrophy
Muscular Dystrophy A Case Study of Positional Cloning Described by Benjamin Duchenne (1868) X-linked recessive disease causing severe muscular degeneration. 100 % penetrance X d Y affected male Frequency
More informationThe Central Dogma of Molecular Biology
Vierstraete Andy (version 1.01) 1/02/2000 -Page 1 - The Central Dogma of Molecular Biology Figure 1 : The Central Dogma of molecular biology. DNA contains the complete genetic information that defines
More informationRecombinant DNA and Biotechnology
Recombinant DNA and Biotechnology Chapter 18 Lecture Objectives What Is Recombinant DNA? How Are New Genes Inserted into Cells? What Sources of DNA Are Used in Cloning? What Other Tools Are Used to Study
More informationNext Generation Sequencing: Technology, Mapping, and Analysis
Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University gbenson@bu.edu http://tandem.bu.edu/ The Human Genome Project took
More informationAbout The Causes of Hearing Loss
About 1 in 500 infants is born with or develops hearing loss during early childhood. Hearing loss has many causes: some are genetic (that is, caused by a baby s genes) or non-genetic (such as certain infections
More informationMolecular typing of VTEC: from PFGE to NGS-based phylogeny
Molecular typing of VTEC: from PFGE to NGS-based phylogeny Valeria Michelacci 10th Annual Workshop of the National Reference Laboratories for E. coli in the EU Rome, November 5 th 2015 Molecular typing
More informationIIID 14. Biotechnology in Fish Disease Diagnostics: Application of the Polymerase Chain Reaction (PCR)
IIID 14. Biotechnology in Fish Disease Diagnostics: Application of the Polymerase Chain Reaction (PCR) Background Infectious diseases caused by pathogenic organisms such as bacteria, viruses, protozoa,
More informationPAPER RFLP TEACHER GUIDE
PAPER RFLP TEACHER GUIDE Paper = DNA Scissors = Restriction Enzyme Desktop = Electrophoresis NOTE: There are TWO versions of this activity one where the students write their own sentences (to represent
More informationX Linked Inheritance
X Linked Inheritance Information for Patients and Families 2 X linked Inheritance The following will give you information about what X linked inheritance means and how X linked conditions are inherited.
More informationDNA Insertions and Deletions in the Human Genome. Philipp W. Messer
DNA Insertions and Deletions in the Human Genome Philipp W. Messer Genetic Variation CGACAATAGCGCTCTTACTACGTGTATCG : : CGACAATGGCGCT---ACTACGTGCATCG 1. Nucleotide mutations 2. Genomic rearrangements 3.
More informationABSTRACT. Promega Corporation, Updated September 2008. http://www.promega.com/pubhub. 1 Campbell-Staton, S.
A Modified Wizard SV Genomic DNA Purification System Protocol to Purify Genomic DNA... A Modified Wizard SV Genomic DNA Purification System Protocol to Purify Genomic DNA from Shed Reptile Skin ABSTRACT
More informationHuman Genome Organization: An Update. Genome Organization: An Update
Human Genome Organization: An Update Genome Organization: An Update Highlights of Human Genome Project Timetable Proposed in 1990 as 3 billion dollar joint venture between DOE and NIH with 15 year completion
More informationRecovering the Romanovs
Recovering the Romanovs Description of activity Recovering the Romanovs is an excellent opening to any unit on human genetics. To complete the three parts of this module, approximately three 40-minute
More informationNucleic Acid Techniques in Bacterial Systematics
Nucleic Acid Techniques in Bacterial Systematics Edited by Erko Stackebrandt Department of Microbiology University of Queensland St Lucia, Australia and Michael Goodfellow Department of Microbiology University
More informationGlobally, about 9.7% of cancers in men are prostate cancers, and the risk of developing the
Chapter 5 Analysis of Prostate Cancer Association Study Data 5.1 Risk factors for Prostate Cancer Globally, about 9.7% of cancers in men are prostate cancers, and the risk of developing the disease has
More informationTechnical Note. Roche Applied Science. No. LC 18/2004. Assay Formats for Use in Real-Time PCR
Roche Applied Science Technical Note No. LC 18/2004 Purpose of this Note Assay Formats for Use in Real-Time PCR The LightCycler Instrument uses several detection channels to monitor the amplification of
More informationChapter 3. Chapter Outline. Chapter Outline 9/11/10. Heredity and Evolu4on
Chapter 3 Heredity and Evolu4on Chapter Outline The Cell DNA Structure and Function Cell Division: Mitosis and Meiosis The Genetic Principles Discovered by Mendel Mendelian Inheritance in Humans Misconceptions
More informationMarrying a relative. Is there an increased chance that a child will have genetic problems if its parents are related to each other?
Marrying a relative Is there an increased chance that a child will have genetic problems if its parents are related to each other? The simple answer to this question is Yes, there is an increased chance.
More informationDNA Testing and the Melungeons
DNA Testing and the Melungeons Roberta Estes, copyright 2006-2008, restes@comcast.net DNA testing has become an integral part of any genealogical endeavor, generally as part of a surname project. However,
More informationRecovering the Romanovs
Recovering the Romanovs ACTIVITY 1 The Romanov Family: Screen #4 Inheritance of a Sex-linked Trait Key: H=normal allele; h=hemophilia allele; X=X chromosome; Y=Y chromosome 1. Use a Punnett square to show
More informationOn the Common Ancestors of All Living Humans
On the Common Ancestors of All Living Humans Douglas L. T. Rohde Massachusetts Institute of Technology November 11, 2003 Abstract Questions concerning the common ancestors of all present-day humans have
More informationDNA Genealogy, Mutation Rates, and Some Historical Evidences Written in Y-Chromosome. I. Basic Principles and the Method
DNA Genealogy, Mutation Rates, and Some Historical Evidences Written in Y-Chromosome. I. Basic Principles and the Method Anatole A. Klyosov 1 Abstract Origin of peoples in a context of DNA genealogy is
More informationChapter 13: Meiosis and Sexual Life Cycles
Name Period Chapter 13: Meiosis and Sexual Life Cycles Concept 13.1 Offspring acquire genes from parents by inheriting chromosomes 1. Let s begin with a review of several terms that you may already know.
More informationGenetomic Promototypes
Genetomic Promototypes Mirkó Palla and Dana Pe er Department of Mechanical Engineering Clarkson University Potsdam, New York and Department of Genetics Harvard Medical School 77 Avenue Louis Pasteur Boston,
More informationMitochondrial DNA PCR and Sequencing. Table of Contents Fall 2012
Mitochondrial DNA PCR and Sequencing Table of Contents Mitochondrial DNA as a Molecular Clock Introduction.....1 Mitochondrial DNA Replication.......1 Setting the Molecular Clock........ 3 Mitochondrial
More informationCCR Biology - Chapter 10 Practice Test - Summer 2012
Name: Class: Date: CCR Biology - Chapter 10 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. What is the term for a feature
More informationOkami Study Guide: Chapter 3 1
Okami Study Guide: Chapter 3 1 Chapter in Review 1. Heredity is the tendency of offspring to resemble their parents in various ways. Genes are units of heredity. They are functional strands of DNA grouped
More informationBeginner s Guide to Real-Time PCR
Beginner s Guide to Real-Time PCR 02 Real-time PCR basic principles PCR or the Polymerase Chain Reaction has become the cornerstone of modern molecular biology the world over. Real-time PCR is an advanced
More information( 1) Most human populations are a product of mixture of genetically distinct groups that intermixed within the last 4,000 years.
Frequently asked questions about A Genetic Atlas of Human Admixture History G. Hellenthal, G.B.J. Busby, G. Band, J.F. Wilson, C. Capelli, D. Falush, S. Myers, Science (2014) SUMMARY What is your work
More information