3/31 Using DNA to Track Your Ancestors

Size: px
Start display at page:

Download "3/31 Using DNA to Track Your Ancestors"

Transcription

1 1/9/16 11:49 AM 3/31 Using DNA to Track Your Ancestors DNA analysis: General Procedure (slide 1) Amplify sections of the DNA Separate DNA fragments by length and visualize Compare the DNA pattern between two individuals Types of DNA analysis (slide 2) Compare sequenced genomes (Slide 3) o Architecture

2 o Dependent on methods o Finding orthologs o rrna gene Scientists use DNA to trace Life s Time line Time Tree compare last common ancestor between two species o Genomics advances o Rapid DNA sequencing o Ability to compare genomes o Ability to compute evolutionary distance from sequence changes (Allan Wilson) o Statistical advances o Baysian probabilities o Markov paths Microsatellite Regions Tandem repeated DNA motifs that range in length from two to five nucleotides, and are typically repeated 5-50 times

3 TATATATATA Dinucleotide repeat/ 5 times Neutral regions-fix mutations Replication slippage changes repeat number 1/1000 replications PCR amplification (slide 3) Amplifying DNA by PCR Using two primers that bracket a particular microsatellite, or VNTR, sequence produces a different pair of DNA bands from each individual.

4 One bands contains the repeated VNTR sequence from the individual's mother and the other from the individual's father. DNA bands obtained from a set of different PCR reactions each of which amplifies the DNA from a different VNTR sequence "fingerprint" to identify each individual nearly uniquely. The starting material for the PCR reaction can be a single hair that was left at the scene of a crime. Single nucleotide polymorphisms (Slide 4) Change of a single base (variation) at a known location o 8.8 x 10 5 SNPs/ 2.7 x 10 9 bp in human DNA Detected on SNP chips

5 o An array containing immobilized allelespecific oligonucleotide (ASO) probes. o Fragmented nucleic acid sequences of target, labeled with fluorescent dyes. o A detection system that records and interprets the hybridization signal. o Ancient hominid DNA-Whole DNA approach (Slide 6)

6 o Homo heidelbergensis-ancestor of H.neanderthal,H.denisova, and H. sapiens o New species yet to be discovered Neanderthal and Denisovan % of genome Haplogroups (Slide 7) Defined by a unique SNP Haplotypes Identical mutations within the Haplogroup

7 Eve and her 7 Daughters (Slide 8) Mitochondrial Eve:matrilineal most recent common ancestor (MRCA) of all currently

8 living humans o mtdna inherited by both male and female offspring o lived between 99,000 and 200,000 years ago,most likely in East Africa Alan Wilson (molecular clock) 1986 mt work

9 o Post-doc Wesley Brown-Mutation in mtdna is fast 1%/million years Large variation among human subjects o Grad student Rebecca Cann Collected mt DNA based on ethnicity (100 samples)

10 o Grad student Mark Stoneking Collected mt DNA samples from aboriginal Australians New Guineans and!kung o All current mtdna derived from a specific women in East Africa Common misconceptions o Not the only women o Not a fixed individual over time o Not necessarily a contemporary of Y chromosome Adam o Not the most recent ancestor shared by all humans Human MRCA 5000 years ago ú A few thousand years before MRCA, all humans then alive left no descendants alive today or were common ancestors of all

11 humans alive today (identical ancestor point) each present-day human has exactly the same set of genealogical ancestors" alive at the "identical ancestors point" o Not the biblical eve Y-chromosome Adam (Slide 9) Almost all males inherit Y chromosome from a single male

12 o Lived 200,000 years ago Emergence of anatomically modern H. sapiens Lived before Eve Lived in North-west Africa Both Y and mt studies support out of Africa Hypothesis Commercial Genealogy Companies (slide 10) Services available 111 segments of your Y chromosome Some or all of your mitochondrial DNA Most of your 22 non-sex chromosomes (1 million markers) Ancestory.com Originally Sorenson Molecular Genealogy Foundation (1999) Started by a Mormon billionaire to look at DNA from Norway

13 Associated with the Mormon family History Centers-Giant database of genealogy data Collected DNA from Norway, Africa, Asia, Kyrgyztan, Mongolia greater than 100,000 samples Acquired by ancestory.com (2112) Documented lineages of more than 700,000 sites on the genome including mtdna and the Y chromosome Family Tree DNA(2000) Bennett Greenspan based on two genetics cases in media of shared Y chromosome Male descendants of Thomas Jefferson and Sally Hemings Many Cohen males of Ashkenazic and Sephardic origin (Cohen Modal Haplotypehaplogroup J) Diaspora marker for descendants of Aaron

14 Appears in other haplotypes not associated with Cohen Multiple lineages among Cohen Y-chromosome Levi (son of Jacob) Haplogroup E1b1b1 common in Eastern Europeans Haplogroups J1 and 2 and E1b1b1 are prevalent among Jewish populations Samaritan Cohens Distinct religious and cultural sect Broke away from mainstream Jews in 5BCE Maintain extensive genealogical records Belong to haplogroup E1b1b1 All crowd sourced Family Tree DNA largest collection of mt and Y chromosome data What genealogical information is written in the DNA (TheGeneticGenealogist.com YourGeneticGenealogist.com)

15 Place of origin Religious origins Geographic origins Adoptees to find families Baby switches in hospitals Abandoned infants Genetic based social networks Companies track genetic cousins and specific segments of the genome o Alert customers to large shared segments-identity by descent o Trace back from autosomal DNA 5 generations o Identify 3d cousins 90% prob o 4 th cousin with 50% prob o 5 th cousin with 10% prob o documented examples of 8 th cousins

16 o Large enough group of descendants in a single family line, rebuild the genome of the group s common ancestor o Theoretically, rebuild the population of a city in 1850

The Story of Human Evolution Part 1: From ape-like ancestors to modern humans

The Story of Human Evolution Part 1: From ape-like ancestors to modern humans The Story of Human Evolution Part 1: From ape-like ancestors to modern humans Slide 1 The Story of Human Evolution This powerpoint presentation tells the story of who we are and where we came from - how

More information

From Africa to Aotearoa Part 1: Out of Africa

From Africa to Aotearoa Part 1: Out of Africa From Africa to Aotearoa Part 1: Out of Africa The spread of modern humans out of Africa started around 65,000 years ago, and ended with the settlement of New Zealand 750 years ago. These PowerPoint presentations

More information

Forensic DNA Testing Terminology

Forensic DNA Testing Terminology Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.

More information

The sample is taken with a simple mouth swab no blood is involved. There will be instructions included on how to take the sample.

The sample is taken with a simple mouth swab no blood is involved. There will be instructions included on how to take the sample. DNA testing Thanks for your enquiry about DNA testing. I oversee the Scottish DNA Project on behalf of the University of Strathclyde, Glasgow and act as representative for Family Tree DNA who host our

More information

Mitochondrial DNA Analysis

Mitochondrial DNA Analysis Mitochondrial DNA Analysis Lineage Markers Lineage markers are passed down from generation to generation without changing Except for rare mutation events They can help determine the lineage (family tree)

More information

Y Chromosome Markers

Y Chromosome Markers Y Chromosome Markers Lineage Markers Autosomal chromosomes recombine with each meiosis Y and Mitochondrial DNA does not This means that the Y and mtdna remains constant from generation to generation Except

More information

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Genetic engineering: humans Gene replacement therapy or gene therapy Many technical and ethical issues implications for gene pool for germ-line gene therapy what traits constitute disease rather than just

More information

Gene Mapping Techniques

Gene Mapping Techniques Gene Mapping Techniques OBJECTIVES By the end of this session the student should be able to: Define genetic linkage and recombinant frequency State how genetic distance may be estimated State how restriction

More information

Single Nucleotide Polymorphisms (SNPs)

Single Nucleotide Polymorphisms (SNPs) Single Nucleotide Polymorphisms (SNPs) Additional Markers 13 core STR loci Obtain further information from additional markers: Y STRs Separating male samples Mitochondrial DNA Working with extremely degraded

More information

Genetic Variation and Human Evolution Lynn B. Jorde, Ph.D. Department of Human Genetics University of Utah School of Medicine.

Genetic Variation and Human Evolution Lynn B. Jorde, Ph.D. Department of Human Genetics University of Utah School of Medicine. Genetic Variation and Human Evolution Lynn B. Jorde, Ph.D. Department of Human Genetics University of Utah School of Medicine. The past two decades have witnessed an explosion of human genetic data. Innumerable

More information

Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA

Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA Page 1 of 5 Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA Genetics Exercise: Understanding how meiosis affects genetic inheritance and DNA patterns

More information

MCB41: Second Midterm Spring 2009

MCB41: Second Midterm Spring 2009 MCB41: Second Midterm Spring 2009 Before you start, print your name and student identification number (S.I.D) at the top of each page. There are 7 pages including this page. You will have 50 minutes for

More information

I Have the Results of My Genetic Genealogy Test, Now What?

I Have the Results of My Genetic Genealogy Test, Now What? I Have the Results of My Genetic Genealogy Test, Now What? Version 2.1 1 I Have the Results of My Genetic Genealogy Test, Now What? Chapter 1: What Is (And Isn t) Genetic Genealogy? Chapter 2: How Do I

More information

Some ancestors are difficult to trace. Adoptions illegitimacies, name changes and migrations can present brick walls in our research that seem

Some ancestors are difficult to trace. Adoptions illegitimacies, name changes and migrations can present brick walls in our research that seem Some ancestors are difficult to trace. Adoptions illegitimacies, name changes and migrations can present brick walls in our research that seem impregnable. In other cases, documentation that would shed

More information

Tracing the evolution of the genus Homo is important for understanding the ancestry of humans; the only living species of Homo.

Tracing the evolution of the genus Homo is important for understanding the ancestry of humans; the only living species of Homo. Section 3: Tracing the evolution of the genus Homo is important for understanding the ancestry of humans; the only living species of Homo. K What I Know W What I Want to Find Out L What I Learned Essential

More information

GENETIC GENEALOGY AND DNA TESTING

GENETIC GENEALOGY AND DNA TESTING GENETIC GENEALOGY AND DNA TESTING by Ted Steele This publication may be ordered from: St. Louis Genealogical Society P. O. Box 432010 St. Louis, MO 63143 Copyright 2013 St. Louis Genealogical Society All

More information

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99. 1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence

More information

Commonly Used STR Markers

Commonly Used STR Markers Commonly Used STR Markers Repeats Satellites 100 to 1000 bases repeated Minisatellites VNTR variable number tandem repeat 10 to 100 bases repeated Microsatellites STR short tandem repeat 2 to 6 bases repeated

More information

The Human Genome Project

The Human Genome Project The Human Genome Project Brief History of the Human Genome Project Physical Chromosome Maps Genetic (or Linkage) Maps DNA Markers Sequencing and Annotating Genomic DNA What Have We learned from the HGP?

More information

DNA Testing for Genealogy - What Can It Do For You??

DNA Testing for Genealogy - What Can It Do For You?? DNA Testing for Genealogy - What Can It Do For You?? Paper courtesy of Roberta Estes, www.dnaexplain.com, e-mail Roberta at Roberta@dnaexplain.com. Graphics courtesy of Family Tree DNA, www.familytreedna.com.

More information

14.3 Studying the Human Genome

14.3 Studying the Human Genome 14.3 Studying the Human Genome Lesson Objectives Summarize the methods of DNA analysis. State the goals of the Human Genome Project and explain what we have learned so far. Lesson Summary Manipulating

More information

Rethinking Polynesian Origins: Human Settlement of the Pacific

Rethinking Polynesian Origins: Human Settlement of the Pacific LENScience Senior Biology Seminar Series Rethinking Polynesian Origins: Human Settlement of the Pacific Michal Denny, and Lisa Matisoo-Smith Our Polynesian ancestors are renowned as some of the world s

More information

Innovations in Molecular Epidemiology

Innovations in Molecular Epidemiology Innovations in Molecular Epidemiology Molecular Epidemiology Measure current rates of active transmission Determine whether recurrent tuberculosis is attributable to exogenous reinfection Determine whether

More information

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,

More information

CHROMOSOMES Dr. Fern Tsien, Dept. of Genetics, LSUHSC, NO, LA

CHROMOSOMES Dr. Fern Tsien, Dept. of Genetics, LSUHSC, NO, LA CHROMOSOMES Dr. Fern Tsien, Dept. of Genetics, LSUHSC, NO, LA Cytogenetics is the study of chromosomes and their structure, inheritance, and abnormalities. Chromosome abnormalities occur in approximately:

More information

Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs)

Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs) Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs) Single nucleotide polymorphisms or SNPs (pronounced "snips") are DNA sequence variations that occur

More information

NORSE VIKING HERITAGE

NORSE VIKING HERITAGE NORSE VIKING HERITAGE My mother's maiden name is WILLIAMSON. Her ancestors in the paternal line came from the Shetland Islands. The Shetland Islands were settled by Norse Vikings beginning before 800 AD.

More information

Matthew Kaplan and Taylor Edwards. University of Arizona Tucson, Arizona

Matthew Kaplan and Taylor Edwards. University of Arizona Tucson, Arizona Matthew Kaplan and Taylor Edwards University of Arizona Tucson, Arizona Unresolved paternity Consent for testing Ownership of Samples Uncovering genetic disorders SRY Reversal / Klinefelter s Syndrome

More information

Level 3 Biology, 2012

Level 3 Biology, 2012 90719 907190 3SUPERVISOR S Level 3 Biology, 2012 90719 Describe trends in human evolution 2.00 pm Tuesday 13 November 2012 Credits: Three Check that the National Student Number (NSN) on your admission

More information

Fact Sheet 14 EPIGENETICS

Fact Sheet 14 EPIGENETICS This fact sheet describes epigenetics which refers to factors that can influence the way our genes are expressed in the cells of our body. In summary Epigenetics is a phenomenon that affects the way cells

More information

DNA and Forensic Science

DNA and Forensic Science DNA and Forensic Science Micah A. Luftig * Stephen Richey ** I. INTRODUCTION This paper represents a discussion of the fundamental principles of DNA technology as it applies to forensic testing. A brief

More information

Elsevier Editorial System(tm) for Forensic Science International: Genetics Manuscript Draft

Elsevier Editorial System(tm) for Forensic Science International: Genetics Manuscript Draft Elsevier Editorial System(tm) for Forensic Science International: Genetics Manuscript Draft Manuscript Number: Title: A comment on the Paper: A comparison of Y-chromosomal lineage dating using either resequencing

More information

Paternity Testing. Chapter 23

Paternity Testing. Chapter 23 Paternity Testing Chapter 23 Kinship and Paternity DNA analysis can also be used for: Kinship testing determining whether individuals are related Paternity testing determining the father of a child Missing

More information

Worksheet - COMPARATIVE MAPPING 1

Worksheet - COMPARATIVE MAPPING 1 Worksheet - COMPARATIVE MAPPING 1 The arrangement of genes and other DNA markers is compared between species in Comparative genome mapping. As early as 1915, the geneticist J.B.S Haldane reported that

More information

Algorithms in Computational Biology (236522) spring 2007 Lecture #1

Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office

More information

This fact sheet describes how genes affect our health when they follow a well understood pattern of genetic inheritance known as autosomal recessive.

This fact sheet describes how genes affect our health when they follow a well understood pattern of genetic inheritance known as autosomal recessive. 11111 This fact sheet describes how genes affect our health when they follow a well understood pattern of genetic inheritance known as autosomal recessive. In summary Genes contain the instructions for

More information

CCR Biology - Chapter 9 Practice Test - Summer 2012

CCR Biology - Chapter 9 Practice Test - Summer 2012 Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible

More information

Genetics Module B, Anchor 3

Genetics Module B, Anchor 3 Genetics Module B, Anchor 3 Key Concepts: - An individual s characteristics are determines by factors that are passed from one parental generation to the next. - During gamete formation, the alleles for

More information

The following chapter is called "Preimplantation Genetic Diagnosis (PGD)".

The following chapter is called Preimplantation Genetic Diagnosis (PGD). Slide 1 Welcome to chapter 9. The following chapter is called "Preimplantation Genetic Diagnosis (PGD)". The author is Dr. Maria Lalioti. Slide 2 The learning objectives of this chapter are: To learn the

More information

The Techniques of Molecular Biology: Forensic DNA Fingerprinting

The Techniques of Molecular Biology: Forensic DNA Fingerprinting Revised Fall 2011 The Techniques of Molecular Biology: Forensic DNA Fingerprinting The techniques of molecular biology are used to manipulate the structure and function of molecules such as DNA and proteins

More information

All your base(s) are belong to us

All your base(s) are belong to us All your base(s) are belong to us The dawn of the high-throughput DNA sequencing era 25C3 Magnus Manske The place Sanger Center, Cambridge, UK Basic biology Level of complexity Genome Single (all chromosomes

More information

The Chinese University of Hong Kong School of Life Sciences Biochemistry Program CUGEN Ltd.

The Chinese University of Hong Kong School of Life Sciences Biochemistry Program CUGEN Ltd. The Chinese University of Hong Kong School of Life Sciences Biochemistry Program CUGEN Ltd. DNA Forensic and Agarose Gel Electrophoresis 1 OBJECTIVES Prof. Stephen K.W. Tsui, Dr. Patrick Law and Miss Fion

More information

Gene mutation and molecular medicine Chapter 15

Gene mutation and molecular medicine Chapter 15 Gene mutation and molecular medicine Chapter 15 Lecture Objectives What Are Mutations? How Are DNA Molecules and Mutations Analyzed? How Do Defective Proteins Lead to Diseases? What DNA Changes Lead to

More information

SNP Essentials The same SNP story

SNP Essentials The same SNP story HOW SNPS HELP RESEARCHERS FIND THE GENETIC CAUSES OF DISEASE SNP Essentials One of the findings of the Human Genome Project is that the DNA of any two people, all 3.1 billion molecules of it, is more than

More information

Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS)

Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) A typical RNA Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,

More information

Human Genome and Human Genome Project. Louxin Zhang

Human Genome and Human Genome Project. Louxin Zhang Human Genome and Human Genome Project Louxin Zhang A Primer to Genomics Cells are the fundamental working units of every living systems. DNA is made of 4 nucleotide bases. The DNA sequence is the particular

More information

Use of the Agilent 2100 Bioanalyzer and the DNA 500 LabChip in the Analysis of PCR Amplified Mitochondrial DNA Application

Use of the Agilent 2100 Bioanalyzer and the DNA 500 LabChip in the Analysis of PCR Amplified Mitochondrial DNA Application Use of the Agilent 2100 Bioanalyzer and the DNA LabChip in the Analysis of PCR Amplified Mitochondrial DNA Application Homeland Security/Forensics Author Mark Jensen Agilent Technologies, Inc. 2850 Centerville

More information

Genetic Technology. Name: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question.

Genetic Technology. Name: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question. Name: Class: Date: Genetic Technology Multiple Choice Identify the choice that best completes the statement or answers the question. 1. An application of using DNA technology to help environmental scientists

More information

A Primer of Genome Science THIRD

A Primer of Genome Science THIRD A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:

More information

DNA: A Person s Ultimate Fingerprint

DNA: A Person s Ultimate Fingerprint A partnership between the UAB Center for Community Outreach Development and McWane Center DNA: A Person s Ultimate Fingerprint This project is supported by a Science Education Partnership Award (SEPA)

More information

Bob Jesberg. Boston, MA April 3, 2014

Bob Jesberg. Boston, MA April 3, 2014 DNA, Replication and Transcription Bob Jesberg NSTA Conference Boston, MA April 3, 2014 1 Workshop Agenda Looking at DNA and Forensics The DNA, Replication i and Transcription i Set DNA Ladder The Double

More information

Annex to the Accreditation Certificate D-PL-13372-01-00 according to DIN EN ISO/IEC 17025:2005

Annex to the Accreditation Certificate D-PL-13372-01-00 according to DIN EN ISO/IEC 17025:2005 Deutsche Akkreditierungsstelle GmbH German Accreditation Body Annex to the Accreditation Certificate D-PL-13372-01-00 according to DIN EN ISO/IEC 17025:2005 Period of validity: 26.03.2012 to 25.03.2017

More information

Genetics Test Biology I

Genetics Test Biology I Genetics Test Biology I Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Avery s experiments showed that bacteria are transformed by a. RNA. c. proteins.

More information

Development of two Novel DNA Analysis methods to Improve Workflow Efficiency for Challenging Forensic Samples

Development of two Novel DNA Analysis methods to Improve Workflow Efficiency for Challenging Forensic Samples Development of two Novel DNA Analysis methods to Improve Workflow Efficiency for Challenging Forensic Samples Sudhir K. Sinha, Ph.D.*, Anne H. Montgomery, M.S., Gina Pineda, M.S., and Hiromi Brown, Ph.D.

More information

Difficult DNA Templates Sequencing. Primer Walking Service

Difficult DNA Templates Sequencing. Primer Walking Service Difficult DNA Templates Sequencing Primer Walking Service Result 16/18s (ITS 5.8s) rrna Sequencing Phylogenetic tree 16s rrna Region ITS rrna Region ITS and 26s rrna Region Order and Result Cloning Service

More information

Overview of Genetic Testing and Screening

Overview of Genetic Testing and Screening Integrating Genetics into Your Practice Webinar Series Overview of Genetic Testing and Screening Genetic testing is an important tool in the screening and diagnosis of many conditions. New technology is

More information

PRINCIPLES OF POPULATION GENETICS

PRINCIPLES OF POPULATION GENETICS PRINCIPLES OF POPULATION GENETICS FOURTH EDITION Daniel L. Hartl Harvard University Andrew G. Clark Cornell University UniversitSts- und Landesbibliothek Darmstadt Bibliothek Biologie Sinauer Associates,

More information

Edlund, H., Allen, M. (2009) Y chromosomal STR analysis using Pyrosequencing technology. Forensic Science International: Genetics, 3(2):119-124

Edlund, H., Allen, M. (2009) Y chromosomal STR analysis using Pyrosequencing technology. Forensic Science International: Genetics, 3(2):119-124 Till min familj List of Papers This thesis is based on the following papers, which are referred to in the text by their Roman numerals. I II III IV Edlund, H., Allen, M. (2009) Y chromosomal STR analysis

More information

Name Class Date. binomial nomenclature. MAIN IDEA: Linnaeus developed the scientific naming system still used today.

Name Class Date. binomial nomenclature. MAIN IDEA: Linnaeus developed the scientific naming system still used today. Section 1: The Linnaean System of Classification 17.1 Reading Guide KEY CONCEPT Organisms can be classified based on physical similarities. VOCABULARY taxonomy taxon binomial nomenclature genus MAIN IDEA:

More information

Summary. 16 1 Genes and Variation. 16 2 Evolution as Genetic Change. Name Class Date

Summary. 16 1 Genes and Variation. 16 2 Evolution as Genetic Change. Name Class Date Chapter 16 Summary Evolution of Populations 16 1 Genes and Variation Darwin s original ideas can now be understood in genetic terms. Beginning with variation, we now know that traits are controlled by

More information

Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis

Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype

More information

Data Analysis for Ion Torrent Sequencing

Data Analysis for Ion Torrent Sequencing IFU022 v140202 Research Use Only Instructions For Use Part III Data Analysis for Ion Torrent Sequencing MANUFACTURER: Multiplicom N.V. Galileilaan 18 2845 Niel Belgium Revision date: August 21, 2014 Page

More information

Crime Scenes and Genes

Crime Scenes and Genes Glossary Agarose Biotechnology Cell Chromosome DNA (deoxyribonucleic acid) Electrophoresis Gene Micro-pipette Mutation Nucleotide Nucleus PCR (Polymerase chain reaction) Primer STR (short tandem repeats)

More information

Genomes and SNPs in Malaria and Sickle Cell Anemia

Genomes and SNPs in Malaria and Sickle Cell Anemia Genomes and SNPs in Malaria and Sickle Cell Anemia Introduction to Genome Browsing with Ensembl Ensembl The vast amount of information in biological databases today demands a way of organising and accessing

More information

Biology Final Exam Study Guide: Semester 2

Biology Final Exam Study Guide: Semester 2 Biology Final Exam Study Guide: Semester 2 Questions 1. Scientific method: What does each of these entail? Investigation and Experimentation Problem Hypothesis Methods Results/Data Discussion/Conclusion

More information

DNA PROFILING IN FORENSIC SCIENCE

DNA PROFILING IN FORENSIC SCIENCE DA PROFILIG I FORESIC SCIECE DA is the chemical code that is found in every cell of an individual's body, and is unique to each individual. Because it is unique, the ability to examine DA found at a crime

More information

DNA Sequence Analysis

DNA Sequence Analysis DNA Sequence Analysis Two general kinds of analysis Screen for one of a set of known sequences Determine the sequence even if it is novel Screening for a known sequence usually involves an oligonucleotide

More information

Information leaflet. Centrum voor Medische Genetica. Version 1/20150504 Design by Ben Caljon, UZ Brussel. Universitair Ziekenhuis Brussel

Information leaflet. Centrum voor Medische Genetica. Version 1/20150504 Design by Ben Caljon, UZ Brussel. Universitair Ziekenhuis Brussel Information on genome-wide genetic testing Array Comparative Genomic Hybridization (array CGH) Single Nucleotide Polymorphism array (SNP array) Massive Parallel Sequencing (MPS) Version 120150504 Design

More information

DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA

DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA DNA Fingerprinting Unless they are identical twins, individuals have unique DNA DNA fingerprinting The name used for the unambiguous identifying technique that takes advantage of differences in DNA sequence

More information

How many of you have checked out the web site on protein-dna interactions?

How many of you have checked out the web site on protein-dna interactions? How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss

More information

SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE

SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE AP Biology Date SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE LEARNING OBJECTIVES Students will gain an appreciation of the physical effects of sickle cell anemia, its prevalence in the population,

More information

Becker Muscular Dystrophy

Becker Muscular Dystrophy Muscular Dystrophy A Case Study of Positional Cloning Described by Benjamin Duchenne (1868) X-linked recessive disease causing severe muscular degeneration. 100 % penetrance X d Y affected male Frequency

More information

The Central Dogma of Molecular Biology

The Central Dogma of Molecular Biology Vierstraete Andy (version 1.01) 1/02/2000 -Page 1 - The Central Dogma of Molecular Biology Figure 1 : The Central Dogma of molecular biology. DNA contains the complete genetic information that defines

More information

Recombinant DNA and Biotechnology

Recombinant DNA and Biotechnology Recombinant DNA and Biotechnology Chapter 18 Lecture Objectives What Is Recombinant DNA? How Are New Genes Inserted into Cells? What Sources of DNA Are Used in Cloning? What Other Tools Are Used to Study

More information

Next Generation Sequencing: Technology, Mapping, and Analysis

Next Generation Sequencing: Technology, Mapping, and Analysis Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University gbenson@bu.edu http://tandem.bu.edu/ The Human Genome Project took

More information

About The Causes of Hearing Loss

About The Causes of Hearing Loss About 1 in 500 infants is born with or develops hearing loss during early childhood. Hearing loss has many causes: some are genetic (that is, caused by a baby s genes) or non-genetic (such as certain infections

More information

Molecular typing of VTEC: from PFGE to NGS-based phylogeny

Molecular typing of VTEC: from PFGE to NGS-based phylogeny Molecular typing of VTEC: from PFGE to NGS-based phylogeny Valeria Michelacci 10th Annual Workshop of the National Reference Laboratories for E. coli in the EU Rome, November 5 th 2015 Molecular typing

More information

IIID 14. Biotechnology in Fish Disease Diagnostics: Application of the Polymerase Chain Reaction (PCR)

IIID 14. Biotechnology in Fish Disease Diagnostics: Application of the Polymerase Chain Reaction (PCR) IIID 14. Biotechnology in Fish Disease Diagnostics: Application of the Polymerase Chain Reaction (PCR) Background Infectious diseases caused by pathogenic organisms such as bacteria, viruses, protozoa,

More information

PAPER RFLP TEACHER GUIDE

PAPER RFLP TEACHER GUIDE PAPER RFLP TEACHER GUIDE Paper = DNA Scissors = Restriction Enzyme Desktop = Electrophoresis NOTE: There are TWO versions of this activity one where the students write their own sentences (to represent

More information

X Linked Inheritance

X Linked Inheritance X Linked Inheritance Information for Patients and Families 2 X linked Inheritance The following will give you information about what X linked inheritance means and how X linked conditions are inherited.

More information

DNA Insertions and Deletions in the Human Genome. Philipp W. Messer

DNA Insertions and Deletions in the Human Genome. Philipp W. Messer DNA Insertions and Deletions in the Human Genome Philipp W. Messer Genetic Variation CGACAATAGCGCTCTTACTACGTGTATCG : : CGACAATGGCGCT---ACTACGTGCATCG 1. Nucleotide mutations 2. Genomic rearrangements 3.

More information

ABSTRACT. Promega Corporation, Updated September 2008. http://www.promega.com/pubhub. 1 Campbell-Staton, S.

ABSTRACT. Promega Corporation, Updated September 2008. http://www.promega.com/pubhub. 1 Campbell-Staton, S. A Modified Wizard SV Genomic DNA Purification System Protocol to Purify Genomic DNA... A Modified Wizard SV Genomic DNA Purification System Protocol to Purify Genomic DNA from Shed Reptile Skin ABSTRACT

More information

Human Genome Organization: An Update. Genome Organization: An Update

Human Genome Organization: An Update. Genome Organization: An Update Human Genome Organization: An Update Genome Organization: An Update Highlights of Human Genome Project Timetable Proposed in 1990 as 3 billion dollar joint venture between DOE and NIH with 15 year completion

More information

Recovering the Romanovs

Recovering the Romanovs Recovering the Romanovs Description of activity Recovering the Romanovs is an excellent opening to any unit on human genetics. To complete the three parts of this module, approximately three 40-minute

More information

Nucleic Acid Techniques in Bacterial Systematics

Nucleic Acid Techniques in Bacterial Systematics Nucleic Acid Techniques in Bacterial Systematics Edited by Erko Stackebrandt Department of Microbiology University of Queensland St Lucia, Australia and Michael Goodfellow Department of Microbiology University

More information

Globally, about 9.7% of cancers in men are prostate cancers, and the risk of developing the

Globally, about 9.7% of cancers in men are prostate cancers, and the risk of developing the Chapter 5 Analysis of Prostate Cancer Association Study Data 5.1 Risk factors for Prostate Cancer Globally, about 9.7% of cancers in men are prostate cancers, and the risk of developing the disease has

More information

Technical Note. Roche Applied Science. No. LC 18/2004. Assay Formats for Use in Real-Time PCR

Technical Note. Roche Applied Science. No. LC 18/2004. Assay Formats for Use in Real-Time PCR Roche Applied Science Technical Note No. LC 18/2004 Purpose of this Note Assay Formats for Use in Real-Time PCR The LightCycler Instrument uses several detection channels to monitor the amplification of

More information

Chapter 3. Chapter Outline. Chapter Outline 9/11/10. Heredity and Evolu4on

Chapter 3. Chapter Outline. Chapter Outline 9/11/10. Heredity and Evolu4on Chapter 3 Heredity and Evolu4on Chapter Outline The Cell DNA Structure and Function Cell Division: Mitosis and Meiosis The Genetic Principles Discovered by Mendel Mendelian Inheritance in Humans Misconceptions

More information

Marrying a relative. Is there an increased chance that a child will have genetic problems if its parents are related to each other?

Marrying a relative. Is there an increased chance that a child will have genetic problems if its parents are related to each other? Marrying a relative Is there an increased chance that a child will have genetic problems if its parents are related to each other? The simple answer to this question is Yes, there is an increased chance.

More information

DNA Testing and the Melungeons

DNA Testing and the Melungeons DNA Testing and the Melungeons Roberta Estes, copyright 2006-2008, restes@comcast.net DNA testing has become an integral part of any genealogical endeavor, generally as part of a surname project. However,

More information

Recovering the Romanovs

Recovering the Romanovs Recovering the Romanovs ACTIVITY 1 The Romanov Family: Screen #4 Inheritance of a Sex-linked Trait Key: H=normal allele; h=hemophilia allele; X=X chromosome; Y=Y chromosome 1. Use a Punnett square to show

More information

On the Common Ancestors of All Living Humans

On the Common Ancestors of All Living Humans On the Common Ancestors of All Living Humans Douglas L. T. Rohde Massachusetts Institute of Technology November 11, 2003 Abstract Questions concerning the common ancestors of all present-day humans have

More information

DNA Genealogy, Mutation Rates, and Some Historical Evidences Written in Y-Chromosome. I. Basic Principles and the Method

DNA Genealogy, Mutation Rates, and Some Historical Evidences Written in Y-Chromosome. I. Basic Principles and the Method DNA Genealogy, Mutation Rates, and Some Historical Evidences Written in Y-Chromosome. I. Basic Principles and the Method Anatole A. Klyosov 1 Abstract Origin of peoples in a context of DNA genealogy is

More information

Chapter 13: Meiosis and Sexual Life Cycles

Chapter 13: Meiosis and Sexual Life Cycles Name Period Chapter 13: Meiosis and Sexual Life Cycles Concept 13.1 Offspring acquire genes from parents by inheriting chromosomes 1. Let s begin with a review of several terms that you may already know.

More information

Genetomic Promototypes

Genetomic Promototypes Genetomic Promototypes Mirkó Palla and Dana Pe er Department of Mechanical Engineering Clarkson University Potsdam, New York and Department of Genetics Harvard Medical School 77 Avenue Louis Pasteur Boston,

More information

Mitochondrial DNA PCR and Sequencing. Table of Contents Fall 2012

Mitochondrial DNA PCR and Sequencing. Table of Contents Fall 2012 Mitochondrial DNA PCR and Sequencing Table of Contents Mitochondrial DNA as a Molecular Clock Introduction.....1 Mitochondrial DNA Replication.......1 Setting the Molecular Clock........ 3 Mitochondrial

More information

CCR Biology - Chapter 10 Practice Test - Summer 2012

CCR Biology - Chapter 10 Practice Test - Summer 2012 Name: Class: Date: CCR Biology - Chapter 10 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. What is the term for a feature

More information

Okami Study Guide: Chapter 3 1

Okami Study Guide: Chapter 3 1 Okami Study Guide: Chapter 3 1 Chapter in Review 1. Heredity is the tendency of offspring to resemble their parents in various ways. Genes are units of heredity. They are functional strands of DNA grouped

More information

Beginner s Guide to Real-Time PCR

Beginner s Guide to Real-Time PCR Beginner s Guide to Real-Time PCR 02 Real-time PCR basic principles PCR or the Polymerase Chain Reaction has become the cornerstone of modern molecular biology the world over. Real-time PCR is an advanced

More information

( 1) Most human populations are a product of mixture of genetically distinct groups that intermixed within the last 4,000 years.

( 1) Most human populations are a product of mixture of genetically distinct groups that intermixed within the last 4,000 years. Frequently asked questions about A Genetic Atlas of Human Admixture History G. Hellenthal, G.B.J. Busby, G. Band, J.F. Wilson, C. Capelli, D. Falush, S. Myers, Science (2014) SUMMARY What is your work

More information