cdna sequence and expression pattern of the putative

Transcription

1 Proc. Natl. Acad. Sci. USA Vol. 92, pp , March 1995 Biochemistry cdna sequence and expression pattern of the putative pheromone carrier aphrodisin (lipocalin/hamster/vagina/bartholin's glands) HANS-JURGEN MAGERT*t, THORSTEN HADRYS*, ALEXANDRA CIESLAK*, ANJA GROGER*, STEPHAN FELLERt, AND WOLF-GEORG FORSSMANN* *Lower Saxony Institute for Peptide Research, Feodor-Lynen-Strasse 31, Hannover, Germany; and tdepartment of Molecular Oncology, Rockefeller University, York Avenue, New York, NY Communicated by M. Lindauer, Universitat Wurzburg, Wurzburg, Germany, October 5, 1994 ABSTRACT The cdna sequence for aphrodisin, a lipocalin from hamster vaginal discharge which is involved in pheromonal activity, has been determined. Corresponding genomic clones were isolated and the promoter region was identified. Primer extension analysis revealed an adenosine residue as the main transcription initiation site, located 50 bp upstream of the translation start codon ATG, which is surrounded by a typical Kozak sequence. However, data from polymerase chain reaction analysis suggest the existence of at least one alternative transcription initiation site. The aphrodisin cdna is 732 bp long and codes for the mature 151-aa aphrodisin and an additional N-terminal 16-aa secretory signal peptide. The 3' nontranslated region is 228 bp long. Among the known sequences, the aphrodisin cdna shares the highest homology with the rat odorant-binding protein cdna (45%), which verifies the protein data. Vaginal tissue and Bartholin's glands are the main aphrodisin gene-expressing tissues of the female hamster genital tract, as demonstrated by Northern blot analysis. Under less stringent hybridization conditions, RNA isolated from rat Bartholin's glands also showed a signal, indicating the occurrence of aphrodisinrelated mrna in this species. The so-called lipocalins (lipocalycins) are a superfamily of structurally related proteins in the size range of kda which typically consist of two sets of four antiparallel,3-strands arranged in two orthogonally stranded (3-sheets (1-3). The resulting tertiary structure is comparable to a coffee filter containing an apolar pocket for the noncovalent binding of small hydrophobic molecules such as lipids, steroids, odorants, bilins, and retinoids (3). Most of the lipocalins are known to serve as carriers for the mentioned ligands. However, one of these proteins, prostaglandin D synthase, exhibits enzymatic activity (4, 5). The specificity of the lipocalins for certain ligands is probably determined by the composition of the amino acids within the binding pocket (6). Nevertheless, some lipocalins-for instance,,b-lactoglobulin and mouse major urinary protein-are capable of binding several different ligands (6, 7). The mechanisms of interaction of the lipocalin/ ligand complexes with specific receptors have not been well investigated. In the case of human serum retinol-binding protein, it has been demonstrated that certain parts of the loops connecting the (B-strands are essential for the interaction with an additional protein called transthyretin and a membrane receptor of the target cells. Further, it is proposed that the release of retinol from the binding pocket is triggered by some kind of conformational change in the retinol-binding protein after binding to the receptor (8). Aphrodisin, a 17-kDa glycoprotein of the lipocalin family, has been purified from hamster vaginal discharge (9). It The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C solely to indicate this fact. consists of 151 aa and contains two disulfide bonds which connect the cysteine residues at positions 38 and 42 and at positions 57 and 149. Its N terminus is blocked by a pyroglutamate residue, indicating the occurrence of a larger primary translational product (10). Acting via the vomeronasal organ (11), aphrodisin elicits copulatory behavior in male hamsters. At this time it is not quite clear whether an additional ligand is required for biological activity but, if this should be the case, it must be bound very tightly to the protein (12). On the other hand, proteolytic or heat degradation of aphrodisincontaining fractions leads to a loss of activity (9). Functions as pheromone-binding proteins have also been discussed for two other lipocalins, the mouse major urinary protein and a-2u globulin (6, 13). Among the known proteins, rat odorant-binding protein (ROBP) shares the highest sequence homology with aphrodisin (40%). It occurs in nasal mucosa of rats and seems to be responsible for the binding of odorant molecules (refs. 14 and 15; for review see ref. 16). Here we report the nucleotide sequence of a 732-bp aphrodisin precursor cdna which codes for the mature protein and an additional N-terminal secretory signal peptide of 16 aa. PCR amplifications of different cdna fragments indicate the existence of at least two transcriptional initiation sites. We show by Northern hybridization that vaginal tissue and Bartholin's glands are the main aphrodisin gene-expressing tissues of the female hamster genital tract. Under less stringent conditions we also obtained a hybridization signal in the expected size range from rat Bartholin's glands, suggesting the synthesis of a related protein. MATERIALS AND METHODS Polymerase Chain Reaction. Total RNA was purified from one female hamster genital tract by means of an automatic nucleic acid extractor (model 340; Applied Biosystems). Five micrograms of the total RNA was subjected to reverse transcription using Moloney murine leukemia virus reverse transcriptase and a synthetic oligo(dt) universal primer (UNIP-2; Fig. 1). One-thirtieth of the cdna mixture was then used for each of the three-step-cycle PCRs (17) in a model 480 thermocycler with Amplitaq DNA polymerase (both from Perkin- Elmer) and synthetic primers (Fig. 1). Cloning of PCR Fragments. PCR fragments were separated in 3% NuSieve GTG agarose gels (Biozyme, Oldendorf, Germany) and purified with a Qiaex kit (Qiagen, Hilden, Germany). The ends of the PCR fragments were cleaved with Xba I, whose recognition sequence was included in the PCR primers. After the short cleavage products were removed by Abbreviation: ROBP, rat odorant-binding protein. tto whom reprint requests should be addressed. I The sequence reported in this paper has been deposited in the GenBank data base (accession no. X65238). 2091

2 2092 Biochemistry: Magert et al. AP-1 AP-2 AP-3 AP-4 AP-5 AP-6 AP-7 AP-8 AP-9 RAP-1 RAP-2 UNIP CCCTCTAGAA TTCARGGNAARTGGTAYACNAT CCTCTA GAA TTCTAYGTNATHACNAAYAAYCARTG AA TCTA GAA TCTMNCCYTCRAAYTGNGTYTG A CTCTA GAA TTCTTYTTYTCRTGNGCRAAYTGNAC AAA TCTA GAA TTCAGTGCTCCAAGACCACAGTCATTGG CGGTCTA GAA TTCGGAAATGGAACYTACCAAACCCAGTTTG TCCTGAGCATGAGCCAGA GCAG1TTTTATAACAATCAATATG CGGTCTAGAA7TCTATCTM1ICAAGATTGTCAGCAGC GCTTTGTCAGTTGAGTTCTTTTC GGAAAAGCAAAGTCAGGCACC poly(a)tail CCTGAA TTCTA GA GCTCA (T) 17 FIG. 1. Nucleotide sequences (in 5' -- 3' orientation) of primers. The positions of the primers within the presented cdna sequence are indicated. Italic regions do not correspond to the cdna sequence but contain recognition sites for restriction endonucleases (Xba I, EcoRI, and, in the case of UNIP-2, also Sst I) which enable easy cloning of the obtained PCR fragments. Proc. Natl. Acad Sci. USA 92 (1995) centrifugation in Centricon filters (Amicon), the fragments were ligated with Xba I-cleaved plasmid puc18 (18). Escherichia coli JM109 cells (18) were transformed with the ligation products by the PEG method (19). Genomic Library Screening. A Golden hamster (Mesocricetus auratus) genomic library in A Fix II (Stratagene) was screened (20) with the 407-bp AP-1/AP-4 aphrodisin cdna PCR fragment, which had been labeled with [a-32p]dctp by use of a random-primer labeling kit (Boehringer Mannheim). Primer Extension Analysis. Total RNA was extracted from Golden hamster vagina and brain as described above. A synthetic antisense oligonucleotide primer (AP-7; Fig. 1) was 5'-end labeled with 32P by use of [,y-32p]atp and T4 polynucleotide kinase and hybridized to 5,ug of total RNA. After the extension reaction (21), the products together with labeled size markers were separated by electrophoresis in a denaturing 8% polyacrylamide gel, which was subsequently exposed to x-ray film (Kodak XAR-5). DNA Sequencing. Nucleotide sequences were determined according to the method of Sanger et al. (22) by means of an automatic fluorescence sequencer (model 373A; Applied Biosystems) (23). To avoid sequence errors caused by misincorporation of nucleotides during PCR, at least three independent clones of each fragment were sequenced. Uncloned PCR fragments were also directly sequenced after agarose gel electrophoresis and purification with Ultrafree-MC filter columns (first 0.45-,um Durapore, then PTTK polysulfone membrane; Millipore) using the PCR primers as sequencing primers Ṅorthern and Southern Blotting. Total RNA was glyoxylated and electrophoretically separated as described (24). RNA and PCR fragments were transferred from the gel to Hybond N+ membrane (Amersham) by use of a PosiBlot pressure blotting apparatus (Stratagene). The nucleic acids were fixed to the membranes according to the manufacturer's instructions. Northern blots were hybridized to the same 32P-labeled PCR fragment, AP-1/AP-4, that was used for genomic library screening. PCR Southern blots (25) were hybridized to a synthetic oligonucleotide (AP-7; Fig. 1) that had been 5'-end labeled with 32p. DNA Sequence Comparisons. Homology searches in the EMBL nucleic acid sequence database, sequence alignments, and other kinds of sequence analyses were performed on an Apple SE 30 computer using the MACMOLLY program package (Soft Gene, Berlin). RESULTS Aphrodisin cdna Sequence. From the already known aphrodisin protein sequence, four degenerate PCR primers were constructed (sense, AP-1 and AP-2; antisense, AP-3 and AP-4; Figs. 1 and 2) and used for the amplification of aphrodisin-specific cdna fragments from total RNA of female hamster genital tract. Four homogeneous PCR fragments were obtained, all of them in the expected size range. The largest fragment (AP-1/AP-4) was cloned in puc18 and three independent clones (ppet1-3) were sequenced. Translation of the cdna into protein sequence and comparison with the aphrodisin amino acid sequence verified the cloning of an aphrodisin-specific partial cdna. By means of this sequence, two highly specific primers (AP-5 and AP-6; Fig. 1) were constructed and used together with the oligo(dt) primer UNIP-2 (Fig. 1) for amplification of the rest of the 3'-terminal cdna (preamplification with AP-5/UNIP-2, final amplification with AP-6/UNIP-2). The 500-bp cdna fragment obtained was cloned in puc18 and five independent clones (ppet11-15) were sequenced. From the partial gene (see below) and cdna sequence, two additional primers (RAP-2 and AP-8; Fig. 1) were derived for the amplification of the rest of the 5'-terminal cdna. The 198-bp fragment obtained was sequenced directly and, by means of overlapping regions, the I-> secretory signal peptide I> mature aphrodisin AP-1 > Met Val Lys Ile Leu Leu Leu Ala Leu Val Phe Ser Leu Ala His Ala Gln Asp Phe Ala Glu Leu Gln Gly Lys Trp Tyr Thr Ile Val Ile Ala Ala Asp Asn Leu Glu Lys Ile acc AM GTA AAG ATU CTG CTG CTG GCT TTG GTC mtt AGT CTG GCT CAT GCT CAG GAT UTT GCA GAG CUT CAA GGA AAA TGG TAT ACC ATU GTC ATT GCT GCT GAC AAT CUT GAA AAG ATA AP-5 AP-2 Glu Glu Gly Gly Pro Leu Arg Phe Tyr Phe Arg His Ile Asp Cys Tyr Lys Asn Cys Ser Glu Met Glu Ile Thr Phe Tyr Val Ile Thr Asn Asn Gln Cys Ser Lys Thr Thr Val Ile GAA GAA GGA GGA CCA CTG AGA TTC TAT UT CGT CAT ATU GAT TGT TAT AAA AAC TGC AGT GAA ATG GAA ATC ACA UT TAT GTC ATT ACA AAC AAC CAG TGC TCC AAG ACC ACA GTC ATT * * 0* _, AP-6 AP-3 Gly Tyr Leu Lys Gly Asn Gly Thr Tyr Gln Thr Gln Phe Glu Gly Asn Asn Ile Phe Gln Pro Leu Tyr Ile Thr Ser Asp Lys Ile Phe Phe Thr Asn Lys Asn Met Asp Arg Ala Gly GGG TAC TUG AM GG AAT GGA ACC TAC CAA ACC CAG UT GAA GGT AAC MT ATA UTT CAA CCT TTG TAT ATA ACA TCA GAC AAG ATT TUC m ACC AAC AAG AAC ATG GAT AGA GCT GGC c - AP-4 Gln Glu Thr Asn Met Ile Val Val Ala Gly Lys Gly Asn Ala Leu Thr Pro Glu Glu Asn Glu Ile Leu Val Gln Phe Ala His Glu Lys Lys Ile Pro Val Glu Asn Ile Leu Asn Ile CAG GAA ACG AAC ATG ATT GTT GUT GCT GGA AAA GGT AAT GCT TUG ACA CCT GAA GAA AAT GM ATA CTT GTG CAAm GCr CAT GAA AAG AAA ATT CCA GTG GAA AAC ATT CTC AAT ATT * * * 0 Leu Ala Thr Asp Thr Cys Pro Glu STOP CUT GCT ACA GAT ACT TGT CCT GAA TAA aggcmttccgtaggtgagacaggotggcaottaggcotcatctcttgotcotggoatcagcatcacaeatoootcaccotttcattctocatgaettgtccatctcctgtagogccag ap jp W-- V-. 'IF... 9 FIG. 2. Nucleotide sequence of the hamster aphrodisin precursor cdna. The deduced amino acid sequence is shown in the three-letter code. The translational start codon and the polyadenylylation signal are underlined. Positions of PCR primers are marked with arrows. Distances of 30 bp are indicated with black dots. 732

3 Biochemistry: Mdgert et al complete aphrodisin cdna sequence (EMBL data library, accession number X65238) (Fig. 2) was assembled. The amplified coding region of the cdna and the 3' nontranslated region together have a size of 732 bp. The cdna codes for the 151-aa mature aphrodisin and a typical N- terminal 16-aa secretory signal peptide (26). No deviation of the translated cdna sequence from the published protein sequence of mature aphrodisin was detected. The 3' nontranslated region is 228 bp long and contains a typical AATAAA polyadenylylation signal (27, 28) at its 3' terminus. Comparisons with known cdna sequences revealed the highest homology (45% nucleotide sequence identity) with the ROBP cdna (15). This is in accordance with comparisons at the protein level (40% identity). Identification of the Aphrodisin Gene Promoter Region and Transcription Initiation Site. After screening of 400,000. plaques of the Golden hamster genomic library, 4 independent clones were isolated. As determined by restriction analysis, 1 clone, compared with the other 3 clones, contained a slightly shifted part of the same genomic region as the insert. PCR amplifications of partial insert fragments using primers (not listed) derived from the incomplete gene sequence and the 3'-terminal end of the cdna indicated the cloning of the complete gene in all cases. It has a size of '6000 bp (data not shown). Sst I and Xba I fragments of the gene were subcloned in puc18 and partially sequenced. One of the obtained sequences contains a CCAAT-box motif (29) in reverse complementary orientation and a TATA-box motif (for review see refs. 30 and 31) near potential transcription start sites, followed in the 3' direction by a region that codes for a typical secretory signal peptide (26) and the first 5 aa of mature aphrodisin (Fig. 3). These features strongly fit those expected for the 5' end of the aphrodisin gene. The first exon is then interrupted by the 448-bp intron I, which is followed by a sequence expected for exon II. Our sequence data allow the conclusion that the aphrodisin gene consists of at least five exons and four introns (data not shown). From the partial gene sequence an antisense primer (AP-7; Figs. 1 and 3) was derived and used for primer extension analysis of Golden hamster vaginal and brain RNA. In the first case we obtained a 103-nt extension product (Fig. 4), whereas we obtained none in the second case (negative control). The extension product correlates with a pair of adenosines located 29 and 30 bp downstream from the second thymidine of the above-mentioned TATA-box motif. Forty-nine base pairs downstream of the first potential transcription start site, an ATG in the correct frame appears, surrounded by nucleotides matching the Kozak sequence (CCRCCATGG) (32) typical for highly efficient eukaryotic translational start codons (Fig. 1). Proc. NatL Acad Sci USA 92 (1995) 2093 Brain agin S Size (Nucleotides) so _ * ~- 78 * FIG. 4. Primer extension analysis of hamster aphrodisin mrna. The size of the extension product obtained by using the primer AP-7 and vaginal total RNA is calculated as 103 bp. Thus, the most probable transcription start site is the adenosine in position 1 of Fig. 3. To verify the detected transcription start site by an alternative method, we performed cdna PCRs with two different sense primers located upstream (RAP-1) and downstream (RAP-2; Fig. 1) of the identified transcription start site. To enable us to distinguish between amplified cdna and gene fragments, we used antisense primers (AP-8 and AP-9; Fig. 1) located behind the first intron (Fig. 3). Surprisingly, all primer combinations led to the amplification of fragments which fit the sizes expected for cdna. Using the internal primer AP-7 as a probe, we verified the amplification of aphrodisin-specific fragments by Southern blot analysis (Fig. 5). Despite the fact that we obtained just one signal from the primer extension analysis, these results indicate an alternative transcription initiation of the aphrodisin gene. Distribution ofaphrodisin mrna Within the Female Hamster Genital Tract. To identify tissues expressing the aphrodisin gene, we analyzed total RNA from various parts of the female hamster genital tract (ovaries, fallopian tubes, uterus, vaginal tissue, and Bartholin's glands) by Northern blot analysis. Under stringent conditions we obtained single signals only from hamster vaginal tissue and Bartholin's glands (Fig. 6), both in comparable intensity. CAAT-Box -160 gctaatcacattagtttttgagatatgaggtcatacatcatttggcagggccaaagaggaaacactagacagatgtagcttagtgtagatcaaactgattottccgtgaaactccctct -41 * * * TATA-Box **Exn I > RAP-i >* aactatctg±ttaaaa gctttgtcagttgagttcttttcggccactcacctcttcgagcttctgt +103 <-Ex2n II < 'AP-7 (ILi 11 Phe Ser Leu Ala His Ala Gln Asp Phe Ala Glul +81 AGT CTG GCT CAT GCT CAG GAT TTT GCA GAG gtaaattcatttgct. 000 RAP-2 > Met Val Lys Ile Leu Val Leu Ala Leu Val tggaaaagcaaagtcaggcarccac_atg.gta AAG ATT CTG GTG CTG GCT TTG GTC 0 O6 tron I 448 bp) - I ILeu Gln Gly Lys Trp Tyr Thr Ile Val... tgttgcttttttcag CT CMA GGA MA TGG TAT ACC AU GTC. <- AP-9 AP-8 31 Ile Ala Ala Asp Asn Leu Glu Lys Ile Glu Glu Gly Gly Pro Leu Arg Phe Tyr Phe Arg His Ile Asp Cys Tyr Lys Asn Cys Ser Glu Met Glu ATT GCT GCT GAC AAT CUT GAA AAG ATA GA GAA GGA GGA CCA CTG AGA TTC TAT m CGT CAT ATT GAT TGT TAT AAA AAC TGC AGT GMA ATG GAA +236 FIG. 3. Part of the Golden hamster (Mesocricetus auratus) aphrodisin gene showing the transcription start site and the position of the primers used for primer extension analysis (AP-7) and PCR amplifications of 5'-terminal portions of the cdna (RAP-1, RAP-2, AP-8, AP-9). The putative CAAT box in reverse complementary orientation, the TATA box, the transcription start site, and the Kozak sequence surrounding the ATG start codon are underlined. The two adenosines which correspond to the transcription start site are additionally marked with asterisks (the more probable start site is marked with two asterisks). The codon for valine, differing from the codon for leucine in the case of hamster (Cricetus cricetus), is marked with diamonds. Distances of 30 bp are indicated with black dots. Intron I was not included in the numeration

4 2094 Biochemistry: Miigert et al _' -qj fe' Size (bp) 247 ~~~_ ~ ~ J"' FIG. 5. PCR Southern blot analysis of the transcription start site of the hamster aphrodisin gene with different sets of primers (see text and Fig. 3). After 35 PCR cycles, all primer combinations revealed DNA fragments in the size range expected for cdna (RAP-1/AP-8, 247 bp; RAP-2/AP-8, 198 bp; RAP-1/AP-9, 203 bp; RAP-2/AP-9, 154 bp). Southern blotting and hybridization with the internal oligonucleotide AP-7 verified the amplification of aphrodisin-specific cdna fragments in all cases. Under less stringent conditions we performed Northern hybridization experiments with the corresponding tissues of several other species, including rat, pig (data not shown), guinea pig (data not shown), tupaia, and human (Fig. 6). We obtained a signal in the expected size range only from rat Bartholin's glands. Tupaia vaginal and Bartholin's gland tissue (mixed) and human Bartholin's glands showed long signal smears between the 28S and 18S rrna and below the 18S rrna. DISCUSSION Since the presented cdna sequence was determined by sequencing PCR products, we had to identify the region of 0 47Z3 e Hamster Rat Human Tupaia -_*--28 S S FIG. 6. Northern hybridization with the radioactive-labeled aphrodisin cdna PCR fragment AP-1/AP-4. Five micrograms of total RNA was applied per lane. Hybridization was performed under conditions of high stringency (hamster) [5X standard saline citrate (SSC)/5x Denhardt's solution/0.1% SDS/50% formamide at 42 C, with washes in 2x SSC/0.1% SDS twice for 10 min at room temperature and 0.5x SSC/0.1% SDS once for 10 min at 65 C] or low stringency (rat, human, tupaia) (1 M NaCl/50 mm Tris-HCl ph 7.5/0.1% SDS/10% dextran sulfate at 45 C, with two 5-min washes in 6x SSC/0.1% SDS at room temperature). RNA samples from hamster vagina and Bartholin's glands show a strong hybridization signal even under highly stringent conditions. Under conditions of low stringency a signal in the expected size range was obtained from rat Bartholin's glands. RNA from mixed tissue of tupaia vagina and Bartholin's glands and from human Bartholin's glands gave long signal smears. Under conditions of low stringency rrna from all tissues showed crosshybridization with the aphrodisin probe. Positions of 28S and 18S rrna and aphrodisin (AP) RNA are indicated. _- AP Proc. NatL Acad Sci USA 92 (1995) transcription initiation by primer extension analysis. For this purpose, and in order to clone the corresponding gene, we have screened a Golden hamster genomic library in A phage. Assuming that the differences between aphrodisin genespecific sequences of hamster (Cricetus cricetus) and Golden hamster (Mesocricetus auratus) are only slight, we have chosen a library of the latter species because of its easy commercial availability. Indeed, during the not yet completed sequence determination of the gene, we have detected just one deviating nucleotide in the region coding for the putative secretory signal peptide of the aphrodisin precursor. This deviation leads to a predicted valine in position 6 of the Golden hamster aphrodisin precursor instead of leucine as in the case of the hamster (Fig. 3). By primer extension analysis, we obtained an extension product which correlates with a pair of adenines (see Figs. 3 and 4), identified as potential transcription start sites by both their ideal distance from a TATA-box motif and their location within a polypyrimidine tract. In two independent experiments, we obtained a single extension product which has been determined as 103 nt by means of logarithmic regression. These results suggest that the first adenine of the mentioned pair represents the real transcription initiation point. A further indication for the correct detection of this locus is the fact that the first ATG which follows in the 3' direction is surrounded by a Kozak sequence (see above) which is typical for highly efficient eukaryotic translational start points (32). It is the beginning of the region coding for a putative 16-aa secretory signal peptide, which ends before the codon for the first amino acid (Gln) of mature aphrodisin. Comparison of the deduced signal peptide to that from ROBP revealed a slight homology, especially within the first 9 aa (Fig. 7). However, the PCR experiments indicated the existence of at least one additional alternative transcription initiation site. This phenomenon is also known for some other genes-for instance, the renin gene (33). Since no alternative transcript has been detected by primer extension, it must appear in a much lower concentration than the predominant transcript. Northern blot analysis revealed vaginal tissue and Bartholin's glands (glandulae vestibulares majores) as the main aphrodisin mrna-synthesizing tissues of the female hamster genital tract. Taking into account that we used total RNA and that only relative short exposure times were necessary to obtain strong signals, the expression of the gene in these tissues would seem to be abundant. Whether the expression in vaginal tissue is due to an activity of the glandulae vestibulares minores, which are homologous to Bartholin's glands but much smaller, has to be investigated by in situ hybridization experiments or immunocytochemistry. To totally clarify the tissue distribution of aphrodisin-specific mrna, other tissues also have to be analyzed, preferably by using the more sensitive poly(a)+ RNA Northern blot or the nuclease S1 protection assay. Because aphrodisin acts via the vomeronasal organ (34) and is probably a carrier for an additional ligand, salivary glands are also potential candidates as loci of synthesis. Less stringent Northern hybridizations revealed signals from Bartholin's glands of other species, including rat, tupaia (mixed vaginal and Bartholin's gland tissue), and human. In the rat, the signal obtained was in the same size range as for aphrodisin mrna, suggesting the synthesis of an aphrodisinrelated protein. We now have to determine by cdna cloning and sequence analysis whether the signal is due to a novel mrna or to an expression of the gene for ROBP normally Aphrodisin I7V LLA VF s L- A ROBP F FLLI V.:A L G V SCH E N L FIG. 7. Comparison of the proaphrodisin signal peptide with the ROBP signal peptide (15). Identical regions are boxed.

5 Biochemistry: Mdgert et al. occurring in nasal mucosa (14, 15). In the case of Tupaia belangeri (a putative primate) and humans, we obtained long signal smears from Bartholin's glands instead of distinct signal bands. We first supposed this to be due to experimental artifacts, but this stands in contradiction to the fact that only specimens which contained RNA from Bartholin's glands behaved in this way. Further, the RNA used was absolutely undegraded and the signals cannot be explained by effects of concentration as in the case of 28S and 18S rrna, because no additional dominant bands corresponding to the signals were visible in the ethidium bromide-stained gel (data not shown). Signals from vaginal tissue could not be obtained from species other than hamster or Golden hamster. In summary, the results of Northern hybridization indicate high expression of the aphrodisin gene in hamster Bartholin's glands and vaginal tissue and suggest the synthesis of mrna species with at least a slight homology to the aphrodisin mrna in Bartholin's glands of rat, tupaia, and human. Whether these mrna species are related to lipocalins acting as pheromone carriers has to be investigated. Indications for the occurrence of primate sex pheromones in vaginal discharge already exist (35). Also, the occurrence of the vomeronasal organ in humans (36, 37) and its ability to perceive putative pheromones (38) have been demonstrated. The cloned aphrodisin cdna fragments as well as the gene will now serve as potentially useful tools for the investigation of aphrodisin/ lipocalin-related pheromone systems and their regulation in mammals. We thank G. Schmeding, H. Stober, H. Schindler, and W. Posselt for their excellent technical assistance; I. Kunstyr, A. Bub, M. Meyer, and E. Fuchs for tissue specimens and helpful advice; and G. Klock for the partial sequence analysis. This work was supported by a grant from the Deutsche Forschungsgemeinschaft (Ma 1605/1-1). 1. Pervaiz, S. & Brew, K. (1987) FASEB J. 1, Godovac-Zimmermann, J. (1988) Trends Biochem. Sci. 13, Akerstrom, B. & Logdberg, L. (1990) Trends Biochem. Sci. 15, Peitsch, M. C. & Boguski, M. S. (1991) Trends Biochem. Sci. 16, Igarashi, M., Nagata, A., Toh, H., Urade, Y. & Hayaishi, 0. (1992) Proc. Natl. Acad. Sci. USA 89, Bocskei, Z., Groom, C. R., Flower, D. R., Wright, C. E., Phillips, S. E. V., Cavaggioni, A., Findlay, J. B. C. & North, A. C. T. (1992) Nature (London) 360, Papiz, M. Z., Sawyer, L., Eliopoulos, E. E., North, A. C. T., Findley, J. B. C., Sivaprasadarao, R., Jones, T. A., Newcomer, M. E. & Kraulis, P. J. (1986) Nature (London) 324, Sivaprasadarao, A., Boudjelal, M. & Findley, J. B. (1993) Biochem. Soc. Trans. 21, Proc. NatL Acad Sci. USA 92 (1995) Singer, A. G., Macrides, F., Clancy, A. N. & Agosta, W. C. (1986) J. Biol. Chem. 261, Henzel, W. J., Rodriguez, H., Singer, A. G., Stults, J. T., Macrides, F., Agosta, W. C. & Niall, H. (1988) J. Biol. Chem. 263, Clancy, A. N., Macrides, F., Singer, A. G. & Agosta, W. C. (1984) Physiol. Behav. 33, Singer, A. G. (1991) J. Steroid Biochem. Mol. Biol. 39, Mancini, M. A., Majumdar, D., Chatterjee, B. & Roy, A. K. (1989) J. Histochem. Cytochem. 37, Pevsner, J., Trifiletti, R. R., Strittmatter, S. M. & Snyder, S. H. (1985) Proc. Natl. Acad. Sci. USA 82, Pevsner, J., Reed, R. R., Feinstein, P. G. & Snyder, S. H. (1988) Science 241, Snyder, S. H., Sklar, P. B. & Pevsner, J. (1988) J. Biol. Chem. 263, Saiki, R. K., Gelfand, D. H., Stoffel, S., Scharf, S. J., Higuchi, R., Horn, G. T., Mullis, K. B. & Erlich, H. A. (1988) Science 239, Yanish-Perron, C., Vieira, J. & Messing, J. (1985) Gene 33, Nishimura, A., Morita, M., Nishimura, Y. & Sugino, Y. (1990) Nucleic Acids Res. 18, Benton, W. D. & Davis, R. W. (1977) Science 196, Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Lab. Press, Plainview, NY). 22. Sanger, F., Nicklen, S. & Coulson, A. R. (1977) Proc. Natl. Acad. Sci. USA 74, Smith, L. M., Sanders, J. Z., Kaiser, R. J., Hughes, P., Dodd, C., Connell, C. R., Heiner, C., Kent, S. B. H. & Hood, L. E. (1986) Nature (London) 321, McMaster, G. K. & Carmichael, G. G. (1977) Proc. Natl. Acad. Sci. USA 74, Southern, E. M. (1975) J. Mol. Biol. 98, von Heijne, G. (1983) Eur. J. Biochem. 133, Proudfoot, N. J. & Brownlee, G. G. (1976) Nature (London) 263, Proudfoot, N. J. (1984) Nature (London) 307, Benoist, C., O'Hare, K., Breathnach, R. & Chambon, P. (1980) Nucleic Acids Res. 8, Breathnach, R. & Chambon, P. (1981) Annu. Rev. Biochem. 50, Wingender, E. (1988) Nucleic Acids Res. 16, Kozak, M. (1989) J. Cell Biol. 108, Paul, M., Burt, D. W., Krieger, J. E., Nakamura, N. & Dzau, V. J. (1992) Am. J. Physiol. 262, E644-E Jacobson, L. (1811) Ann. Mus. Hist. Natn. Paris 18, Michael, R. P. & Keverne, E. B. (1970) Nature (London) 225, Garcia-Velasco, J. & Mondragon, M. (1991) J. Steroid Biochem. Mol. Biol. 39, Moran, D. T., Jafek, B. W. & Rowley, J. C., III (1991) J. Steroid Biochem. Mol. Biol. 39, Monti-Bloch, L. & Grosser, B. I. (1991) J. Steroid Biochem. Mol. Biol. 39,