Molecular analyses of EGFR: mutation and amplification detection

Transcription

1 Molecular analyses of EGFR: mutation and amplification detection Petra Nederlof, Moleculaire Pathologie NKI Amsterdam Henrique Ruijter, Ivon Tielen, Lucie Boerrigter, Aafke Ariaens

2 Outline presentation Molecular assays to detect EGFR activating mutations KRAS mutations EGFR gene amplification NKI approach, results, validation Technical issues Other approaches

3 COSMIC database

4 EGFR COSMIC database AA subst. Complex mutations In frame deletions

5 Mutation analysis EGFR Type of mutations Point mutations activating in exons Deletions in exon 19 methods Direct sequencing fragment analysis Melting analysis Real Time PCR Assays In-house tests Commercial kits

6 Current protocol NKI EGFR CISH KRAS sequencing Codon 12 <=60% tumor cells >=60 tumor cells Fragment analysis exon 19 Direct sequencing Exon 18,19,20,21 Enrichment Exon 21 Sequence analysis

7 Sensitivity Limiting factors material Tumor cell percentage may be low Paraffin material: cross-linked and fragmented DNA Biopsies / cytological preps Limited amount of material Limiting factors assays

8 Direct sequencing PCR fragments preferably <250 bp Complete sequence readable in two directions (forward and reverse) Compare with wt sequence same run Check for SNP s Check COSMIC database

9 Primer_ID Naam F/R Label Amplificatie Sequentie 5' - 3' EGFRexon18F F Geen Exon 18 GCT GAG GTG ACC CTT GTC TC EGFRexon18R R Geen Exon 18 CTC CCC ACC AGA CCA TGA EGFRex19F F Geen Exon 19 CAT GTG GCA CCA TCT CAC A EGFRex19R R Geen Exon 19 CAG CTG CCA GAC ATG AGA AA EGFRexon20F F Geen Exon 20 CAT GCG TCT TCA CCT GGA A EGFRexon20R R Geen Exon 20 AGC AGG TAC TGG GAG CCA AT EGFRex21A-F F Geen Exon 21 GAA TTC GGA TGC AGA GCT TC EGFRexon21A-R R Geen Exon 21 TGC CTC CTT CTG CAT GGT AT EGFRex21B-F F Geen Exon 21 GAG GAC CGT CGC TTG GTG EGFRexon21B-R R Geen Exon 21 ATC CTC CCC TGC ATG TGT TA EGFRex19F-FAM F FAM Exon19 6CATGTGGCACCATCTCACA EGFRex19R R Geen Exon 19 GTGTCTTCAGCTGCCAGACATGAGAAA 9700 /mpdiag/egfr 4 min 94 C 1 cyclus 0.5 min 94 C 35 cycli 1.00 min 58 C 1.00 min 72 C 7 min 72 C 1 cyclus soak temp 15 C Size of PCR fragments Exon bp Exon bp Exon bp Exon 21A 220 bp Exon 21B 238 bp Sequence analysis not with M13-tails, but with same primers as initial PCR Results in cleaner sequences

10 Wt EGFR exon 18 sequence paraffin

11 Wt EGFR exon 18 sequence paraffin

12 Exon 19 del18 sequence Female, 64y, PA diagnosis: NSCLC Paraffin embedded biopsy

13 Exon 19 del18 sequence Female, 64y, PA diagnosis: NSCLC Paraffin embedded biopsy

14 Exon 19 del18 sequence Female, 64y, PA diagnosis: NSCLC Paraffin embedded biopsy 18 nucl

15 Exon 19 del15 deletion 15 nucl 15 nucl Tumor cell percentage 70% KRAS: no mutation

16 Cells from pleural fluid Complex mutation: 9bp deletion and point mutation

17 Point mutation exon 21 Exon 21A R Exon 21B F

18 Problems Tumor cell percentage <60% Complex mutations Difficult to determine exact location of aberration (inframe?) Some exons to large for 1 PCR reaction Split exon 21 in two fragments with overlap Point mutations more difficult to detect than deletions Not always Forward and Reverse good sequence

19 Rare but recurrent problems extra peaks may obscure mutation Artifact sequencer?

20 Rare but recurrent problems extra peaks may obscure mutation Artifact sequencer?

21 Zelden zo slecht! Kan komen door slechte DNA kwaliteit, Meestal niet te verklaren (slechts 1 exon 1 richting slecht)

22 What to do in case of low tumor cell % 70% no problems <60% sometimes difficult Sensitivity of direct sequencing enough? Alternatives? Fragment analysis of exon 19 deletions Use restriction sites in wt and mutants Is that an option? Advantages/disadvantages

23 Most common mutations In COSMIC database N=11266 cases 2803 mutated cases 1063 p.l858r exon 21 (38%) 1161 deletions in exon 19 (42%) Together 80% of mutations

24 Fragment analysis FAM WT EGFR Exon 19 wt FAM MUT EGFR Exon 19 wt Primers round common deletions in exon 19 Size of the deletion exact position not known Sensitive: 20% tumor cell percentage detectable del 15 wt del 15 del 18

25 exon 21 c.2573 T>G p.l858r Restriction site in wt, not in mutant TGGCCA wt GGGCCA mut MscI Fragment analysis Enrichment for mutant

26 Enrichment for mutation exon 21 c.2573 T>G p.l858r 1st PCR exon 21 Cut wt sequence with restriction enzyme MscI mutant is not cut 2nd PCR exon 21 Analyze on agarose gel cut/uncut PCR products Confirm by sequence analysis both cut and uncut product TGGCCA wt GGGCCA mut MscI

27 Sensitivity assay Un cut cut 70% 30% Mix tumor DNA mut (estimated 70% tumor cells) with wt DNA 70%, 60%, 50%, 40%, 30%, 10%, 5% Direct sequencing 5%

28 PCR RFLP based analysis EGFR exon 21 L858R Sau 96I Sau 96I Exon 21 CGG PCR FAM Digest with SAu96I 180 bp (wild type) or bp (mutant) WT sample H3255 L858R

29 PCR RFLP based analysis EGFR exon 20 T790M FAM 101 bp (wild type) 92 bp (mutant) WT sample H1975 T790M

30 KRAS mutation analysis Methods Direct sequencing codon 12/13 Sensitivity Tested on tumors with different tumor cell % Mutation determined earlier with sensitive radioactive dot-blot assay Sensitivity higher than with EGFR mutations caused by loss of wt allel in tumor?

31 KRAS sensitivity Wt control 10% tumor cells 15% tumor cells 20% tumor cells 50% tumor cells 60% tumor cells

32 Material NKI Total 182 Biopsy 101 (56%) Cytol. Prep 15 (8%) Resection/excision 66 (36%) Female 121 (67%) 6 mutations EGFR

33 NKI tumors 37 EGFR mutations detected 24 female with mutation (24/113 =21%) 13 male with mutation (13/53 =25%) 24/37 =65% of mutants are female!!

34 KRAS and EGFR analyses cases KRAS & EGFR mut analyses 1 no results 3 mutation detected EGFR (11%) 23 no mutation EGFR Conclusion no mut KRAS 17 no mut KRAS 6 mut KRAS 6/27 KRAS mutation (22%) all without EGFR mut KRAS mut en EGFR mut never together

35 KRAS en EGFR analyses cases KRAS & EGFR mut analyses 8 no results 7 mutation EGFR (14%) no mut KRAS 34 no mutation EGFR 24 no mut KRAS 10 mut KRAS Conclusion 10/49 KRAS mutation (20%) no EGFR mut KRAS mut en EGFR mut never seen together

36 EGFR NKI EGFR mutations no mut exon 18 exon 19 exon 19 exon 21 exon 20 exon % 6% 17% 0% 3% 14% % 0% 5% 0% 0% 7% % 0% 14% 1% 1% 4% 85 totaal KRAS mut KRAS geen MUT N EGFR mut 0% 100% 7 EGFR geen mut 29% 71% 34 6x CISH EGFR 1x amplificatie (7spots) N

37 Other approaches

38 Real Time PCR assay DXS EGFR29 Mutation Test kit detects 1% mutant in a background of wt genomic DNA 19 deletions in exon 19 Price 3360,-/20 samples ( 168/sample)

39 Single Stranded Conformation Polymorphism (SSCP) Wild Type Mutant SSCP for K-ras G12C WT WT G12A

40 DHPLC WAVE system transgenomics Fragment collection followed by direct sequencing

41 summary Advantage of sequencing strategy All mutations can be detected if tumor cell percentage is adequate Advantage of fragment analysis Sensitive but: only known mutations and limited by availability of specific enzymes Advantage other techniques High sensitivity but frequently confirmation by sequencing needed Expensive/special equipment required Kits may be expensive

42 CISH for EGFR amplification our still limited experience! Kit tested: Zytovision Zyto dot SPEC EGFR probe Similar system as HER2 CISH kit

43 Method DAB Staining in automatic stainer used for IHC peroxidase Critical step, needs optimizing

44 Method DAB 5μ paraffin section Probe: Digoxigenylated(Dig)-EGFR peroxidase

45

46 F:\2008\ EGFR CISH 20x ampl contrast.jpg

47

48

49 Pro s and Con s test IHC FISH CISH PRO easy low costs 2 easy read-out colorful Normal microscope routine CON sensitivity varies misses low amplification special microscope Costly, deterioration of material by decay Not yet Costs 50

50 Questions Correlation IHC-CISH? Are EGFR genes with activating mutations in kinase domain also amplified? Do both amplified and mutated EGFR tumors react similar to iressa therapy? Does resistance occur in both groups? Is it relevant to be able to detect subpopulations in tumors (1%) with activating mutations? Are KRAS and EGFR mutations mutually exclusive?

51 QAQC Exchange of material between labs needed to check efficiency of techniques used