Next Generation Sequencing
|
|
|
- Iris Jefferson
- 10 years ago
- Views:
Transcription
1 Next Generation Sequencing 38. Informationsgespräch der Blutspendezentralefür Wien, Niederösterreich und Burgenland Österreichisches Rotes Kreuz 22. November 2014, Parkhotel Schönbrunn
2 Die Zukunft hat begonnen.
3 Generationen 1 Sanger 2 Roche454/Illumina/IonTorrent 3 Pacific Biosystems 4 Oxford Nanopore
4
5
6
7
8 Emulsion PCR
9 DirectsequencingofUnseparated Alleles CCRCCCCGAMCGATCTACTCACTACTCACTWC
10 CloningandSequencing CCRCCCCGAMCGATCTACTCACTACTCACTWC CCACCCCGACCGATCTACTCACTACTCACTAC CCGCCCCGAACGATCTACTCACTACTCACTTC
11 NGS CCRCCCCGAMCGATCTACTCACTACTCACTWC CCACCCC ACCCCGACCGA CCGAACGAT AACGATCTACT CTCACTACTCACTAC TACTCACTTC
12 Sequencing Errors InsertionsandDeletionsmainlyon homopolymer stretches: Ref: CCCCG #1: CCCCCG #2: CCCG #3: CTCCG
13 2 nd Generation, Library Prep PCR Emulsion PCR Polony Amplification Semiconductor Sequencing Pyro Sequencing Reversible Terminator Sequencing
14 Sanger vsngs (2 nd Generation) Workflow PCR (Exons2, 3) Sequenzierreaktion Capillarelektophorese Amplifikation einzelner Moleküle Run, Erfassung der Rxn in ACCGGGAGACACAGATCTGCAAGGCCAAGGCGACAGACTG ACCGAGAGAACCTGCGGATCGCGCTCCGCTACTACAACCAG AGCGAGGCCGGTGAGTGACCCCGGCCCGGGGCGCAGGTC ACGACCGCCCATCCACGTACGCGGCGCCCGATC >B=@?;; =;<8:97396>>>>?@ >9 430,,00&,&-0&-00& '-25+6,,( ,2.4047*001+
15 Proof of Principle Bentley et al, Tissue Antigens 2009, 74:393 Gabriel et al, Hum Immunol2009, 70:960 Lindet al, Hum Immunol2010, 71:1033 Erlichet al, BMC Genomics2011, 12:42 Holcomb et al, Tissue Antigens 2011, 77:206 Wang et al, ProcNatlAcadSci2012,109:8676 Shiina et al, Tissue Antigens 2012, 80:305
16 B*57:01? HIV Patient from Niederösterreich
17 Deletionin Exon3 gdna B*44:138Q GGCCAG GGTC TCACA...TCCAG AGGATGTACG GCTGCGACGT GGGGCCGGAC GGGCGCCTCC TCCGCGGGTA TGACCAGGAC GCCTACGACG GCAAGGATTA B*44:02:01: TCA
18 Sanger-Primer Designation Sequence (5 ->3 ) Purpose B*44--18fwd GCA CCC ACC CGG ACT CAG AA Amplification & Sequencing B* rev GGG GTC ACG GTG GAC ACG G Amplification & Sequencing B* rev TCG TCC ACG TAG CCC ACG GT Sequencing B* fwd GGG TCT CAC ATC ATC CAG AGG Sequencing B* fwd GTC CTA GGG TGT CCC ATG AG Sequencing B* rev GAA GAG ATA TGA CCC CTC ATC Sequencing B* fwd CTG GAG CCC TTC AGC AGG Sequencing B* fwd TGT GAT GTG TAG GAG GAA GAG C Sequencing B* fwd TCC CAG TCC CCT CAC AGG G Sequencing B* rev CCC ACC CAC CCC CAG ACC T Sequencing
19 NGS-Primer Designation Sequence (5 ->3 ) Purpose B_F1 CCC GGT TGC AAT AGA CAG TAA CAA A NGS Amplification (Shiinaetal.) B_R1 GGG TCC AAT TTC ACA GAC AAA TGT NGS Amplification (Shiina et al.)
20 Gene Conversion& Mutations B*44:138Q III I B*44:02:01:01 B*46:01:01
21 Propositi Patient SN: Father SG: Sister SGr: Brother SA: HLA Typing A*02:01/09,*03:01 B*07:02,*44:138Q C*07:02,*07:04 A*23:01,*03:01 B*44:03,* 44:138Q C*04:01,*07:04 A*02:01/09,*23:01 B*07:02,*44:03 C*07:02,*04:01 A*02:01/09,*03:01 B*40:01,* 44:138Q C*03:04,*07:04
22 Super high resolution for single molecule-sequence-based typing of classical HLA loci at the 8-digit level using next generation sequencers, T. Shiina, et al. Tissue Antigens, 2012, 80,
23 HLA Typingon a 314 Chip
24 HLA TypeStreamT Analysis Software
25 Coverage
26 Advantages Whole gene sequencing possible Clonal sequences Automation Chip size Low to High throughput Costs
27 Flaws, Outlook HLA/IMGT database currently incomplete->? Urgent samples? Emulsion PCR? Length of reads GC rich regions Coverage Phase Amplification bias -> Third Generation Sequencing?
28 Sanger vsngs (3 rd Generation) Workflow PCR (Exons2, 3) Sequenzierreaktion Capillarelektophorese Amplifikation einzelner Moleküle Run, Erfassung der Rxn in ACCGGGAGACACAGATCTGCAAGGCCAAGGCGACAGACTG ACCGAGAGAACCTGCGGATCGCGCTCCGCTACTACAACCAG AGCGAGGCCGGTGAGTGACCCCGGCCCGGGGCGCAGGTC ACGACCGCCCATCCACGTACGCGGCGCCCGATC >B=@?;; =;<8:97396>>>>?@ >9 430,,00&,&-0&-00& '-25+6,,( ,2.4047*001+
29
30
31
32 Generation 4 -NanoporeSequencing Single molecule sequencing incorporating nanopore technology Protein pore->solid state channel(dna-transistor) USB size portable DNA sequencer Wholegenomescan15 min Very low cost
33 Schematic of the nanopore device. Schreiber J et al. PNAS 2013;110: by National Academy of Sciences
34 Strategy for reading epigenetic modifications on a target CG dinucleotide. Schreiber J et al. PNAS 2013;110: by National Academy of Sciences
35 Die Zukunft hat begonnen... und ist noch jung
(http://genomes.urv.es/caical) TUTORIAL. (July 2006)
(http://genomes.urv.es/caical) TUTORIAL (July 2006) CAIcal manual 2 Table of contents Introduction... 3 Required inputs... 5 SECTION A Calculation of parameters... 8 SECTION B CAI calculation for FASTA
GENEWIZ, Inc. DNA Sequencing Service Details for USC Norris Comprehensive Cancer Center DNA Core
DNA Sequencing Services Pre-Mixed o Provide template and primer, mixed into the same tube* Pre-Defined o Provide template and primer in separate tubes* Custom o Full-service for samples with unknown concentration
(A) Microarray analysis was performed on ATM and MDM isolated from 4 obese donors.
Legends of supplemental figures and tables Figure 1: Overview of study design and results. (A) Microarray analysis was performed on ATM and MDM isolated from 4 obese donors. After raw data gene expression
Table S1. Related to Figure 4
Table S1. Related to Figure 4 Final Diagnosis Age PMD Control Control 61 15 Control 67 6 Control 68 10 Control 49 15 AR-PD PD 62 15 PD 65 4 PD 52 18 PD 68 10 AR-PD cingulate cortex used for immunoblot
DNA Sample preparation and Submission Guidelines
DNA Sample preparation and Submission Guidelines Requirements: Please submit samples in 1.5ml microcentrifuge tubes. Fill all the required information in the Eurofins DNA sequencing order form and send
10 µg lyophilized plasmid DNA (store lyophilized plasmid at 20 C)
TECHNICAL DATA SHEET BIOLUMINESCENCE RESONANCE ENERGY TRANSFER RENILLA LUCIFERASE FUSION PROTEIN EXPRESSION VECTOR Product: prluc-c Vectors Catalog number: Description: Amount: The prluc-c vectors contain
Molecular analyses of EGFR: mutation and amplification detection
Molecular analyses of EGFR: mutation and amplification detection Petra Nederlof, Moleculaire Pathologie NKI Amsterdam Henrique Ruijter, Ivon Tielen, Lucie Boerrigter, Aafke Ariaens Outline presentation
Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation
BDGP Resources Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation For recovery of sequences flanking PZ, PlacW and PEP elements E. Jay Rehm Berkeley Drosophila Genome Project I.
The p53 MUTATION HANDBOOK
The p MUTATION HANDBOOK Version 1. /7 Thierry Soussi Christophe Béroud, Dalil Hamroun Jean Michel Rubio Nevado http://p/free.fr The p Mutation HandBook By T Soussi, J.M. Rubio-Nevado, D. Hamroun and C.
Introduction to Perl Programming Input/Output, Regular Expressions, String Manipulation. Beginning Perl, Chap 4 6. Example 1
Introduction to Perl Programming Input/Output, Regular Expressions, String Manipulation Beginning Perl, Chap 4 6 Example 1 #!/usr/bin/perl -w use strict; # version 1: my @nt = ('A', 'C', 'G', 'T'); for
UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet
1 UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet Exam in: MBV4010 Arbeidsmetoder i molekylærbiologi og biokjemi I MBV4010 Methods in molecular biology and biochemistry I Day of exam:.
Mutations and Genetic Variability. 1. What is occurring in the diagram below?
Mutations and Genetic Variability 1. What is occurring in the diagram below? A. Sister chromatids are separating. B. Alleles are independently assorting. C. Genes are replicating. D. Segments of DNA are
SERVICES CATALOGUE WITH SUBMISSION GUIDELINES
SERVICES CATALOGUE WITH SUBMISSION GUIDELINES 3921 Montgomery Road Cincinnati, Ohio 45212 513-841-2428 www.agctsequencing.com CONTENTS Welcome Dye Terminator Sequencing DNA Sequencing Services - Full Service
Supplementary Information. Binding region and interaction properties of sulfoquinovosylacylglycerol (SQAG) with human
Supplementary Information Binding region and interaction properties of sulfoquinovosylacylglycerol (SQAG) with human vascular endothelial growth factor 165 revealed by biosensor based assays Yoichi Takakusagi
Hands on Simulation of Mutation
Hands on Simulation of Mutation Charlotte K. Omoto P.O. Box 644236 Washington State University Pullman, WA 99164-4236 [email protected] ABSTRACT This exercise is a hands-on simulation of mutations and their
Gene Synthesis 191. Mutagenesis 194. Gene Cloning 196. AccuGeneBlock Service 198. Gene Synthesis FAQs 201. User Protocol 204
Gene Synthesis 191 Mutagenesis 194 Gene Cloning 196 AccuGeneBlock Service 198 Gene Synthesis FAQs 201 User Protocol 204 Gene Synthesis Overview Gene synthesis is the most cost-effective way to enhance
Gene Finding CMSC 423
Gene Finding CMSC 423 Finding Signals in DNA We just have a long string of A, C, G, Ts. How can we find the signals encoded in it? Suppose you encountered a language you didn t know. How would you decipher
Inverse PCR and Sequencing of P-element, piggybac and Minos Insertion Sites in the Drosophila Gene Disruption Project
Inverse PCR and Sequencing of P-element, piggybac and Minos Insertion Sites in the Drosophila Gene Disruption Project Protocol for recovery of sequences flanking insertions in the Drosophila Gene Disruption
pcas-guide System Validation in Genome Editing
pcas-guide System Validation in Genome Editing Tagging HSP60 with HA tag genome editing The latest tool in genome editing CRISPR/Cas9 allows for specific genome disruption and replacement in a flexible
Introduction to next-generation sequencing data
Introduction to next-generation sequencing data David Simpson Centre for Experimental Medicine Queens University Belfast http://www.qub.ac.uk/research-centres/cem/ Outline History of DNA sequencing NGS
Part ONE. a. Assuming each of the four bases occurs with equal probability, how many bits of information does a nucleotide contain?
Networked Systems, COMPGZ01, 2012 Answer TWO questions from Part ONE on the answer booklet containing lined writing paper, and answer ALL questions in Part TWO on the multiple-choice question answer sheet.
Y-chromosome haplotype distribution in Han Chinese populations and modern human origin in East Asians
Vol. 44 No. 3 SCIENCE IN CHINA (Series C) June 2001 Y-chromosome haplotype distribution in Han Chinese populations and modern human origin in East Asians KE Yuehai ( `º) 1, SU Bing (3 Á) 1 3, XIAO Junhua
NimbleGen SeqCap EZ Library SR User s Guide Version 3.0
NimbleGen SeqCap EZ Library SR User s Guide Version 3.0 For life science research only. Not for use in diagnostic procedures. Copyright 2011 Roche NimbleGen, Inc. All Rights Reserved. Editions Version
ANALYSIS OF A CIRCULAR CODE MODEL
ANALYSIS OF A CIRCULAR CODE MODEL Jérôme Lacan and Chrstan J. Mchel * Laboratore d Informatque de Franche-Comté UNIVERSITE DE FRANCHE-COMTE IUT de Belfort-Montbélard 4 Place Tharradn - BP 747 5 Montbélard
Module 6: Digital DNA
Module 6: Digital DNA Representation and processing of digital information in the form of DNA is essential to life in all organisms, no matter how large or tiny. Computing tools and computational thinking
Chapter 9. Applications of probability. 9.1 The genetic code
Chapter 9 Applications of probability In this chapter we use the tools of elementary probability to investigate problems of several kinds. First, we study the language of life by focusing on the universal
Association of IGF1 and IGFBP3 polymorphisms with colorectal polyps and colorectal cancer risk
DOI 10.1007/s10552-009-9438-4 ORIGINAL PAPER Association of IGF1 and IGFBP3 polymorphisms with colorectal polyps and colorectal cancer risk Elisabeth Feik Æ Andreas Baierl Æ Barbara Hieger Æ Gerhard Führlinger
pcmv6-neo Vector Application Guide Contents
pcmv6-neo Vector Application Guide Contents Package Contents and Storage Conditions... 2 Product Description... 2 Introduction... 2 Production and Quality Assurance... 2 Methods... 3 Other required reagents...
14/12/2012. HLA typing - problem #1. Applications for NGS. HLA typing - problem #1 HLA typing - problem #2
www.medical-genetics.de Routine HLA typing by Next Generation Sequencing Kaimo Hirv Center for Human Genetics and Laboratory Medicine Dr. Klein & Dr. Rost Lochhamer Str. 9 D-8 Martinsried Tel: 0800-GENETIK
http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets
http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets by Louise Brown Jasko John Anthony Campbell Jack Dennis Cassidy Michael Nickelsburg Stephen Prentis Rohm Objectives: 1) Using plastic beads, construct
TITRATION OF raav (VG) USING QUANTITATIVE REAL TIME PCR
Page 1 of 5 Materials DNase digestion buffer [13 mm Tris-Cl, ph7,5 / 5 mm MgCl2 / 0,12 mm CaCl2] RSS plasmid ptr-uf11 SV40pA Forward primer (10µM) AGC AAT AGC ATC ACA AAT TTC ACA A SV40pA Reverse Primer
The making of The Genoma Music
242 Summary Key words Resumen Palabras clave The making of The Genoma Music Aurora Sánchez Sousa 1, Fernando Baquero 1 and Cesar Nombela 2 1 Department of Microbiology, Ramón y Cajal Hospital, and 2 Department
Marine Biology DEC 2004; 146(1) : 53-64 http://dx.doi.org/10.1007/s00227-004-1423-6 Copyright 2004 Springer
Marine Biology DEC 2004; 146(1) : 53-64 http://dx.doi.org/10.1007/s00227-004-1423-6 Copyright 2004 Springer Archimer http://www.ifremer.fr/docelec/ Archive Institutionnelle de l Ifremer The original publication
Mutation. Mutation provides raw material to evolution. Different kinds of mutations have different effects
Mutation Mutation provides raw material to evolution Different kinds of mutations have different effects Mutational Processes Point mutation single nucleotide changes coding changes (missense mutations)
The DNA-"Wave Biocomputer"
The DNA-"Wave Biocomputer" Peter P. Gariaev (Pjotr Garjajev)*, Boris I. Birshtein*, Alexander M. Iarochenko*, Peter J. Marcer**, George G. Tertishny*, Katherine A. Leonova*, Uwe Kaempf ***. * Institute
Insulin Receptor Gene Mutations in Iranian Patients with Type II Diabetes Mellitus
Iranian Biomedical Journal 13 (3): 161-168 (July 2009) Insulin Receptor Gene Mutations in Iranian Patients with Type II Diabetes Mellitus Bahram Kazemi 1*, Negar Seyed 1, Elham Moslemi 2, Mojgan Bandehpour
July 7th 2009 DNA sequencing
July 7th 2009 DNA sequencing Overview Sequencing technologies Sequencing strategies Sample preparation Sequencing instruments at MPI EVA 2 x 5 x ABI 3730/3730xl 454 FLX Titanium Illumina Genome Analyzer
APOT - Assay. Protocol for HPV16 and 18. Amplification of Papilloma Virus Oncogene Transcripts HPV. E6 E7 E1 Zelluläre DNA poly(a)
E5 E2 E1 APOT - Assay Amplification of Papilloma Virus Oncogene Transcripts URR E6 E7 L1 HPV L2 E4 E6 E7 E1 Zelluläre DNA poly(a) Protocol for HPV16 and 18 Brief summary of the APOT assay Fig.1A shows
Transmembrane Signaling in Chimeras of the E. coli Chemotaxis Receptors and Bacterial Class III Adenylyl Cyclases
Transmembrane Signaling in Chimeras of the E. coli Chemotaxis Receptors and Bacterial Class III Adenylyl Cyclases Dissertation der Mathematisch-Naturwissenschaftlichen Fakultät der Eberhard Karls Universität
Event-specific Method for the Quantification of Maize MIR162 Using Real-time PCR. Protocol
Event-specific Method for the Quantification of Maize MIR162 Using Real-time PCR Protocol 31 January 2011 Joint Research Centre Institute for Health and Consumer Protection Molecular Biology and Genomics
2006 7.012 Problem Set 3 KEY
2006 7.012 Problem Set 3 KEY Due before 5 PM on FRIDAY, October 13, 2006. Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. Which reaction is catalyzed by each
Five-minute cloning of Taq polymerase-amplified PCR products
TOPO TA Cloning Version R 8 April 2004 25-0184 TOPO TA Cloning Five-minute cloning of Taq polymerase-amplified PCR products Catalog nos. K4500-01, K4500-40, K4510-20, K4520-01, K4520-40, K4550-01, K4550-40,
Drosophila NK-homeobox genes
Proc. Natl. Acad. Sci. USA Vol. 86, pp. 7716-7720, October 1989 Biochemistry Drosophila NK-homeobox genes (NK-1, NK-2,, and DNA clones/chromosome locations of genes) YONGSOK KIM AND MARSHALL NIRENBERG
Biopython Tutorial and Cookbook
Biopython Tutorial and Cookbook Jeff Chang, Brad Chapman, Iddo Friedberg, Thomas Hamelryck, Michiel de Hoon, Peter Cock Last Update September 2008 Contents 1 Introduction 5 1.1 What is Biopython?.........................................
The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics
The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics The GS Junior System The Power of Next-Generation Sequencing on Your Benchtop Proven technology: Uses the same long
Characterization of cdna clones of the family of trypsin/a-amylase inhibitors (CM-proteins) in barley {Hordeum vulgare L.)
Characterization of cdna clones of the family of trypsin/a-amylase inhibitors (CM-proteins) in barley {Hordeum vulgare L.) J. Paz-Ares, F. Ponz, P. Rodríguez-Palenzuela, A. Lázaro, C. Hernández-Lucas,
Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research. March 17, 2011 Rendez-Vous Séquençage
Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research March 17, 2011 Rendez-Vous Séquençage Presentation Overview Core Technology Review Sequence Enrichment Application
Next Generation Sequencing
Next Generation Sequencing Technology and applications 10/1/2015 Jeroen Van Houdt - Genomics Core - KU Leuven - UZ Leuven 1 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977
All commonly-used expression vectors used in the Jia Lab contain the following multiple cloning site: BamHI EcoRI SmaI SalI XhoI_ NotI
2. Primer Design 2.1 Multiple Cloning Sites All commonly-used expression vectors used in the Jia Lab contain the following multiple cloning site: BamHI EcoRI SmaI SalI XhoI NotI XXX XXX GGA TCC CCG AAT
Archimer http://archimer.ifremer.fr
Please note that this is an author-produced PDF of an article accepted for publication following peer review. The definitive publisher-authenticated version is available on the publisher Web site Fish
Data Analysis for Ion Torrent Sequencing
IFU022 v140202 Research Use Only Instructions For Use Part III Data Analysis for Ion Torrent Sequencing MANUFACTURER: Multiplicom N.V. Galileilaan 18 2845 Niel Belgium Revision date: August 21, 2014 Page
Six Homeoproteins and a Iinc-RNA at the Fast MYH Locus Lock Fast Myofiber Terminal Phenotype
Six Homeoproteins and a Iinc-RNA at the Fast MYH Locus Lock Fast Myofiber Terminal Phenotype Iori Sakakibara 1,2,3, Marc Santolini 4, Arnaud Ferry 2,5, Vincent Hakim 4, Pascal Maire 1,2,3 * 1 INSERM U1016,
Nazneen Aziz, PhD. Director, Molecular Medicine Transformation Program Office
2013 Laboratory Accreditation Program Audioconferences and Webinars Implementing Next Generation Sequencing (NGS) as a Clinical Tool in the Laboratory Nazneen Aziz, PhD Director, Molecular Medicine Transformation
Heraeus Sepatech, Kendro Laboratory Products GmbH, Berlin. Becton Dickinson,Heidelberg. Biozym, Hessisch Oldendorf. Eppendorf, Hamburg
13 4. MATERIALS 4.1 Laboratory apparatus Biofuge A Centrifuge 5804R FACScan Gel electrophoresis chamber GPR Centrifuge Heraeus CO-AUTO-ZERO Light Cycler Microscope Motopipet Neubauer Cell Chamber PCR cycler
Taqman TCID50 for AAV Vector Infectious Titer Determination
Page 1 of 8 Purpose: To determine the concentration of infectious particles in an AAV vector sample. This process involves serial dilution of the vector in a TCID50 format and endpoint determination through
inhibition of mitosis
The EMBO Journal vol.13 no.2 pp.425-434, 1994 cdt 1 is an essential target of the Cdc 1 O/Sct 1 transcription factor: requirement for DNA replication and inhibition of mitosis Johannes F.X.Hofmann and
Protein Synthesis Simulation
Protein Synthesis Simulation Name(s) Date Period Benchmark: SC.912.L.16.5 as AA: Explain the basic processes of transcription and translation, and how they result in the expression of genes. (Assessed
History of DNA Sequencing & Current Applications
History of DNA Sequencing & Current Applications Christopher McLeod President & CEO, 454 Life Sciences, A Roche Company IMPORTANT NOTICE Intended Use Unless explicitly stated otherwise, all Roche Applied
Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein
Assignment 3 Michele Owens Vocabulary Gene: A sequence of DNA that instructs a cell to produce a particular protein Promoter a control sequence near the start of a gene Coding sequence the sequence of
Chlamydomonas adapted Green Fluorescent Protein (CrGFP)
Chlamydomonas adapted Green Fluorescent Protein (CrGFP) Plasmid pfcrgfp for fusion proteins Sequence of the CrGFP In the sequence below, all amino acids which have been altered from the wildtype GFP from
Next generation DNA sequencing technologies. theory & prac-ce
Next generation DNA sequencing technologies theory & prac-ce Outline Next- Genera-on sequencing (NGS) technologies overview NGS applica-ons NGS workflow: data collec-on and processing the exome sequencing
Immortalized epithelial cells from human autosomal dominant polycystic kidney cysts
Am J Physiol Renal Physiol 285: F397 F412, 2003. First published May 6, 2003; 10.1152/ajprenal.00310.2002. Immortalized epithelial cells from human autosomal dominant polycystic kidney cysts Mahmoud Loghman-Adham,
EU Reference Laboratory for E. coli Department of Veterinary Public Health and Food Safety Unit of Foodborne Zoonoses Istituto Superiore di Sanità
Identification and characterization of Verocytotoxin-producing Escherichia coli (VTEC) by Real Time PCR amplification of the main virulence genes and the genes associated with the serogroups mainly associated
The nucleotide sequence of the gene for human protein C
Proc. Natl. Acad. Sci. USA Vol. 82, pp. 4673-4677, July 1985 Biochemistry The nucleotide sequence of the gene for human protein C (DNA sequence analysis/vitamin K-dependent proteins/blood coagulation)
TA Cloning Kit. Version V 7 April 2004 25-0024. Catalog nos. K2000-01, K2000-40, K2020-20, K2020-40, K2030-01 K2030-40, K2040-01, K2040-40
TA Cloning Kit Version V 7 April 2004 25-0024 TA Cloning Kit Catalog nos. K2000-01, K2000-40, K2020-20, K2020-40, K2030-01 K2030-40, K2040-01, K2040-40 ii Table of Contents Table of Contents...iii Important
RT-PCR: Two-Step Protocol
RT-PCR: Two-Step Protocol We will provide both one-step and two-step protocols for RT-PCR. We recommend the twostep protocol for this class. In the one-step protocol, the components of RT and PCR are mixed
BD BaculoGold Baculovirus Expression System Innovative Solutions for Proteomics
BD BaculoGold Baculovirus Expression System Innovative Solutions for Proteomics Table of Contents Innovative Solutions for Proteomics...........................................................................
Automated DNA sequencing 20/12/2009. Next Generation Sequencing
DNA sequencing the beginnings Ghent University (Fiers et al) pioneers sequencing first complete gene (1972) first complete genome (1976) Next Generation Sequencing Fred Sanger develops dideoxy sequencing
Molecular Facts and Figures
Nucleic Acids Molecular Facts and Figures DNA/RNA bases: DNA and RNA are composed of four bases each. In DNA the four are Adenine (A), Thymidine (T), Cytosine (C), and Guanine (G). In RNA the four are
ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes
ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes Page 1 of 22 Introduction Indiana students enrolled in Biology I participated in the ISTEP+: Biology I Graduation Examination
4 th DVFA Life Science Conference. Going East / Going West. Life Science Asia/Europe getting insight in mutual growth opportunities
4 th DVFA Life Science Conference Going East / Going West Life Science Asia/Europe getting insight in mutual growth opportunities 4 th DVFA Symposium Life Science followed by a Get Together 17 May 2011,
Thermo Scientific Phusion Site-Directed Mutagenesis Kit #F-541
PRODUCT INFORMATION Thermo Scientific Phusion Site-Directed Mutagenesis Kit #F-541 Lot _ Store at -20 C Expiry Date _ www.thermoscientific.com/onebio CERTIFICATE OF ANALYSIS The Phusion Site-Directed Mutagenesis
BRCA1 / 2 testing by massive sequencing highlights, shadows or pitfalls?
BRCA1 / 2 testing by massive sequencing highlights, shadows or pitfalls? Giovanni Luca Scaglione, PhD ------------------------ Laboratory of Clinical Molecular Diagnostics and Personalized Medicine, Institute
Directed-Mutagenesis and Deletion Generated through an Improved Overlapping-Extension PCR Based Procedure
Research Article Directed-Mutagenesis and Deletion Generated through an Improved Overlapping-Extension PCR Based Procedure Wirojne Kanoksilapatham 1*, Juan M. González 2 and Frank T. Robb 3 1 Department
