APOT - Assay. Protocol for HPV16 and 18. Amplification of Papilloma Virus Oncogene Transcripts HPV. E6 E7 E1 Zelluläre DNA poly(a)
|
|
|
- Gary Byrd
- 10 years ago
- Views:
Transcription
1 E5 E2 E1 APOT - Assay Amplification of Papilloma Virus Oncogene Transcripts URR E6 E7 L1 HPV L2 E4 E6 E7 E1 Zelluläre DNA poly(a) Protocol for HPV16 and 18
2 Brief summary of the APOT assay Fig.1A shows the basic principles of the APOT assay for episomal and integrated transcripts. On the left side, transcript schemes are shown, on the right side, the corresponding amplification products are depicted. RT is performed using an adaptor linked oligodt primer. Next, two PCR steps are done using oligo dt / Adaptor primers and HPV E7 specific primers. The amplification products are hybridized to HPV E7 and E4 specific probes to discriminate episomal from integrate-derived transcripts (Fig. 1B). Alternatively, fusion transcripts can be excised from the gel and sequenced to allow detection of integrate derived transcripts. Figure 1: APOT diagram, amplification and hybridization results A Episomal Transcription Amplification P1 P2 dt P3 H1 H2 E6 E7 E1 E4 poly(a) E7 E1 E4 Integrated P1 P2 dt P3 H1 H2 E6 E7 E1 Cellular DNA poly(a) E7 E1 Cellular DNA Arrows: Primer binding sites. P1, P2: HPV specific forward primers for 1st and 2nd PCR. dt: Oligo dt Primer. P3: Adaptor primer. H1: E7 probe. H2: E4 probe. B 1.0 kb 0.3 kb * * * * * * 1.0 kb E7 0.3 kb 1.0 kb E4 0.3 kb Upper row: Agarose gel electrophoresis after APOT RT-PCR. Middle and lower row: Southern blot hybridization with HPV E7 / E4 specific probes. 1-3: normal; 4-6: CIN1; 7-9: CIN2; 10-12: CIN3; 13-15: Carcinoma * Integrate detection by differential hybridization
3 Sample material RNA quality RNA integrity is very important for a good performance of the APOT assay. When RNA integrity is assured, APOT can be performed from very low amounts of clinical material, such as cervical swabs or small biopsies. It is very important to stabilize RNA immidiately after sample extraction. For optimal results, samples should be frozen in liquid nitrogen. Various RNA preparation methods have been used, including modified phenol/chlorophorm assays, Trizol protocols or column based methods, like RNeasy (Qiagen). All methods showed sufficient results with APOT amplification when good RNA was used as starting material. RNA stabilization solutions We have tested RNA stabilization solutions as a substitute for liquid nitrogen. We had good APOT amplification results when samples were immediately transferred to RNAlater (Ambion) and stored up to one week at 25 C and up to one month at 4 C. Long term storage is possible in RNAlater solution at 20 C or -80 C. The quality of the isolated RNA should be determined by amplification of housekeeping gene mrnas like GAPDH or beta-actin. DNAse digest If problems with DNA contamination occur, a DNAse digest can be performed prior to reverse transcription. However, a general application of DNAse does not seem to be necessary. In our lab, we are analyzing mainly fresh frozen swab and biopsy samples. RNA is extracted using the RNeasy kit. Additionally, using this kit, DNA can be isolated from the RNeasy column initial and first wash flowthroughs. The isolated DNA can be used for HPV typing or genome-based integration detection. DNAse digestion of the isolated RNA is generally not performed.
4 Detailed Protocol Reverse Transcription Total RNA (1ng -1 µg) was reverse transcribed using an oligo(dt)17-primer coupled to a linker sequence (dt)17-p3. Master Mix 1 RT reaction x1 Template 4 µl Water 7 µl (dt)17-p3 25 M 1 µl Master Mix 2 5 x RT buffer 4 µl 0,1 DTT 2 µl 10mM dntp 1 µl MMLV RT SuperScript TM µl (20-40 U) Total 20µl Heat denaturation Reverse transcription Master Mix 1 Master Mix 2 HPV 16 HPV C 10 min ->quick chill on ice 42 C 60 min Inactivation min (dt)17-p3-sequence GACTCGAGTCGACATCGA TTTTTTTTTTTTTTTTT SuperScript TM II RNase H - Reverse Transcriptase (Invitrogen) is used to synthesize first-strand cdna and will generally give higher yields of cdna and more full-length product than other reverse transcriptases.
5 1 st PCR Pipetting protocol for the first PCR: 1 st PCR x1 10 x RT buffer 5 µl 10mM dntp 1 µl 50mM MgCl 2 1,5 P1for16 / P1for18 (25 M) 0,5 µl P3 (25 M) 0,5 µl Taq-polymerase (5U) 0,3 µl Water 37,2 µl Template 4 µl Total 50 µl Cycling conditions and primers for the first PCR : 30 Cycles HPV 16 HPV 18 Initial denaturation 94 C 3 min Denaturation 94 C 40 sec Annealing 59 C 30 sec 61 C 30 sec Extension 72 C 4 min Final extension 72 C 7 min P1-sequence CGG ACA GAG CCC ATT ACA AT TAG AAA GCT CAG CAG ACG ACC P3-sequence GAC TCG AGT CGA CAT CG
6 2 nd PCR Pipetting protocol for the second PCR: 1 st PCR x1 10 x RT buffer 5 µl 10mM dntp 1 µl 50mM MgCl 2 1,5 P2for16 / P2for18 (25 M) 0,5 µl (dt)17-p3 (25 M) 0,5 µl Taq-polymerase (5U) 0,3 µl Water 37,2 µl Template 4 µl Total 50 µl Cycling conditions and primers for the second PCR : 30 Cycles HPV 16 HPV 18 Initial denaturation 94 C 3 min Denaturation 94 C 40 sec Annealing 67 C 30 sec 70 C 30 sec Extension 72 C 4 min Final extension 72 C 7 min P2-sequence (dt)17-p3-sequence CCT TTT GTT GCA AGT GTG ACG ACC TTC GAG CAT TCC AGC ACT CTA CG AG GAC TCG AGT CGA CAT CGA TTTTTTTTTTTTTTTTT
7 Hybridization The PCR products are electrophoresed in 1.2% agarose gels, blotted on nylon membranes (Hybond N+, Amersham Life Science, Buckinghamshire, England) and hybridized with an E7-specific probe (H1, table) at 55 C. A second parallel filter is hybridised with an E4-specific probe (H2, table) at 55 C to highlight amplimeres that encompass E4 sequences. Labeling and detection of the probes was performed with the ECL oligolabeling and detection kit (Amersham Pharmacia Biotech, Freiburg, Germany) as per the manufacturer s instructions. Alternatively, other ECL detection systems can be used according to your personal preferences. Amplimeres which did not hybridize with the E4-specific probe or which displayed a different size than the major E7-E1`E4 episomal transcript (approximately 1050 bp in length for HPV16 and 1000 bp for HPV18) were suspected to be derived from integrated HPV genomes. H1-16 TCGTACTTTGGAAGACCTGTTAATG H1-18 GTTTCTGAACACCCTGTCCTTTGTG H2-16 GAAGAAACACAGACGACTATCCAG H2-18 CAGCTACACCTACAGGCAACAACAA Sequencing PCR products of interest are excised from the gel and extracted using the Qiagen Gel Extraction Kit (Qiagen). Sequencing reactions are performed using the Big-Dye terminator DNA-sequencing Kit (Perkin Elmer) and analyzed on an ABI Prism 310 Genetic Analyzer (Applied Biosystems). Sequencing results are compared to public databases using the BLASTN-program provided by the National Cancer Institute, USA.
8 Examples 1. Amplification of fusion transcripts from microdissected material ,2- integrated HPV (two different microdissected tumor regions), patient N1 3,4 - integrated HPV (two different microdissected tumor regions), patient N2 5, 6 - integrated HPV (two different microdissected tumor regions), patient N3 7,8,9- episomal transcripts patient N4 (1050bp - specific, 250, 530, 610, 870, 1400bp -weak non-specific amplicons) The first example shows good reproducible amplification products obtained with microdissected material. Fresh frozen tissue slides were used for laser assisted microdissection. Different areas ( cells) from the same tumor showed identical APOT patterns. Integrate derived fusion transcripts were confirmed by direct sequencing of amplification products.
9 2. Amplification of episomal transcripts and episome derived artifacts The gel shows samples that only harbour episomal HPV DNA. When high amounts of episomal transcripts are present, mispriming of the oligo(dt) primer to A-rich regions can lead to amplification of various artifacts that have a different length than the standard episomal transcript (1050 bp). All marked transcripts were cloned and sequenced. Sequence comparism with the HPV16 genome allowed us to identify the most frequent aberrant binding sites. The characteristic artifact patterns shown in the picture above occur only when no integrate derived transcripts can be amplified. On the following page, the HPV16 sequence from 728 (binding site of the 2 nd APOT PCR primer) to 4250 (area of the polya signal AATAAA that leads to termination of transcription and polyadenylation, regular binding site of the oligo(dt) primer) is provided. A-rich sequences are marked and annotated according to the data from sequenced artifacts. Three artifacts (250, 870 and 1400) derive from non-spliced transcripts or from contaminating episomal DNA, the others from regularly spliced transcripts.
10 Additional material: sequence map of HPV16 with aberrant binding sites. 2nd PCR primer 721 attgtaacct tttgttgcaa gtgtgactct acgcttcggt tgtgcgtaca aagcacacac 781 gtagacattc gtactttgga agacctgtta atgggcacac taggaattgt gtgccccatc s.donor site 841 tgttctcaga aaccataatc taccatggct gatcctgcag gtaccaatgg ggaagagggt A-rich 250 bp 901 acgggatgta atggatggtt ttatgtagag gctgtagtgg aaaaaaaaac aggggatgct 961 atatcagatg acgagaacga aaatgacagt gatacaggtg aagatttggt agattttata 1021 gtaaatgata atgattattt aacacaggca gaaacagaga cagcacatgc gttgtttact 1081 gcacaggaag caaaacaaca tagagatgca gtacaggttc taaaacgaaa gtatttggta 1141 gtccacttag tgatattagt ggatgtgtag acaataatat tagtcctaga ttaaaagcta 1201 tatgtataga aaaacaaagt agagctgcaa aaaggagatt atttgaaagc gaagacagcg 1261 ggtatggcaa tactgaagtg gaaactcagc agatgttaca ggtagaaggg cgccatgaga 1321 ctgaaacacc atgtagtcag tatagtggtg gaagtggggg tggttgcagt cagtacagta 1381 gtggaagtgg gggagagggt gttagtgaaa gacacactat atgccaaaca ccacttacaa 1441 atattttaaa tgtactaaaa actagtaatg caaaggcagc aatgttagca aaatttaaag 1501 agttatacgg ggtgagtttt tcagaattag taagaccatt taaaagtaat aaatcaacgt A-rich 870 bp 1561 gttgcgattg gtgtattgct gcatttggac ttacacccag tatagctgac agtataaaaa 1621 cactattaca acaatattgt ttatatttac acattcaaag tttagcatgt tcatggggaa 1681 tggttgtgtt actattagta agatataaat gtggaaaaaa tagagaaaca attgaaaaat 1741 tgctgtctaa actattatgt gtgtctccaa tgtgtatgat gatagagcct ccaaaattgc 1801 gtagtacagc agcagcatta tattggtata aaacaggtat atcaaatatt agtgaagtgt 1861 atggagacac gccagaatgg atacaaagac aaacagtatt acaacatagt tttaatgatt 1921 gtacatttga attatcacag atggtacaat gggcctacga taatgacata gtagacgata 1981 gtgaaattgc atataaatat gcacaattgg cagacactaa tagtaatgca agtgcctttc 2041 taaaaagtaa ttcacaggca aaaattgtaa aggattgtgc aacaatgtgt agacattata A-rich 1400 bp 2101 aacgagcaga aaaaaaacaa atgagtatga gtcaatggat aaaatataga tgtgataggg 2161 tagatgatgg aggtgattgg aagcaaattg ttatgttttt aaggtatcaa ggtgtagagt 2221 ttatgtcatt tttaactgca ttaaaaagat ttttgcaagg catacctaaa aaaaattgca 2281 tattactata tggtgcagct aacacaggta aatcattatt tggtatgagt ttaatgaaat 2341 ttctgcaagg gtctgtaata tgttttgtaa attctaaaag ccatttttgg ttacaaccat 2401 tagcagatgc caaaataggt atgttagatg atgctacagt gccctgttgg aactacatag 2461 atgacaattt aagaaatgca ttggatggaa atttagtttc tatggatgta aagcatagac 2521 cattggtaca actaaaatgc cctccattat taattacatc taacattaat gctggtacag 2581 attctaggtg gccttattta cataatagat tggtggtgtt tacatttcct aatgagtttc 2641 catttgacga aaacggaaat ccagtgtatg agcttaatga taagaactgg aaatcctttt 2701 tctcaaggac gtggtccaga ttaagtttgc acgaggacga ggacaaggaa aacgatggag 2761 actctttgcc aacgtttaaa tgtgtgtcag gacaaaatac taacacatta tgaaaatgat 2821 agtacagacc tacgtgacca tatagactat tggaaacaca tgcgcctaga atgtgctatt 2881 tattacaagg ccagagaaat gggatttaaa catattaacc accaagtggt gccaacactg 2941 gctgtatcaa agaataaagc attacaagca attgaactgc aactaacgtt agaaacaata 3001 tataactcac aatatagtaa tgaaaagtgg acattacaag acgttagcct tgaagtgtat 3061 ttaactgcac caacaggatg tataaaaaaa catggatata cagtggaagt gcagtttgat 3121 ggagacatat gcaatacaat gcattataca aactggacac atatatatat ttgtgaagaa 3181 gcatcagtaa ctgtggtaga gggtcaagtt gactattatg gtttatatta tgttcatgaa 3241 ggaatacgaa catattttgt gcagtttaaa gatgatgcag aaaaatatag taaaaataaa s.acc 3301 gtatgggaag ttcatgcggg tggtcaggta atattatgtc ctacatctgt gtttagcagc 3361 aacgaagtat cctctcctga aattattagg cagcacttgg ccaaccaccc cgccgcgacc 3421 cataccaaag ccgtcgcctt gggcaccgaa gaaacacaga cgactatcca gcgaccaaga 3481 tcagagccag acaccggaaa cccctgccac accactaagt tgttgcacag agactcagtg 3541 gacagtgctc caatcctcac tgcatttaac agctcacaca aaggacggat taactgtaat 3601 agtaacacta cacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga 3661 tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca A-rich 530 bp 3721 ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa A-rich 610 bp 3781 cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggattt 3841 atgtctatat gacaaatctt gatactgcat ccacaacatt actggcgtgc tttttgcttt 3901 gctttgtgtg cttttgtgtg tctgcctatt aatacgtccg ctgcttttgt ctgtgtctac 3961 atacacatca ttaataatat tggtattact attgtggata acagcagcct ctgcgtttag 4021 gtgttttatt gtatatatta tatttgttta tataccatta tttttaatac atacacatgc 4081 acgcttttta attacataat gtatatgtac ataatgtaat tgttacatat aattgttgta 4141 taccataact tactattttt tcttttttat tttcatatat aatttttttt tttgtttgtt poly A episomal 1050 bp 4201 tgtttgtttt ttaataaact gttattactt aacaatgcga cacaaacgtt ctgcaaaacg
11 Literature Papers Klaes R, Woerner SM, Ridder R, Wentzensen N, Duerst M, Schneider A, Lotz B, Melsheimer P, von Knebel Doeberitz M. Detection of high-risk cervical intraepithelial neoplasia and cervical cancer by amplification of transcripts derived from integrated papillomavirus oncogenes. (1999) Cancer Research 59: Initial description of the APOT protocol, application on a large number of clinical samples. Wentzensen N, Ridder R, Klaes R, Vinokourova S, Schaefer U, von Knebel Doeberitz M Characterization of viral-cellular fusion transcripts in a large series of HPV16 and 18 positive anogenital lesions. (2002) Oncogene 21: Characterization of APOT derived fusion transcripts. Wiest T, Schwarz E, Enders C, Flechtenmacher C, Bosch FX. Involvement of intact HPV16 E6/E7 gene expression in head and neck cancers with unaltered p53 status and perturbed prb cell cycle control. (2002) Oncogene 21: Modified APOT protocol used to analyze fusion transcripts from head and neck cancers. Ziegert C, Wentzensen N, Vinokourova S, Kisseljov F, Einenkel J, Hoeckel M,von Knebel Doeberitz M. A Comprehensive Analysis of HPV Integration Loci in Anogenital Lesions combining Transcript and Genome Based Amplification Techniques. Submitted. Comparison of fusion transcripts and genomic integration sites using APOT. Conference presentations Turek L et al. HPV conference 2001 and 2002 APOT amplification of fusion transcripts from head and neck cancers.
12 Contact information We are continuously working to improve the APOT assay and have decided to provide users with our standard procedure protocols. If you encounter any problems or have any further questions, please do not hesitate to contact us. Svetlana Vinokourova, PhD Nicolas Wentzensen, MD Division of Molecular Pathology Department of Pathology University of Heidelberg Im Neuenheimer Feld 220/221 D Heidelberg Phone : Fax: [email protected] [email protected] Version 1.1 December 2002
RT-PCR: Two-Step Protocol
RT-PCR: Two-Step Protocol We will provide both one-step and two-step protocols for RT-PCR. We recommend the twostep protocol for this class. In the one-step protocol, the components of RT and PCR are mixed
RevertAid Premium First Strand cdna Synthesis Kit
RevertAid Premium First Strand cdna Synthesis Kit #K1651, #K1652 CERTIFICATE OF ANALYSIS #K1651 Lot QUALITY CONTROL RT-PCR using 100 fg of control GAPDH RNA and GAPDH control primers generated a prominent
CompleteⅡ 1st strand cdna Synthesis Kit
Instruction Manual CompleteⅡ 1st strand cdna Synthesis Kit Catalog # GM30401, GM30402 Green Mountain Biosystems. LLC Web: www.greenmountainbio.com Tel: 800-942-1160 Sales: Sales@ greenmountainbio.com Support:
Real-time quantitative RT -PCR (Taqman)
Real-time quantitative RT -PCR (Taqman) Author: SC, Patti Lab, 3/03 This is performed as a 2-step reaction: 1. cdna synthesis from DNase 1-treated total RNA 2. PCR 1. cdna synthesis (Advantage RT-for-PCR
Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual
Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual F- 470S 20 cdna synthesis reactions (20 µl each) F- 470L 100 cdna synthesis reactions (20 µl each) Table of contents 1. Description...
All-in-One First-Strand cdna Synthesis Kit
All-in-One First-Strand cdna Synthesis Kit For reliable first-strand cdna synthesis from all RNA sources Cat. No. AORT-0020 (20 synthesis reactions) Cat. No. AORT-0050 (50 synthesis reactions) User Manual
HiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
DNA Sample preparation and Submission Guidelines
DNA Sample preparation and Submission Guidelines Requirements: Please submit samples in 1.5ml microcentrifuge tubes. Fill all the required information in the Eurofins DNA sequencing order form and send
All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna
All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna All-in-One TM mirna First-Strand cdna Synthesis Kit AMRT-0020 (20 RT reactions), AMRT-0060 (60 RT reactions) Used in combination
Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation
BDGP Resources Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation For recovery of sequences flanking PZ, PlacW and PEP elements E. Jay Rehm Berkeley Drosophila Genome Project I.
ab185916 Hi-Fi cdna Synthesis Kit
ab185916 Hi-Fi cdna Synthesis Kit Instructions for Use For cdna synthesis from various RNA samples This product is for research use only and is not intended for diagnostic use. Version 1 Last Updated 1
Global MicroRNA Amplification Kit
Global MicroRNA Amplification Kit Store kit at -20 C on receipt (ver. 3-060901) A limited-use label license covers this product. By use of this product, you accept the terms and conditions outlined in
First Strand cdna Synthesis
380PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 [email protected] A Geno Technology, Inc. (USA) brand name First Strand cdna Synthesis (Cat. # 786 812) think proteins! think G-Biosciences
Mir-X mirna First-Strand Synthesis Kit User Manual
User Manual Mir-X mirna First-Strand Synthesis Kit User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories, Inc.
RT31-020 20 rxns. RT31-100 100 rxns TRANSCRIPTME Enzyme Mix (1) 40 µl 2 x 50 µl 5 x 40 µl
Components RT31-020 20 rxns RT31-050 50 rxns RT31-100 100 rxns TRANSCRIPTME Enzyme Mix (1) 40 µl 2 x 50 µl 5 x 40 µl 2x RT Master Mix (2) 200 µl 2 x 250 µl 5 x 200 µl RNase H (E. coli) 20 µl 2 x 25 µl
Table of Contents. I. Description... 2. II. Kit Components... 2. III. Storage... 2. IV. 1st Strand cdna Synthesis Reaction... 3
Table of Contents I. Description... 2 II. Kit Components... 2 III. Storage... 2 IV. 1st Strand cdna Synthesis Reaction... 3 V. RT-PCR, Real-time RT-PCR... 4 VI. Application... 5 VII. Preparation of RNA
pcas-guide System Validation in Genome Editing
pcas-guide System Validation in Genome Editing Tagging HSP60 with HA tag genome editing The latest tool in genome editing CRISPR/Cas9 allows for specific genome disruption and replacement in a flexible
SYBR Green Realtime PCR Master Mix -Plus-
Instruction manual SYBR Green Realtime PCR Master Mix -Plus- 0810 F0925K SYBR Green Realtime PCR Master Mix -Plus- Contents QPK-212T 1mLx1 QPK-212 1mLx5 Store at -20 C, protected from light [1] Introduction
Reverse Transcription System
TECHNICAL BULLETIN Reverse Transcription System Instruc ons for use of Product A3500 Revised 1/14 TB099 Reverse Transcription System All technical literature is available on the Internet at: www.promega.com/protocols/
All-in-One mirna qrt-pcr Detection System Handbook
All-in-One mirna qrt-pcr Detection System Handbook For quantitative detection of mature mirna All-in-One mirna First-Strand cdna Synthesis Kit Cat. No. AMRT-0020 (20 mirna reverse transcription reactions)
AffinityScript QPCR cdna Synthesis Kit
AffinityScript QPCR cdna Synthesis Kit INSTRUCTION MANUAL Catalog #600559 Revision C.01 For In Vitro Use Only 600559-12 LIMITED PRODUCT WARRANTY This warranty limits our liability to replacement of this
qstar mirna qpcr Detection System
qstar mirna qpcr Detection System Table of Contents Table of Contents...1 Package Contents and Storage Conditions...2 For mirna cdna synthesis kit...2 For qstar mirna primer pairs...2 For qstar mirna qpcr
GENEWIZ, Inc. DNA Sequencing Service Details for USC Norris Comprehensive Cancer Center DNA Core
DNA Sequencing Services Pre-Mixed o Provide template and primer, mixed into the same tube* Pre-Defined o Provide template and primer in separate tubes* Custom o Full-service for samples with unknown concentration
DyNAmo cdna Synthesis Kit for qrt-pcr
DyNAmo cdna Synthesis Kit for qrt-pcr Instruction manual F- 470S Sufficient for 20 cdna synthesis reactions (20 µl each) F- 470L Sufficient for 100 cdna synthesis reactions (20 µl each) Description...
Updated: July 2005. 5' End label RNA markers 18.113 (18mer) and 44.12 (24mer) with Kinase and 32P-gamma-ATP. Gel purify labeled markers.
RNA Cloning Method Flowchart Extract total RNA containing small RNAs. Check quality on denaturing gel with EtBr staining 5' End label RNA markers 18.113 (18mer) and 44.12 (24mer) with Kinase and 32P-gamma-ATP.
Introduction To Real Time Quantitative PCR (qpcr)
Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors
MMLV High Performance Reverse Transcriptase
MMLV High Performance Reverse Transcriptase Cat. Nos. RT80110K and RT80125K Connect with Epicentre on our blog (epicentral.blogspot.com), Facebook (facebook.com/epicentrebio), and Twitter (@EpicentreBio).
Speed Matters - Fast ways from template to result
qpcr Symposium 2007 - Weihenstephan Speed Matters - Fast ways from template to result March 28, 2007 Dr. Thorsten Traeger Senior Scientist, Research and Development - 1 - Overview Ạgenda Fast PCR The Challenges
RNA Extraction and Quantification, Reverse Transcription, and Real-time PCR (q-pcr)
RNA Extraction and Quantification, Reverse Transcription, and Real-time Preparation of Samples Cells: o Remove media and wash cells 2X with cold PBS. (2 ml for 6 well plate or 3 ml for 6cm plate) Keep
ONLINE SUPPLEMENTAL MATERIAL. Allele-Specific Expression of Angiotensinogen in Human Subcutaneous Adipose Tissue
ONLINE SUPPLEMENTAL MATERIAL Allele-Specific Expression of Angiotensinogen in Human Subcutaneous Adipose Tissue Sungmi Park 1, Ko-Ting Lu 1, Xuebo Liu 1, Tapan K. Chatterjee 2, Steven M. Rudich 3, Neal
Heraeus Sepatech, Kendro Laboratory Products GmbH, Berlin. Becton Dickinson,Heidelberg. Biozym, Hessisch Oldendorf. Eppendorf, Hamburg
13 4. MATERIALS 4.1 Laboratory apparatus Biofuge A Centrifuge 5804R FACScan Gel electrophoresis chamber GPR Centrifuge Heraeus CO-AUTO-ZERO Light Cycler Microscope Motopipet Neubauer Cell Chamber PCR cycler
FastLine cell cdna Kit
1. FastLine cell cdna Kit For high-speed preparation of first-strand cdna directly from cultured cells without RNA purification www.tiangen.com RT100701 FastLine cell cdna Kit Cat. no. KR105 Kit Contents
QUANTITATIVE RT-PCR. A = B (1+e) n. A=amplified products, B=input templates, n=cycle number, and e=amplification efficiency.
QUANTITATIVE RT-PCR Application: Quantitative RT-PCR is used to quantify mrna in both relative and absolute terms. It can be applied for the quantification of mrna expressed from endogenous genes, and
Quantitative Real Time PCR Protocol. Stack Lab
Quantitative Real Time PCR Protocol Stack Lab Overview Real-time quantitative polymerase chain reaction (qpcr) differs from regular PCR by including in the reaction fluorescent reporter molecules that
POLYMERASES & AMPLIFICATION. OneTaq RT-PCR Kit. Instruction Manual. NEB #E5310S 30 reactions
POLYMERASES & AMPLIFICATION OneTaq RT-PCR Kit Instruction Manual NEB #E5310S 30 reactions ISO 9001 Registered Quality Management ISO 14001 Registered Environmental Management ISO 13485 Registered Medical
Mir-X mirna First-Strand Synthesis and SYBR qrt-pcr
User Manual Mir-X mirna First-Strand Synthesis and SYBR qrt-pcr User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories,
Hepatitis B Virus Genemer Mix
Product Manual Hepatitis B Virus Genemer Mix Primer Pair for amplification of HBV Specific DNA Fragment Includes Internal Negative Control Primers and Template Catalog No.: 60-2007-12 Store at 20 o C For
PreciseTM Whitepaper
Precise TM Whitepaper Introduction LIMITATIONS OF EXISTING RNA-SEQ METHODS Correctly designed gene expression studies require large numbers of samples, accurate results and low analysis costs. Analysis
PrimeSTAR HS DNA Polymerase
Cat. # R010A For Research Use PrimeSTAR HS DNA Polymerase Product Manual Table of Contents I. Description...3 II. III. IV. Components...3 Storage...3 Features...3 V. General Composition of PCR Reaction
NimbleGen SeqCap EZ Library SR User s Guide Version 3.0
NimbleGen SeqCap EZ Library SR User s Guide Version 3.0 For life science research only. Not for use in diagnostic procedures. Copyright 2011 Roche NimbleGen, Inc. All Rights Reserved. Editions Version
PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-)
PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-) FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE Lucigen Corporation 2905 Parmenter St, Middleton, WI 53562 USA Toll Free: (888) 575-9695 (608)
Validating Microarray Data Using RT 2 Real-Time PCR Products
Validating Microarray Data Using RT 2 Real-Time PCR Products Introduction: Real-time PCR monitors the amount of amplicon as the reaction occurs. Usually, the amount of product is directly related to the
Essentials of Real Time PCR. About Sequence Detection Chemistries
Essentials of Real Time PCR About Real-Time PCR Assays Real-time Polymerase Chain Reaction (PCR) is the ability to monitor the progress of the PCR as it occurs (i.e., in real time). Data is therefore collected
SOLIDscript Solid Phase cdna Synthesis Kit Instruction Manual
Toll Free: 866-252-7771 752A Lincoln Blvd. Phone: 732-469-7771 Fax: 732-469-7782 Middlesex, NJ 08846 Web: www.purebiotechllc.com SOLIDscript Solid Phase cdna Synthesis Kit Instruction Manual Product: SOLIDscript
Data Analysis for Ion Torrent Sequencing
IFU022 v140202 Research Use Only Instructions For Use Part III Data Analysis for Ion Torrent Sequencing MANUFACTURER: Multiplicom N.V. Galileilaan 18 2845 Niel Belgium Revision date: August 21, 2014 Page
MystiCq microrna cdna Synthesis Mix Catalog Number MIRRT Storage Temperature 20 C
microrna cdna Synthesis Mix Catalog Number MIRRT Storage Temperature 20 C Product Description The microrna cdna Synthesis Mix has been designed to easily convert micrornas into cdna templates for qpcr
How many of you have checked out the web site on protein-dna interactions?
How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss
User Manual/Hand book. qpcr mirna Arrays ABM catalog # MA003 (human) and MA004 (mouse)
User Manual/Hand book qpcr mirna Arrays ABM catalog # MA003 (human) and MA004 (mouse) Kit Components Cat. No. MA003...Human Whole Genome mirna qpcr Profiling Kit (-20 C) The following components are sufficient
mircute mirna qpcr Detection Kit (SYBR Green)
mircute mirna qpcr Detection Kit (SYBR Green) For detection of mirna using real-time RT-PCR (SYBR Green I) www.tiangen.com QP110302 mircute mirna qpcr Detection Kit (SYBR Green) Kit Contents Cat. no. FP401
Application Guide... 2
Protocol for GenomePlex Whole Genome Amplification from Formalin-Fixed Parrafin-Embedded (FFPE) tissue Application Guide... 2 I. Description... 2 II. Product Components... 2 III. Materials to be Supplied
PrimeScript High Fidelity RT-PCR Kit
For Research Use PrimeScript High Fidelity RT-PCR Kit Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Materials Required but not Provided... 4 IV. Storage... 4 V. Fidelity
360 Master Mix. , and a supplementary 360 GC Enhancer.
Product Bulletin AmpliTaq Gold 360 Master Mix and 360 DNA Polymerase AmpliTaq Gold 360 Master Mix AmpliTaq Gold 360 DNA Polymerase 360 Coverage for a Full Range of Targets AmpliTaq Gold 360 Master Mix
Protocol. Introduction to TaqMan and SYBR Green Chemistries for Real-Time PCR
Protocol Introduction to TaqMan and SYBR Green Chemistries for Real-Time PCR Copyright 2008, 2010 Applied Biosystems. All rights reserved. Ambion and Applied Biosystems products are for Research Use Only.
EXPERIMENT 6 RNA ISOLATION AND RT-PCR ANALYSIS (GENE TWO)
EXPERIMENT 6 RNA ISOLATION AND RT-PCR ANALYSIS (GENE TWO) Purpose: To determine the mrna accumulation pattern of the gene of interest in wild type and mutant Arabidopsis siliques. OVERVIEW OF RT-PCR STRATEGY
RNA Isolation for Frozen Mouse Livers and Reverse Transcription
RNA Isolation for Frozen Mouse Livers and Reverse Transcription I. Introduction RNA is typically isolated from tissue or cells based on the procedure originally described by Chomczynski and Sacchi in 1987.
REAL TIME PCR USING SYBR GREEN
REAL TIME PCR USING SYBR GREEN 1 THE PROBLEM NEED TO QUANTITATE DIFFERENCES IN mrna EXPRESSION SMALL AMOUNTS OF mrna LASER CAPTURE SMALL AMOUNTS OF TISSUE PRIMARY CELLS PRECIOUS REAGENTS 2 THE PROBLEM
Power SYBR Green PCR Master Mix and Power SYBR Green RT-PCR Reagents Kit
USER GUIDE Power SYBR Green PCR Master Mix and Power SYBR Green RT-PCR Reagents Kit Catalog Number 4368577, 4367659, 4367660, 4368706, 4368702, 4368708 (Master Mix) and 4368711 (RT-PCR Reagents Kit) Publication
Trimmer-2 cdna normalization kit
Trimmer-2 cdna normalization kit Cat # NK003 User manual PLEASE READ THE ENTIRE MANUAL BEFORE STARTING Contents I Intended use............................ 1 II Method overview..........................
Stratagene QPCR Mouse Reference Total RNA
Stratagene QPCR Mouse Reference Total RNA Instruction Manual Catalog #750600 Revision C.0 For Research Use Only. Not for use in diagnostic procedures. 750600-12 LIMITED PRODUCT WARRANTY This warranty limits
Arcturus PicoPure RNA Isolation Kit. User Guide
Arcturus PicoPure RNA Isolation Kit User Guide For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in this document is subject to change without notice.
SYBR Green PCR Master Mix and SYBR Green RT-PCR Reagents Kit
USER GUIDE SYBR Green PCR Master Mix and SYBR Green RT-PCR Reagents Kit Catalog Number 4309155 (Master Mix) and 4306736 (RT-PCR Reagents Kit) Publication Part Number 4310251 Rev. G Revision Date September
Absolute Quantification Getting Started Guide
5 cdna Reverse Primer Oligo d(t) or random hexamer Synthesis of 1st cdna strand 3 5 cdna Applied Biosystems 7300/7500/7500 Fast Real-Time PCR System Absolute Quantification Getting Started Guide Introduction
SOP Title: Multiplex-PCR check of genomic DNA isolated from FFPE tissue for its usability in array CGH analysis
SOP Title: Multiplex-PCR check of genomic DNA isolated from FFPE tissue for its usability in array CGH analysis The STORE processing methods were shown to be fit-for purpose for DNA, RNA and protein extraction
TaqMan Fast Advanced Master Mix. Protocol
TaqMan Fast Advanced Master Mix Protocol For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in this document is subject to change without notice. APPLIED
Molecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION
Molecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION Susan Carson Heather B. Miller D.Scott Witherow ELSEVIER AMSTERDAM BOSTON HEIDELBERG LONDON NEW YORK OXFORD PARIS SAN DIEGO SAN
Gene Expression Assays
APPLICATION NOTE TaqMan Gene Expression Assays A mpl i fic ationef ficienc yof TaqMan Gene Expression Assays Assays tested extensively for qpcr efficiency Key factors that affect efficiency Efficiency
10 µg lyophilized plasmid DNA (store lyophilized plasmid at 20 C)
TECHNICAL DATA SHEET BIOLUMINESCENCE RESONANCE ENERGY TRANSFER RENILLA LUCIFERASE FUSION PROTEIN EXPRESSION VECTOR Product: prluc-c Vectors Catalog number: Description: Amount: The prluc-c vectors contain
ChIP TROUBLESHOOTING TIPS
ChIP TROUBLESHOOTING TIPS Creative Diagnostics Abstract ChIP dissects the spatial and temporal dynamics of the interactions between chromatin and its associated factors CD Creative Diagnostics info@creative-
Řekněte si o vzorky zdarma!
strana 1 z 6 Ceník platí v souladu s Obchodními podmínkami LAB MARK od 15.10.2015 Core Reagents for Molecular Biology www.bioline.com Řekněte si o vzorky zdarma! PCR ENZYME & MIXES DNA Polymerases - For
Materials and Methods. Blocking of Globin Reverse Transcription to Enhance Human Whole Blood Gene Expression Profiling
Application Note Blocking of Globin Reverse Transcription to Enhance Human Whole Blood Gene Expression Profi ling Yasmin Beazer-Barclay, Doug Sinon, Christopher Morehouse, Mark Porter, and Mike Kuziora
Highly specific and sensitive quantitation
PRODUCT ULLETIN SYR Select Master Mix SYR Select Master Mix Highly specific and sensitive quantitation SYR Select Master Mix offers advanced performance at an affordable price. SYR Select Master Mix is
Molecular analyses of EGFR: mutation and amplification detection
Molecular analyses of EGFR: mutation and amplification detection Petra Nederlof, Moleculaire Pathologie NKI Amsterdam Henrique Ruijter, Ivon Tielen, Lucie Boerrigter, Aafke Ariaens Outline presentation
DNA Core Facility: DNA Sequencing Guide
DNA Core Facility: DNA Sequencing Guide University of Missouri-Columbia 216 Life Sciences Center Columbia, MO 65211 http://biotech.missouri.edu/dnacore/ Table of Contents 1. Evaluating Sequencing Data..
5PCR, real-time PCR, reverse transcription, and cloning
5PCR, real-time PCR, reverse transcription, and cloning 166 www.qiagen.com QIAGEN Product Guide 2007 PCR, real-time PCR, reverse transcription, and cloning 5 5.1 PCR and RT-PCR www.qiagen.com/pg/pcr Selection
ExpressArt Bacterial H-TR cdna synthesis kit. With extreme selectivity against rrnas
ExpressArt Bacterial H-TR cdna synthesis kit With extreme selectivity against rrnas suitable for 2 to 4 µg total RNA Catalogue No. 8004-A30 (30 rxns) Reagents Materials are provided for 30 cdna synthesis
Procedure for RNA isolation from human muscle or fat
Procedure for RNA isolation from human muscle or fat Reagents, all Rnase free: 20% SDS DEPC-H2O Rnase ZAP 75% EtOH Trizol Chloroform Isopropanol 0.8M NaCitrate/1.2M NaCl TE buffer, ph 7.0 1. Homogenizer-probe
User Manual. CelluLyser Lysis and cdna Synthesis Kit. Version 1.4 Oct 2012 From cells to cdna in one tube
User Manual CelluLyser Lysis and cdna Synthesis Kit Version 1.4 Oct 2012 From cells to cdna in one tube CelluLyser Lysis and cdna Synthesis Kit Table of contents Introduction 4 Contents 5 Storage 5 Additionally
SERVICES CATALOGUE WITH SUBMISSION GUIDELINES
SERVICES CATALOGUE WITH SUBMISSION GUIDELINES 3921 Montgomery Road Cincinnati, Ohio 45212 513-841-2428 www.agctsequencing.com CONTENTS Welcome Dye Terminator Sequencing DNA Sequencing Services - Full Service
Technical Manual No. 0173 Update Date 10112010
TissueDirect TM Multiplex PCR System Technical Manual No. 0173 Update Date 10112010 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 3 V Simplified Procedures. 3 VI Detailed
TIANquick Mini Purification Kit
TIANquick Mini Purification Kit For purification of PCR products, 100 bp to 20 kb www.tiangen.com TIANquick Mini Purification Kit (Spin column) Cat no. DP203 Kit Contents Contents Buffer BL Buffer PB Buffer
Genolution Pharmaceuticals, Inc. Life Science and Molecular Diagnostic Products
Genolution Pharmaceuticals, Inc. Revolution through genes, And Solution through genes. Life Science and Molecular Diagnostic Products www.genolution1.com TEL; 02-3010-8670, 8672 Geno-Serum Hepatitis B
New Technologies for Sensitive, Low-Input RNA-Seq. Clontech Laboratories, Inc.
New Technologies for Sensitive, Low-Input RNA-Seq Clontech Laboratories, Inc. Outline Introduction Single-Cell-Capable mrna-seq Using SMART Technology SMARTer Ultra Low RNA Kit for the Fluidigm C 1 System
Taq98 Hot Start 2X Master Mix
Taq98 Hot Start 2X Master Mix Optimized for 98C Denaturation Lucigen Corporation 2905 Parmenter St, Middleton, WI 53562 USA Toll Free: (888) 575-9695 (608) 831-9011 FAX: (608) 831-9012 [email protected]
Next Generation Sequencing
Next Generation Sequencing 38. Informationsgespräch der Blutspendezentralefür Wien, Niederösterreich und Burgenland Österreichisches Rotes Kreuz 22. November 2014, Parkhotel Schönbrunn Die Zukunft hat
Protocols. Internal transcribed spacer region (ITS) region. Niklaus J. Grünwald, Frank N. Martin, and Meg M. Larsen (2013)
Protocols Internal transcribed spacer region (ITS) region Niklaus J. Grünwald, Frank N. Martin, and Meg M. Larsen (2013) The nuclear ribosomal RNA (rrna) genes (small subunit, large subunit and 5.8S) are
Application Note. Single Cell PCR Preparation
Application Note Single Cell PCR Preparation From Automated Screening to the Molecular Analysis of Single Cells The AmpliGrid system is a highly sensitive tool for the analysis of single cells. In combination
SUGAR BEET (Beta vulgaris L.) PROMOTERS FOR DIRECTED TISSUE- SPECIFIC ROOT TRANSCRIPTION
SUGAR BEET (Beta vulgaris L.) PROMOTERS FOR DIRECTED TISSUE- SPECIFIC ROOT TRANSCRIPTION Senthilkumar Padmanaban, Haiyan Li, David P. Puthoff and Ann C. Smigocki USDA-ARS Molecular Plant Pathology Laboratory,
Genomic DNA Clean & Concentrator Catalog Nos. D4010 & D4011
Page 0 INSTRUCTION MANUAL Catalog Nos. D4010 & D4011 Highlights Quick (5 minute) spin column recovery of large-sized DNA (e.g., genomic, mitochondrial, plasmid (BAC/PAC), viral, phage, (wga)dna, etc.)
Isolation and characterization of nine microsatellite loci in the Pale Pitcher Plant. MARGARET M. KOOPMAN*, ELIZABETH GALLAGHER, and BRYAN C.
Page 1 of 28 1 1 2 3 PERMANENT GENETIC RESOURCES Isolation and characterization of nine microsatellite loci in the Pale Pitcher Plant Sarracenia alata (Sarraceniaceae). 4 5 6 MARGARET M. KOOPMAN*, ELIZABETH
PicoMaxx High Fidelity PCR System
PicoMaxx High Fidelity PCR System Instruction Manual Catalog #600420 (100 U), #600422 (500 U), and #600424 (1000 U) Revision C Research Use Only. Not for Use in Diagnostic Procedures. 600420-12 LIMITED
Investigating the role of a Cryptosporidium parum apyrase in infection
Investigating the role of a Cryptosporidium parum apyrase in infection David Riccardi and Patricio Manque Abstract This project attempted to characterize the function of a Cryptosporidium parvum apyrase
NimbleGen DNA Methylation Microarrays and Services
NimbleGen DNA Methylation Microarrays and Services Sample Preparation Instructions Outline This protocol describes the process for preparing samples for NimbleGen DNA Methylation microarrays using the
TITRATION OF raav (VG) USING QUANTITATIVE REAL TIME PCR
Page 1 of 5 Materials DNase digestion buffer [13 mm Tris-Cl, ph7,5 / 5 mm MgCl2 / 0,12 mm CaCl2] RSS plasmid ptr-uf11 SV40pA Forward primer (10µM) AGC AAT AGC ATC ACA AAT TTC ACA A SV40pA Reverse Primer
Sequencing Guidelines Adapted from ABI BigDye Terminator v3.1 Cycle Sequencing Kit and Roswell Park Cancer Institute Core Laboratory website
Biomolecular Core Facility AI Dupont Hospital for Children, Rockland Center One, Room 214 Core: (302) 651-6712, Office: (302) 651-6707, [email protected] Katia Sol-Church, Ph.D., Director Jennifer Frenck
Real-Time PCR Vs. Traditional PCR
Real-Time PCR Vs. Traditional PCR Description This tutorial will discuss the evolution of traditional PCR methods towards the use of Real-Time chemistry and instrumentation for accurate quantitation. Objectives
Dynabeads mrna DIRECT Micro Kit
USER GUIDE Dynabeads mrna DIRECT Micro Kit Catalog Number 61021 Revision 004 Revision Date 14 May 2012 For Research Use Only. Not for human or animal therapeutic or diagnostic use. For Research Use Only.
PrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID papillary renal cell carcinoma (translocation-associated) PRCC Human This gene
Path-ID Multiplex One-Step RT-PCR Kit
USER GUIDE Path-ID Multiplex One-Step RT-PCR Kit TaqMan probe-based multiplex one-step real-time RT-PCR detection of RNA targets Catalog Numbers 4428206, 4428207, 4440022 Publication Part Number 4440907
