P G DIPLOMA IN BIOINFORMATICS

Size: px
Start display at page:

Download "P G DIPLOMA IN BIOINFORMATICS"

Transcription

1 P G DIPLOMA IN BIOINFORMATICS Name Course Code Name of the Course Credits PGD BINF 301 Introduction to Bioinformatics and Databases 2 Module I PGD BINF 302 Genome and Protein Sequence Analysis 2 Basic PGD BINF 303 Genomics and proteomics 2 Bioinformatics PGD BINF 304 Lab : Bioinformatics Databases 2 PGD BINF 305 Lab : Sequence Analysis 2 Module II Applied Bioinformatics PGD BINF 401 Systems Biology 2 PGD BINF 402 Structural Biology 2 PGD BINF 403 Computer Aided Drug Design 2 PGD BINF 404 Lab : Structural Biology 2 PGD BINF 405 Lab : Computer Aided Drug Design 2

2 PGD BINF 301 Introduction to Bioinformatics and Databases Bioinformatics: an overview - Introduction to Computational Biology and Bioinformatics; some of the biological problems that require computational methods for their solution; Role of internet and www in bioinformatics. Biological Data Acquisition The form of biological information; DNA sequencing methods basic DNA sequencing, automated DNA sequencing, DNA sequencing by capillary array and electrophoresis; Types of DNA sequences genomic DNA, cdna, recombinant DNA, Expressed sequence tags (ESTs), Genomic survey sequences (GSSs); RNA sequencing methods; Protein structure determination methods; gene expression data. Databases : Format and Annotation Conventions for databases indexing and specification of search terms; Common sequencing file formats NBRF/PIR, FASTA, GDE; Files for multiple sequence alignment multiple sequence format (MSF), ALN format; Files for structural data PDB format and NMR files; Annotated sequence databases primary sequence databases (GenBank-NCBI, the nucleotide sequence database-embl, DNA sequence databank of Japan-DDBJ; Subsidiary data storage (ESTs, dbests, GSSs), unfinished genomic sequence data, organisms specific databases (EcoGene, SGD, MatDB, TAIR, FlyBase, OMIM, etc.); Protein sequence and structure databases (PDB, SWISS-PROT and TrEMBL); List of Gateways (NCBI, GOLD, MIPS, TIGR, UniGene) V Data : Access, Retrieval and Submission Data access standard search engines, Data retrieval tools Entrez, DBGET and SRS (sequence retrieval systems); Software for data building; Submission of new and revised data. Sequence Similarity Searches Sequence homology as product of molecular evolution; Sequence similarity searches; Significance of sequence alignment; Sequence alignment global, local and freespace; Alignment scores and gap penalties; Measurement of sequence similarity; Similarity and homology. Text Books : 1. Mount, D. (2004) Bioinformatics: Sequence and Genome Analysis ; Cold Spring Harbor Laboratory Press, New York. (ISBN ) 2. Baxevanis, A.D. and Francis Ouellellette, B.F. (1998) Bioinformatics a practical guide to the analysis of Genes and Proteins ; John Wiley and Sons, New Jersey, USA. 3. Pevzner, P.A. (2004) Computational Molecular Biology ; Prentice Hall of India Ltd, New Delhi.

3 PGD BINF 302 Genome and Protein Sequence Analysis Sequence Analysis: Basic concepts of sequence similarity, identity and homology, definitions of homologues, orthologues, paralogues and xenologues Scoring matrices: basic concept of a scoring matrix, Matrices for nucleic acid and proteins sequences, PAM and BLOSUM series, matrix derivation methods and principles. Database Searches: Keyword-based Entrez and SRS; Sequence-based: BLAST & FASTA; Use of these methods for sequence analysis including the on-line use of the tools and interpretation of results from various sequence and structural as well as bibliographic databases Sequence alignment : Basic concepts of sequence alignment, Needleman and Wunsch, Smith and Waterman algorithms for pairwise alignments, use of pairwise alignments for analysis of nucleic acid and protein sequences and interpretation of results, basic concepts of various approaches for multiple sequence alignment (e.g. progressive, iterative). Algorithm of CLUSTALW and PileUp and their applications for sequence analysis Sequence patterns and profiles: Basic concept and definition of sequence patterns, motifs and profiles, various types of pattern representations viz. consensus, regular expression (Prosite-type) and sequence profiles; profile-based database searches using PSI-BLAST, analysis and interpretation of profile-based searches. Tools for searching sequence patterns: MeMe, PHI-BLAST, SCanProsite and PRATT. V Comparative Genomics: Basic concepts, Applications of Comparative Genomics: Identification of Gene, Regulatory regions, Virulence factors/ Pathogenecity Islands, Reconstruction of metabolic networks. Genome Analysis Tools: Artemis, BLAST2, MegaBLAST, GenePlot. Comparative genomics databases: KEGG, DEG, COG. Phylogeny: Terminology, Steps in Phylogenetic analysis, Different tree construction methods: Distance based methods- Neighbor Joining, UPGMA and Fitch Margoliash; Character-based methods- Maximum Parsimony and Maximum Likelihood. Phylogenetic programs: Phylip, Mega, PAUP, Phylodraw. Text Books: 1. Mount, D. (2004) Bioinformatics: Sequence and Genome Analysis ; Cold Spring Harbor Laboratory Press, New York. 2. Baxevanis, A.D. and Francis Ouellellette, B.F. (1998) Bioinformatics a practical guide to the analysis of Genes and Proteins ; John Wiley & Sons, UK. Reference Books 1. Pevzner, P.A. (2004) Computational Molecular Biology ; Prentice Hall of India Ltd, New Delhi. 2. Lesk, A.M. (2002) Introduction to Bioinformatics, First edition, Oxford University Press, UK. 3. Sensen, C.W. (2002) Essentials of Genomics and Bioinformatics ; Wiley-VCH Publishers, USA.

4 PGD BINF 303 Proteomics and Genomics Genomics and Metagenomics: Large scale genome sequencing strategies. Genome assembly and annotation. Genome databases of Plants, animals and pathogens. Metagenomics: Gene networks: basic concepts, computational model such as Lambda receptor and lac operon. Prediction of genes, promoters, splice sites, regulatory regions: basic principles, application of methods to prokaryotic and eukaryotic genomes and interpretation of results. Basic concepts on identification of disease genes, role of bioinformatics-omim database, reference genome sequence, integrated genomic maps, gene expression profiling; identification of SNPs, SNP database (DbSNP). Role of SNP in Pharmacogenomics, SNP arrays. Basic concepts in identification of Drought stress response genes, insect resistant genes, nutrition enhancing genes Epigenetics: DNA microarray: database and basic tools, Gene Expression Omnibus (GEO), ArrayExpress, SAGE databases DNA microarray: understanding of microarray data, normalizing microarray data, detecting differential gene expression, correlation of gene expression data to biological process and computational analysis tools (especially clustering approaches) Comparative genomics: Basic concepts and applications, whole genome alignments: understanding the significance; Artemis, BLAST2, MegaBlast algorithms, PipMaker, AVID, Vista, MUMmer, applications of suffix tree in comparative genomics, synteny and gene order comparisons Comparative genomics databases: COG, VOG V Functional genomics: Application of sequence based and structure-based approaches to assignment of gene functions e.g. sequence comparison, structure analysis (especially active sites, binding sites) and comparison, pattern identification, etc. Use of various derived databases in function assignment, use of SNPs for identification of genetic traits. Gene/Protein function prediction using Machine learning tools viz. Neural network, SVM etc Proteomics: Protein arrays: basic principles. Computational methods for identification of polypeptides from mass spectrometry. Protein arrays: bioinformatics-based tools for analysis of proteomics data (Tools available at ExPASy Proteomics server); databases (such as InterPro) and analysis tools. Proteinprotein interactions: databases such as DIP, PPI server and tools for analysis of protein-protein interactions Text Books: 1. Discovering Genomics, Proteomics and Bioinformatics 2nd edition - by A. Malcolm Campbell and Laurie J. Heyer. by Cold Spring Harbor Laboratory Press 2006.

5 Exercises: PGD BINF 304 Lab : Bioinformatics Databases 1. Entrez and Literature Searches. 2. Sequence Retrieval System of Biological Databases 3. File format conversion 4. Sequence Analysis 5. Phylogenetic analysis using PHYLIP, Phylodraw, PAUP, Treeview, JalView. 6. Usage of Softwares: a. BioEdit b. GeneDoc c. ClustalW / X, MEGA, MEME 7. Usage of Visualization Tool a. RasMol b. Cn3D c. MolMol

6 PGD BINF 305 Lab : Sequence Analysis Exercises: 1. Sequence Analysis Packages EMBOSS, NCBI ToolKit 2. Dynamic programming. 3. Analysis of Biological Sequences. 4. FASTA 5. Multiple sequence alignment 6. MEME/MAST, emotif, InterproScan, ProSite, ProDom, Pfam 7. Phylogenetic analysis PAUP, PHYLIP, MacClade, MEGA 8. Genome annotation Artemis. 9. Hypothetical Protein analysis 10. Genome Comparison

7 PGD BINF 401 SYSTEMS BIOLOGY Systems Biology - Objectives of Systems Biology, Strategies relating to In silico Modeling of biological processes, Metabolic Networks, Signal Transduction Pathways, E-cell and V-cell. Reconstruction of pathways and annotation Reconstructing metabolic pathways from sequence and function information in microbial species; statistical profiling and function annotation of genomes with a microbial genome as an example. Profile analysis Expression profile analysis of cells, Microarray and genome wide expression analysis, Genomics and Proteomics in medicine, Connectivity maps, high throughput sequencing and assembly, SNPs and their applications. V Databases for Systems Biology Genome databases (NCBI Entrez Genome databases, Ensembl), Metabolic pathways databases (KEGG, EMP, EcoCyc, MetaCyc) and Expression databases (Gene Expression Omnibus and ArrayExpress). Biological simulation and network - Constrained based modeling (Flux balance analysis): Stoichiometric matrix, Linear optimization, Elementary flux modes, Extreme pathways. Biological network: scale-free network, Properties of a network (Nodes, edges, hubs, clustering coefficient and diameter). Text Book: 1. Alon, U. (2006) An Introduction to Systems Biology. Chapman & Hall/CRC 2. M.E.J. Newman (2010) Networks: An Introduction. Oxford University Press. Reference Books: 1. Wilkins, M.R., Wiliams, K.L., Appel, R.D. and Hochstrasser, D.F. (1997) Proteome Research: New frontiers in Functional Genomics, Springer Verlag, New York, USA. 2. Witten, I.H. and Frank, E. (2005) Data mining: Practical Machine Learning Tools and Techniques, Morgan Kauffman Publishers, USA.

8 PGD BINF 402 Structural Biology Basic structural features of macro molecules like proteins, nucleic acids and carbohydrates; concepts of secondary structures of proteins helix, sheet; motifs, domains, tertiary and quaternary structures; Structure validation - Ramachandran Plot Introduction to Experimental Methods: X-ray Diffraction, NMR, Electron microscopy. Database of experimental structures (PDB, NDB). Intermolecular interactions Hydrogen bonding, van Der walls forces, hydrophobic and hydrophilic factors, ionic interactions; introduction to membrane proteins. Structures of DNA; A, B, and Z-DNA, DNA bending. Structure of RNA. Structure of Ribosome. V Methods for prediction of secondary and tertiary structures of proteins knowledge-based structure prediction; fold recognition; ab initio methods for structure prediction, Comparative protein modeling Methods for comparison of 3D structures of proteins; Methods to predict three dimensional structures of nucleic acids, rrna; Electrostatic energy surface generation. Text Books : 1. Andrew R. Leach (2001) Molecular Modeling Principles and Applications ; Second Edition, Prentice Hall, USA. 2. George H Stout, and Lyle H Jensen (1989) X-ray Structure Determination : A Practical Guide ; Second Edition. Wiley-Interscience Publication. 3. Creighton, T.E. (1993) Proteins: structure and molecular properties ; Second edition, W.H. Freeman and Company, New York, USA. Reference Books : 1. Mount, D. (2004) Bioinformatics: Sequence and Genome Analysis ; Cold Spring Harbor Laboratory Press, New York. 2. Lesk, A.M. (2001) Introduction to Protein Architecture, Oxford University Press, UK. 3. Mcpherson, A. (2003) Introduction of Molecular Crystallography, John Wiley Publications, USA.

9 PGD BINF 403 Computer Aided Drug Design Introduction to Drugs: How drugs work - Drug targets, drug-target interaction and dose-response relationships; ADME & Bioavailability of drugs drug-drug interaction & drug toxicity. New Drug Discovery & Development: Lead Discovery Drug likeness concept & Lipinski s rule of 5 - Preclinical & Clinical Testing of New Drugs - New Drug Approval. CADD: Introduction, Computer hardware and software for CADD. Molecular Mechanics: Introduction of molecular mechanics. Coordinate System; molecular graphics & potential energy surfaces. force fields and their component; Bonded and non-bonded interactions importance of hydrogen bonding; Energy minimization algorithms. Molecular Dynamics Simulation Methods Molecular Dynamics using simple models; Molecular Dynamics with continuous potentials and at constant temperature and pressure; Time-dependent properties; Solvent effects in Molecular Dynamics; Conformational changes from Molecular Dynamics simulation. V Analog based drug design: QSAR and QSPR Methodology for drug design - Various Descriptors used in QSAR studies - deriving & validating QSAR equations 3D QSAR application in drug design and ADME prediction. 3D Pharamcophore development: Conformation generation - deriving and using 3D Pharmacophores;. Structure based drug design: Molecular Docking: Docking approaches - Search algorithm - Scoring function; de novo ligand design - Linking & growing methods - applications; and Virtual screening - data base searching to identify leads. Text Books: 1. Molecular Modeling Principles and Applications by Andrew R. Leach Second Edition, Prentice Hall, USA, Computational Drug Design: A guide for Computational & Medicinal Chemists by David C Young, John Wiley & Sons, Inc Reference Books 1. The organic chemistry of drug design and drug action by Richard B. Silverman, Elesevier, Molecular Modeling: Basic Principles and Applications, by Hans-Dieter Höltje, Wolfgang Sippl, Didier Rognan, 3rd Edition, Wiley-vch Verlag Gmbh, Burger s Medicinal Chemistry and Drug discovery. Volume 2, Drug Discovery and development. 6 th Edition. by Andre I. Khuri, Donald J. Abraham, Alfred Burger, Wiley-Interscience, 2003.

10 PGD BINF 404 Lab : Structural Biology Exercises 1. Advanced Visualization Software and 3D representations. 2. Coordinate generations and inter-conversions. 3. Secondary Structure Prediction 4. Fold Recognition, ab initio (Rosetta Server) 5. Homology based comparative protein modeling. 6. Energy minimizations. 7. Validation of models. a. WHATIF b. PROSA c. PROCHECK d. VERIFY 3D 8. Protein Structure Alignment. 9. Modeller 10. Geno-3D 11. Discovery Studio Server.

11 PGD BINF 405 Lab : Computer Aided Drug Design Exercises Molecular modeling: Viewers, generating conformations, file format conversion, databases Molecular mechanics: Structural characterization Molecular Dynamics: Simulation of small systems and conformational analysis Docking and Drug Design: QSAR analysis & Docking

BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS

BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS NEW YORK CITY COLLEGE OF TECHNOLOGY The City University Of New York School of Arts and Sciences Biological Sciences Department Course title:

More information

Linear Sequence Analysis. 3-D Structure Analysis

Linear Sequence Analysis. 3-D Structure Analysis Linear Sequence Analysis What can you learn from a (single) protein sequence? Calculate it s physical properties Molecular weight (MW), isoelectric point (pi), amino acid content, hydropathy (hydrophilic

More information

Syllabus of B.Sc. (Bioinformatics) Subject- Bioinformatics (as one subject) B.Sc. I Year Semester I Paper I: Basic of Bioinformatics 85 marks

Syllabus of B.Sc. (Bioinformatics) Subject- Bioinformatics (as one subject) B.Sc. I Year Semester I Paper I: Basic of Bioinformatics 85 marks Syllabus of B.Sc. (Bioinformatics) Subject- Bioinformatics (as one subject) B.Sc. I Year Semester I Paper I: Basic of Bioinformatics 85 marks Semester II Paper II: Mathematics I 85 marks B.Sc. II Year

More information

A Primer of Genome Science THIRD

A Primer of Genome Science THIRD A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:

More information

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the

More information

Core Bioinformatics. Degree Type Year Semester. 4313473 Bioinformàtica/Bioinformatics OB 0 1

Core Bioinformatics. Degree Type Year Semester. 4313473 Bioinformàtica/Bioinformatics OB 0 1 Core Bioinformatics 2014/2015 Code: 42397 ECTS Credits: 12 Degree Type Year Semester 4313473 Bioinformàtica/Bioinformatics OB 0 1 Contact Name: Sònia Casillas Viladerrams Email: [email protected]

More information

BIOINF 525 Winter 2016 Foundations of Bioinformatics and Systems Biology http://tinyurl.com/bioinf525-w16

BIOINF 525 Winter 2016 Foundations of Bioinformatics and Systems Biology http://tinyurl.com/bioinf525-w16 Course Director: Dr. Barry Grant (DCM&B, [email protected]) Description: This is a three module course covering (1) Foundations of Bioinformatics, (2) Statistics in Bioinformatics, and (3) Systems

More information

Bio-Informatics Lectures. A Short Introduction

Bio-Informatics Lectures. A Short Introduction Bio-Informatics Lectures A Short Introduction The History of Bioinformatics Sanger Sequencing PCR in presence of fluorescent, chain-terminating dideoxynucleotides Massively Parallel Sequencing Massively

More information

A Multiple DNA Sequence Translation Tool Incorporating Web Robot and Intelligent Recommendation Techniques

A Multiple DNA Sequence Translation Tool Incorporating Web Robot and Intelligent Recommendation Techniques Proceedings of the 2007 WSEAS International Conference on Computer Engineering and Applications, Gold Coast, Australia, January 17-19, 2007 402 A Multiple DNA Sequence Translation Tool Incorporating Web

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources 1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools

More information

Distributed Data Mining in Discovery Net. Dr. Moustafa Ghanem Department of Computing Imperial College London

Distributed Data Mining in Discovery Net. Dr. Moustafa Ghanem Department of Computing Imperial College London Distributed Data Mining in Discovery Net Dr. Moustafa Ghanem Department of Computing Imperial College London 1. What is Discovery Net 2. Distributed Data Mining for Compute Intensive Tasks 3. Distributed

More information

Integrating Bioinformatics, Medical Sciences and Drug Discovery

Integrating Bioinformatics, Medical Sciences and Drug Discovery Integrating Bioinformatics, Medical Sciences and Drug Discovery M. Madan Babu Centre for Biotechnology, Anna University, Chennai - 600025 phone: 44-4332179 :: email: [email protected] Bioinformatics

More information

Vad är bioinformatik och varför behöver vi det i vården? a bioinformatician's perspectives

Vad är bioinformatik och varför behöver vi det i vården? a bioinformatician's perspectives Vad är bioinformatik och varför behöver vi det i vården? a bioinformatician's perspectives [email protected] 2015-05-21 Functional Bioinformatics, Örebro University Vad är bioinformatik och varför

More information

Bioinformatics Grid - Enabled Tools For Biologists.

Bioinformatics Grid - Enabled Tools For Biologists. Bioinformatics Grid - Enabled Tools For Biologists. What is Grid-Enabled Tools (GET)? As number of data from the genomics and proteomics experiment increases. Problems arise for the current sequence analysis

More information

Bioinformatics: course introduction

Bioinformatics: course introduction Bioinformatics: course introduction Filip Železný Czech Technical University in Prague Faculty of Electrical Engineering Department of Cybernetics Intelligent Data Analysis lab http://ida.felk.cvut.cz

More information

Bioinformatics for Biologists. Protein Structure

Bioinformatics for Biologists. Protein Structure Bioinformatics for Biologists Comparative Protein Analysis: Part III. Protein Structure Prediction and Comparison Robert Latek, PhD Sr. Bioinformatics Scientist Whitehead Institute for Biomedical Research

More information

Guide for Bioinformatics Project Module 3

Guide for Bioinformatics Project Module 3 Structure- Based Evidence and Multiple Sequence Alignment In this module we will revisit some topics we started to look at while performing our BLAST search and looking at the CDD database in the first

More information

Structure and Function of DNA

Structure and Function of DNA Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four

More information

Molecular Databases and Tools

Molecular Databases and Tools NWeHealth, The University of Manchester Molecular Databases and Tools Afternoon Session: NCBI/EBI resources, pairwise alignment, BLAST, multiple sequence alignment and primer finding. Dr. Georgina Moulton

More information

REGULATIONS FOR THE DEGREE OF BACHELOR OF SCIENCE IN BIOINFORMATICS (BSc[BioInf])

REGULATIONS FOR THE DEGREE OF BACHELOR OF SCIENCE IN BIOINFORMATICS (BSc[BioInf]) 820 REGULATIONS FOR THE DEGREE OF BACHELOR OF SCIENCE IN BIOINFORMATICS (BSc[BioInf]) (See also General Regulations) BMS1 Admission to the Degree To be eligible for admission to the degree of Bachelor

More information

Biological Databases and Protein Sequence Analysis

Biological Databases and Protein Sequence Analysis Biological Databases and Protein Sequence Analysis Introduction M. Madan Babu, Center for Biotechnology, Anna University, Chennai 25, India Bioinformatics is the application of Information technology to

More information

Teaching Bioinformatics to Undergraduates

Teaching Bioinformatics to Undergraduates Teaching Bioinformatics to Undergraduates http://www.med.nyu.edu/rcr/asm Stuart M. Brown Research Computing, NYU School of Medicine I. What is Bioinformatics? II. Challenges of teaching bioinformatics

More information

M.Sc. BIOINFORMATICS

M.Sc. BIOINFORMATICS M.Sc. BIOINFORMATICS REGULATIONS AND SYLLABI (Effective from 2011-2012) Centre for Bioinformatics SCHOOL OF LIFE SCIENCES PONDICHERRY UNIVERSITY PUDUCHERRY 1 Eligibility for M. Sc. Bioinformatics Students

More information

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins

More information

Module 1. Sequence Formats and Retrieval. Charles Steward

Module 1. Sequence Formats and Retrieval. Charles Steward The Open Door Workshop Module 1 Sequence Formats and Retrieval Charles Steward 1 Aims Acquaint you with different file formats and associated annotations. Introduce different nucleotide and protein databases.

More information

Protein Protein Interaction Networks

Protein Protein Interaction Networks Functional Pattern Mining from Genome Scale Protein Protein Interaction Networks Young-Rae Cho, Ph.D. Assistant Professor Department of Computer Science Baylor University it My Definition of Bioinformatics

More information

Using MATLAB: Bioinformatics Toolbox for Life Sciences

Using MATLAB: Bioinformatics Toolbox for Life Sciences Using MATLAB: Bioinformatics Toolbox for Life Sciences MR. SARAWUT WONGPHAYAK BIOINFORMATICS PROGRAM, SCHOOL OF BIORESOURCES AND TECHNOLOGY, AND SCHOOL OF INFORMATION TECHNOLOGY, KING MONGKUT S UNIVERSITY

More information

PROC. CAIRO INTERNATIONAL BIOMEDICAL ENGINEERING CONFERENCE 2006 1. E-mail: [email protected]

PROC. CAIRO INTERNATIONAL BIOMEDICAL ENGINEERING CONFERENCE 2006 1. E-mail: msm_eng@k-space.org BIOINFTool: Bioinformatics and sequence data analysis in molecular biology using Matlab Mai S. Mabrouk 1, Marwa Hamdy 2, Marwa Mamdouh 2, Marwa Aboelfotoh 2,Yasser M. Kadah 2 1 Biomedical Engineering Department,

More information

200630 - FBIO - Fundations of Bioinformatics

200630 - FBIO - Fundations of Bioinformatics Coordinating unit: Teaching unit: Academic year: Degree: ECTS credits: 2015 200 - FME - School of Mathematics and Statistics 1004 - UB - (ENG)Universitat de Barcelona MASTER'S DEGREE IN STATISTICS AND

More information

UGENE Quick Start Guide

UGENE Quick Start Guide Quick Start Guide This document contains a quick introduction to UGENE. For more detailed information, you can find the UGENE User Manual and other special manuals in project website: http://ugene.unipro.ru.

More information

FACULTY OF MEDICAL SCIENCE

FACULTY OF MEDICAL SCIENCE Doctor of Philosophy in Biochemistry FACULTY OF MEDICAL SCIENCE Naresuan University 73 Doctor of Philosophy in Biochemistry The Biochemistry Department at Naresuan University is a leader in lower northern

More information

Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources

Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources Appendix 2 Molecular Biology Core Curriculum Websites and Other Resources Chapter 1 - The Molecular Basis of Cancer 1. Inside Cancer http://www.insidecancer.org/ From the Dolan DNA Learning Center Cold

More information

EMBL-EBI Web Services

EMBL-EBI Web Services EMBL-EBI Web Services Rodrigo Lopez Head of the External Services Team SME Workshop Piemonte 2011 EBI is an Outstation of the European Molecular Biology Laboratory. Summary Introduction The JDispatcher

More information

Structure Tools and Visualization

Structure Tools and Visualization Structure Tools and Visualization Gary Van Domselaar University of Alberta [email protected] Slides Adapted from Michel Dumontier, Blueprint Initiative 1 Visualization & Communication Visualization

More information

Core Bioinformatics. Degree Type Year Semester

Core Bioinformatics. Degree Type Year Semester Core Bioinformatics 2015/2016 Code: 42397 ECTS Credits: 12 Degree Type Year Semester 4313473 Bioinformatics OB 0 1 Contact Name: Sònia Casillas Viladerrams Email: [email protected] Teachers Use of

More information

Protein & DNA Sequence Analysis. Bobbie-Jo Webb-Robertson May 3, 2004

Protein & DNA Sequence Analysis. Bobbie-Jo Webb-Robertson May 3, 2004 Protein & DNA Sequence Analysis Bobbie-Jo Webb-Robertson May 3, 2004 Sequence Analysis Anything connected to identifying higher biological meaning out of raw sequence data. 2 Genomic & Proteomic Data Sequence

More information

Sequence Formats and Sequence Database Searches. Gloria Rendon SC11 Education June, 2011

Sequence Formats and Sequence Database Searches. Gloria Rendon SC11 Education June, 2011 Sequence Formats and Sequence Database Searches Gloria Rendon SC11 Education June, 2011 Sequence A is the primary structure of a biological molecule. It is a chain of residues that form a precise linear

More information

BIO 3352: BIOINFORMATICS II HYBRID COURSE SYLLABUS

BIO 3352: BIOINFORMATICS II HYBRID COURSE SYLLABUS BIO 3352: BIOINFORMATICS II HYBRID COURSE SYLLABUS NEW YORK CITY COLLEGE OF TECHNOLOGY The City University Of New York School of Arts and Sciences Biological Sciences Department Course title: Bioinformatics

More information

Introduction to Genome Annotation

Introduction to Genome Annotation Introduction to Genome Annotation AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT

More information

Sequence Information. Sequence information. Good web sites. Sequence information. Sequence. Sequence

Sequence Information. Sequence information. Good web sites. Sequence information. Sequence. Sequence Sequence information Multiple Pair-wise SRS Entrez Comparisons Database searches Sequence Information Orthologue clusters Sequence Organell localisation Patterns Protein families Membrane attachment Bengt

More information

Basic Concepts of DNA, Proteins, Genes and Genomes

Basic Concepts of DNA, Proteins, Genes and Genomes Basic Concepts of DNA, Proteins, Genes and Genomes Kun-Mao Chao 1,2,3 1 Graduate Institute of Biomedical Electronics and Bioinformatics 2 Department of Computer Science and Information Engineering 3 Graduate

More information

Lecture 19: Proteins, Primary Struture

Lecture 19: Proteins, Primary Struture CPS260/BGT204.1 Algorithms in Computational Biology November 04, 2003 Lecture 19: Proteins, Primary Struture Lecturer: Pankaj K. Agarwal Scribe: Qiuhua Liu 19.1 The Building Blocks of Protein [1] Proteins

More information

Pairwise Sequence Alignment

Pairwise Sequence Alignment Pairwise Sequence Alignment [email protected] SS 2013 Outline Pairwise sequence alignment global - Needleman Wunsch Gotoh algorithm local - Smith Waterman algorithm BLAST - heuristics What

More information

AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE

AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE ACCELERATING PROGRESS IS IN OUR GENES AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE GENESPRING GENE EXPRESSION (GX) MASS PROFILER PROFESSIONAL (MPP) PATHWAY ARCHITECT (PA) See Deeper. Reach Further. BIOINFORMATICS

More information

NO CALCULATORS OR CELL PHONES ALLOWED

NO CALCULATORS OR CELL PHONES ALLOWED Biol 205 Exam 1 TEST FORM A Spring 2008 NAME Fill out both sides of the Scantron Sheet. On Side 2 be sure to indicate that you have TEST FORM A The answers to Part I should be placed on the SCANTRON SHEET.

More information

Network Protocol Analysis using Bioinformatics Algorithms

Network Protocol Analysis using Bioinformatics Algorithms Network Protocol Analysis using Bioinformatics Algorithms Marshall A. Beddoe [email protected] ABSTRACT Network protocol analysis is currently performed by hand using only intuition and a protocol

More information

Carbohydrates, proteins and lipids

Carbohydrates, proteins and lipids Carbohydrates, proteins and lipids Chapter 3 MACROMOLECULES Macromolecules: polymers with molecular weights >1,000 Functional groups THE FOUR MACROMOLECULES IN LIFE Molecules in living organisms: proteins,

More information

APPLICATION OF DATA MINING IN BIOINFORMATICS

APPLICATION OF DATA MINING IN BIOINFORMATICS APPLICATION OF DATA MINING IN BIOINFORMATICS KHALID RAZA Centre for Theoretical Physics, Jamia Millia Islamia, New Delhi-110025, India Abstract This article highlights some of the basic concepts of bioinformatics

More information

An Introduction to Genomics and SAS Scientific Discovery Solutions

An Introduction to Genomics and SAS Scientific Discovery Solutions An Introduction to Genomics and SAS Scientific Discovery Solutions Dr Karen M Miller Product Manager Bioinformatics SAS EMEA 16.06.03 Copyright 2003, SAS Institute Inc. All rights reserved. 1 Overview!

More information

Similarity Searches on Sequence Databases: BLAST, FASTA. Lorenza Bordoli Swiss Institute of Bioinformatics EMBnet Course, Basel, October 2003

Similarity Searches on Sequence Databases: BLAST, FASTA. Lorenza Bordoli Swiss Institute of Bioinformatics EMBnet Course, Basel, October 2003 Similarity Searches on Sequence Databases: BLAST, FASTA Lorenza Bordoli Swiss Institute of Bioinformatics EMBnet Course, Basel, October 2003 Outline Importance of Similarity Heuristic Sequence Alignment:

More information

Current Motif Discovery Tools and their Limitations

Current Motif Discovery Tools and their Limitations Current Motif Discovery Tools and their Limitations Philipp Bucher SIB / CIG Workshop 3 October 2006 Trendy Concepts and Hypotheses Transcription regulatory elements act in a context-dependent manner.

More information

Introduction to Bioinformatics AS 250.265 Laboratory Assignment 6

Introduction to Bioinformatics AS 250.265 Laboratory Assignment 6 Introduction to Bioinformatics AS 250.265 Laboratory Assignment 6 In the last lab, you learned how to perform basic multiple sequence alignments. While useful in themselves for determining conserved residues

More information

BBSRC TECHNOLOGY STRATEGY: TECHNOLOGIES NEEDED BY RESEARCH KNOWLEDGE PROVIDERS

BBSRC TECHNOLOGY STRATEGY: TECHNOLOGIES NEEDED BY RESEARCH KNOWLEDGE PROVIDERS BBSRC TECHNOLOGY STRATEGY: TECHNOLOGIES NEEDED BY RESEARCH KNOWLEDGE PROVIDERS 1. The Technology Strategy sets out six areas where technological developments are required to push the frontiers of knowledge

More information

BIOINFORMATICS TUTORIAL

BIOINFORMATICS TUTORIAL Bio 242 BIOINFORMATICS TUTORIAL Bio 242 α Amylase Lab Sequence Sequence Searches: BLAST Sequence Alignment: Clustal Omega 3d Structure & 3d Alignments DO NOT REMOVE FROM LAB. DO NOT WRITE IN THIS DOCUMENT.

More information

Genome Explorer For Comparative Genome Analysis

Genome Explorer For Comparative Genome Analysis Genome Explorer For Comparative Genome Analysis Jenn Conn 1, Jo L. Dicks 1 and Ian N. Roberts 2 Abstract Genome Explorer brings together the tools required to build and compare phylogenies from both sequence

More information

Algorithms in Computational Biology (236522) spring 2007 Lecture #1

Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office

More information

A disaccharide is formed when a dehydration reaction joins two monosaccharides. This covalent bond is called a glycosidic linkage.

A disaccharide is formed when a dehydration reaction joins two monosaccharides. This covalent bond is called a glycosidic linkage. CH 5 Structure & Function of Large Molecules: Macromolecules Molecules of Life All living things are made up of four classes of large biological molecules: carbohydrates, lipids, proteins, and nucleic

More information

Biochemistry. Entrance Requirements. Requirements for Honours Programs. 148 Bishop s University 2015/2016

Biochemistry. Entrance Requirements. Requirements for Honours Programs. 148 Bishop s University 2015/2016 148 Bishop s University 2015/2016 Biochemistry The Biochemistry program at Bishop s is coordinated through an interdisciplinary committee of chemists, biochemists and biologists, providing students with

More information

DnaSP, DNA polymorphism analyses by the coalescent and other methods.

DnaSP, DNA polymorphism analyses by the coalescent and other methods. DnaSP, DNA polymorphism analyses by the coalescent and other methods. Author affiliation: Julio Rozas 1, *, Juan C. Sánchez-DelBarrio 2,3, Xavier Messeguer 2 and Ricardo Rozas 1 1 Departament de Genètica,

More information

AP BIOLOGY 2008 SCORING GUIDELINES

AP BIOLOGY 2008 SCORING GUIDELINES AP BIOLOGY 2008 SCORING GUIDELINES Question 1 1. The physical structure of a protein often reflects and affects its function. (a) Describe THREE types of chemical bonds/interactions found in proteins.

More information

Phylogenetic Trees Made Easy

Phylogenetic Trees Made Easy Phylogenetic Trees Made Easy A How-To Manual Fourth Edition Barry G. Hall University of Rochester, Emeritus and Bellingham Research Institute Sinauer Associates, Inc. Publishers Sunderland, Massachusetts

More information

Introduction to Bioinformatics 2. DNA Sequence Retrieval and comparison

Introduction to Bioinformatics 2. DNA Sequence Retrieval and comparison Introduction to Bioinformatics 2. DNA Sequence Retrieval and comparison Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 [email protected]

More information

Lecture 11 Data storage and LIMS solutions. Stéphane LE CROM [email protected]

Lecture 11 Data storage and LIMS solutions. Stéphane LE CROM lecrom@biologie.ens.fr Lecture 11 Data storage and LIMS solutions Stéphane LE CROM [email protected] Various steps of a DNA microarray experiment Experimental steps Data analysis Experimental design set up Chips on catalog

More information

CSC 2427: Algorithms for Molecular Biology Spring 2006. Lecture 16 March 10

CSC 2427: Algorithms for Molecular Biology Spring 2006. Lecture 16 March 10 CSC 2427: Algorithms for Molecular Biology Spring 2006 Lecture 16 March 10 Lecturer: Michael Brudno Scribe: Jim Huang 16.1 Overview of proteins Proteins are long chains of amino acids (AA) which are produced

More information

Pipeline Pilot Enterprise Server. Flexible Integration of Disparate Data and Applications. Capture and Deployment of Best Practices

Pipeline Pilot Enterprise Server. Flexible Integration of Disparate Data and Applications. Capture and Deployment of Best Practices overview Pipeline Pilot Enterprise Server Pipeline Pilot Enterprise Server (PPES) is a powerful client-server platform that streamlines the integration and analysis of the vast quantities of data flooding

More information

Course Outline. 1. COURSE INFORMATION Session Offered Winter 2012 Course Name Biochemistry

Course Outline. 1. COURSE INFORMATION Session Offered Winter 2012 Course Name Biochemistry Course Outline 1. COURSE INFORMATION Session Offered Winter 2012 Course Name Biochemistry Course Code BIOTECH 2BC3 Program Name Biotechnology Calendar Description Biochemistry and biotechnology; amino

More information

Activity 7.21 Transcription factors

Activity 7.21 Transcription factors Purpose To consolidate understanding of protein synthesis. To explain the role of transcription factors and hormones in switching genes on and off. Play the transcription initiation complex game Regulation

More information

Papers listed: Cell2. This weeks papers. Chapt 4. Protein structure and function

Papers listed: Cell2. This weeks papers. Chapt 4. Protein structure and function Papers listed: Cell2 During the semester I will speak of information from several papers. For many of them you will not be required to read these papers, however, you can do so for the fun of it (and it

More information

Dr Alexander Henzing

Dr Alexander Henzing Horizon 2020 Health, Demographic Change & Wellbeing EU funding, research and collaboration opportunities for 2016/17 Innovate UK funding opportunities in omics, bridging health and life sciences Dr Alexander

More information

582606 Introduction to bioinformatics

582606 Introduction to bioinformatics 582606 Introduction to bioinformatics Autumn 2007 Esa Pitkänen Master's Degree Programme in Bioinformatics (MBI) Department of Computer Science, University of Helsinki http://www.cs.helsinki.fi/mbi/courses/07-08/itb/

More information

Using Ontologies in Proteus for Modeling Data Mining Analysis of Proteomics Experiments

Using Ontologies in Proteus for Modeling Data Mining Analysis of Proteomics Experiments Using Ontologies in Proteus for Modeling Data Mining Analysis of Proteomics Experiments Mario Cannataro, Pietro Hiram Guzzi, Tommaso Mazza, and Pierangelo Veltri University Magna Græcia of Catanzaro, 88100

More information

Data Integration. Lectures 16 & 17. ECS289A, WQ03, Filkov

Data Integration. Lectures 16 & 17. ECS289A, WQ03, Filkov Data Integration Lectures 16 & 17 Lectures Outline Goals for Data Integration Homogeneous data integration time series data (Filkov et al. 2002) Heterogeneous data integration microarray + sequence microarray

More information

THE UNIVERSITY OF MANCHESTER Unit Specification

THE UNIVERSITY OF MANCHESTER Unit Specification 1. GENERAL INFORMATION Title Unit code Credit rating 15 Level 7 Contact hours 30 Other Scheduled teaching and learning activities* Pre-requisite units Co-requisite units School responsible Member of staff

More information

CHEM 451 BIOCHEMISTRY I. SUNY Cortland Fall 2010

CHEM 451 BIOCHEMISTRY I. SUNY Cortland Fall 2010 CHEM 451 BIOCHEMISTRY I SUNY Cortland Fall 2010 Instructor: Dr. Frank Rossi Office: Bowers 135 Office Hours: Mon. 2:30-4:00, Wed. 4:00-5:30, Friday 2:30-3:00, or by appointment. Extra evening office hours

More information

Healthcare Analytics. Aryya Gangopadhyay UMBC

Healthcare Analytics. Aryya Gangopadhyay UMBC Healthcare Analytics Aryya Gangopadhyay UMBC Two of many projects Integrated network approach to personalized medicine Multidimensional and multimodal Dynamic Analyze interactions HealthMask Need for sharing

More information

Chapter 3. Protein Structure and Function

Chapter 3. Protein Structure and Function Chapter 3 Protein Structure and Function Broad functional classes So Proteins have structure and function... Fine! -Why do we care to know more???? Understanding functional architechture gives us POWER

More information

Kinexus has an in-house inventory of lysates prepared from 16 human cancer cell lines that have been selected to represent a diversity of tissues,

Kinexus has an in-house inventory of lysates prepared from 16 human cancer cell lines that have been selected to represent a diversity of tissues, Kinexus Bioinformatics Corporation is seeking to map and monitor the molecular communications networks of living cells for biomedical research into the diagnosis, prognosis and treatment of human diseases.

More information

Review. Bioinformatics - a definition 1. As submitted to the Oxford English Dictionary

Review. Bioinformatics - a definition 1. As submitted to the Oxford English Dictionary N.M. Luscombe, D. Greenbaum, M. Gerstein Department of Molecular Biophysics and Biochemistry Yale University New Haven, USA Review What is bioinformatics? An introduction and overview Abstract: A flood

More information

Software review. Vector NTI, a balanced all-in-one sequence analysis suite

Software review. Vector NTI, a balanced all-in-one sequence analysis suite Vector NTI, a balanced all-in-one sequence analysis suite Keywords: sequence analysis, software package, database, virtual cloning, sequence assembly Abstract Vector NTI is a well-balanced desktop application

More information

Global and Discovery Proteomics Lecture Agenda

Global and Discovery Proteomics Lecture Agenda Global and Discovery Proteomics Christine A. Jelinek, Ph.D. Johns Hopkins University School of Medicine Department of Pharmacology and Molecular Sciences Middle Atlantic Mass Spectrometry Laboratory Global

More information

BLAST. Anders Gorm Pedersen & Rasmus Wernersson

BLAST. Anders Gorm Pedersen & Rasmus Wernersson BLAST Anders Gorm Pedersen & Rasmus Wernersson Database searching Using pairwise alignments to search databases for similar sequences Query sequence Database Database searching Most common use of pairwise

More information

Insilico drug designing. Dinesh Gupta Structural and Computational Biology Group ICGEB

Insilico drug designing. Dinesh Gupta Structural and Computational Biology Group ICGEB Insilico drug designing Dinesh Gupta Structural and Computational Biology Group ICGEB Modern drug discovery process Target identification Target validation Lead identification Lead optimization Preclinical

More information

Biological Sciences Initiative. Human Genome

Biological Sciences Initiative. Human Genome Biological Sciences Initiative HHMI Human Genome Introduction In 2000, researchers from around the world published a draft sequence of the entire genome. 20 labs from 6 countries worked on the sequence.

More information

COURSE TITLE COURSE DESCRIPTION

COURSE TITLE COURSE DESCRIPTION COURSE TITLE COURSE DESCRIPTION CH-00X CHEMISTRY EXIT INTERVIEW All graduating students are required to meet with their department chairperson/program director to finalize requirements for degree completion.

More information

Translation Study Guide

Translation Study Guide Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to

More information

Integrating DNA Motif Discovery and Genome-Wide Expression Analysis. Erin M. Conlon

Integrating DNA Motif Discovery and Genome-Wide Expression Analysis. Erin M. Conlon Integrating DNA Motif Discovery and Genome-Wide Expression Analysis Department of Mathematics and Statistics University of Massachusetts Amherst Statistics in Functional Genomics Workshop Ascona, Switzerland

More information

CCR Biology - Chapter 9 Practice Test - Summer 2012

CCR Biology - Chapter 9 Practice Test - Summer 2012 Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible

More information

Chapter 5: The Structure and Function of Large Biological Molecules

Chapter 5: The Structure and Function of Large Biological Molecules Name Period Concept 5.1 Macromolecules are polymers, built from monomers 1. The large molecules of all living things fall into just four main classes. Name them. 2. Circle the three classes that are called

More information

Weill Graduate School of Medical Sciences of Cornell University Program in Pharmacology. Graduate School Curriculum

Weill Graduate School of Medical Sciences of Cornell University Program in Pharmacology. Graduate School Curriculum Weill Graduate School of Medical Sciences of Cornell University Program in Pharmacology Graduate School Curriculum Weill Graduate School of Medical Sciences Partnership between Weill Medical College and

More information