Applying data integration into reconstruction of gene networks from micro
|
|
- Georgiana Long
- 8 years ago
- Views:
Transcription
1 Applying data integration into reconstruction of gene networks from microarray data PhD Thesis Proposal Dipartimento di Informatica e Scienze dell Informazione Università degli Studi di Genova December 3, 2009
2 Contents Data-driven biomarker discovery Baseline knowledge (microarray data) Prior knowledge (biologically relevant data) Data-driven/knowledge-driven biomarker discovery Data fusion strategy Knowledge representation
3 Data-driven biomarker discovery
4 Baseline knowledge source: ArrayExpress (EBI)
5 Baseline knowledge In data-driven biomarker discovery model, statistical learning is performed on gene expression data matrix (numerical data) Post-processing involves sample annotations and gene annotations For example, it is possible to find a mapping between microarray probesets and functionality of the genes (using Genbank annotations)
6 Prior knowledge Gene Ontology (more insight into functionality) Online Mendelian Inheritance in Man (more insight into genetic disease research) Kyoto Encyclopedia of Genes and Genomes (more insight into biochemical data, among others) Genbank (more insight into putative functionality, reference sequence database)
7 Gene Ontology
8 OMIM <?xml version= " 1.0 "?> <!DOCTYPE Mim e n t r i e s PUBLIC " //NLM / / NCBI Mim / / EN" " h t t p : / /www. ncbi. nlm. nih. gov / dtd / NCBI_Mim. dtd " > <Mim e n t r i e s > <Mim e n t r y > <Mim entry_mimnumber>143100< / Mim entry_mimnumber> <Mim entry_mimtype value= " pound ">3< /Mim entry_mimtype> <Mim e n t r y _ t i t l e >HUNTINGTON DISEASE ; HD< / Mim e n t r y _ t i t l e > <Mim e n t r y _copyright>copyright ( c ) Johns Hopkins U n i v e r s i t y < /Mim e n t r y _copyright> <Mim entry_symbol>htt< / Mim entry_symbol> <Mim entry_locus>4p16.3< / Mim entry_locus> <Mim e n t r y _ a l i a s e s > <Mim entry_aliases_e>huntington CHOREA< / Mim entry_aliases_e> < / Mim e n t r y _ a l i a s e s > <Mim entry_seealso> <Mim c i t > <Mim cit_number>17< / Mim cit_number> <Mim c i t _ a u t h o r >Barinaga< / Mim c i t _ a u t h o r > <Mim c i t _ o t h e r s >< / Mim c i t _ o t h e r s > <Mim c i t _ y e a r >1996< / Mim c i t _ y e a r > < / Mim c i t > Beginning of record for Huntington Disease (XML, 1.4MB)
9 KEGG PC Substance : : = { s i d { i d , version 5 }, source db { name "KEGG", source i d s t r " D00287 " }, synonyms { " ", " Cyclophosphamide ", " Cyclophosphamide (USP) ", " Cyclophosphamide hydrate ", " Cyclophosphamide hydrate ( JP15 ) ", " Cytoxan ", " Cytoxan (TN) ", " D00287 ", " Neosar ", " Neosar (TN) " }, comment { " A n t i n e o p l a s t i c ", Beginning of record for cyclophosphamine (ASN.1, 46KB), listed as drug for neuroblastoma cancer, obtained from PubChem through KEGG links
10 Genbank >gi gb W W57613 zd24f07. s1 Soares_fetal_heart_NbHH19W Homo sapiens cdna clone IMAGE: , mrna sequence CAGTGTCCACAAGTAAAGCTTTATTGAAATACATTCACGTTCATTCATTTATATATTGTCAAGGGCTGCT TTTGCACTACATATGGTCAGAGTGGGTAGTTATGACATATTGAATGGCCCACAAGGCTAAACTATTTGCT ATCTGATCCCTTACAGTAAGTAAAGTTAGCCAACTTGTGATTTAGACAGTAGAGGAATCAAATGAAATAG CATCAAAAAGTTGTAGGATCATTGGGCCATTCTAACCCTAAGTCAGAGGAAGAAATGGAATGGGAAGTAG AGGGTGAACAGAAAGAACACAATACATCTGAGTGGGACGCACACATGTTGAGTAGTAAAAATCTCTGAGG ACTTCTTGTTAGGGGGATGCCAAAAAGTGGGGCCCTACCCAAGAAGATATAAAAAGGCTGAGATTAGGGC CGGGGTGCCGGTGGCTCCACACTTTGTAATCCCCAGCACTTTGGAGAAGGCTGAAGCCGGGTNGGATAAC CCTGGGATCCAGGAGNTTCCAGAACCAGNCCTTGGGCCCACATTNGGGGAACCCCCATTTTC FASTA record of transcript W57613, identified by l 1 -l 2 method as member of hypoxia gene signature, with no known functionality
11 Data-driven/knowledge-driven biomarker discovery
12 Data fusion strategy General strategy: Linear combination of elementary kernels κ = {K 1,...,K m }, producing superkernel K = m i=1 µ i K i where µ i 0 for i = 1,...,m, used further in statistical learning phase Primary question: How to design suitable elementary kernels for heterogeneous information from databanks? Secondary question 1: Is it possible to use linear combination property to construct kernels that can accumulate knowledge at a time? Secondary question 2: Is it possible to define other data fusion strategies?
13 Knowledge representation General goal: treating numerical matrix as baseline data type, define set of operations, involving information taken from other data sources, that will enhance results produced in statistical learning phase when using that matrix Primary question: Is it possible to achieve this without reformulating original SL regularization algorithms? Secondary question: Is it possible to adapt SL regularization algorithms for using with data types other than numerical matrices?
The human gene encoding Glucose-6-phosphate dehydrogenase (G6PD) is located on chromosome X in cytogenetic band q28.
Tutorial Module 5 BioMart You will learn about BioMart, a joint project developed and maintained at EBI and OiCR www.biomart.org How to use BioMart to quickly obtain lists of gene information from Ensembl
More informationJust the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
More informationGenBank, Entrez, & FASTA
GenBank, Entrez, & FASTA Nucleotide Sequence Databases First generation GenBank is a representative example started as sort of a museum to preserve knowledge of a sequence from first discovery great repositories,
More informationAn Introduction to the Use of Bayesian Network to Analyze Gene Expression Data
n Introduction to the Use of ayesian Network to nalyze Gene Expression Data Cristina Manfredotti Dipartimento di Informatica, Sistemistica e Comunicazione (D.I.S.Co. Università degli Studi Milano-icocca
More informationorg.rn.eg.db December 16, 2015 org.rn.egaccnum is an R object that contains mappings between Entrez Gene identifiers and GenBank accession numbers.
org.rn.eg.db December 16, 2015 org.rn.egaccnum Map Entrez Gene identifiers to GenBank Accession Numbers org.rn.egaccnum is an R object that contains mappings between Entrez Gene identifiers and GenBank
More informationHuman Genetics: Online Resources
Human Genetics: Online Resources David A Adler, ZymoGenetics, Seattle, Washington, USA There is a large source of information concerning human genetics available on a variety of different Internet sites,
More informationLaboratorio di Bioinformatica
Laboratorio di Bioinformatica Lezione #2 Dr. Marco Fondi Contact: marco.fondi@unifi.it www.unifi.it/dblemm/ tel. 0552288308 Dip.to di Biologia Evoluzionistica Laboratorio di Evoluzione Microbica e Molecolare,
More informationPREDA S4-classes. Francesco Ferrari October 13, 2015
PREDA S4-classes Francesco Ferrari October 13, 2015 Abstract This document provides a description of custom S4 classes used to manage data structures for PREDA: an R package for Position RElated Data Analysis.
More informationTeaching Bioinformatics to Undergraduates
Teaching Bioinformatics to Undergraduates http://www.med.nyu.edu/rcr/asm Stuart M. Brown Research Computing, NYU School of Medicine I. What is Bioinformatics? II. Challenges of teaching bioinformatics
More informationImportance of Statistics in creating high dimensional data
Importance of Statistics in creating high dimensional data Hemant K. Tiwari, PhD Section on Statistical Genetics Department of Biostatistics University of Alabama at Birmingham History of Genomic Data
More informationUsing the Grid for the interactive workflow management in biomedicine. Andrea Schenone BIOLAB DIST University of Genova
Using the Grid for the interactive workflow management in biomedicine Andrea Schenone BIOLAB DIST University of Genova overview background requirements solution case study results background A multilevel
More informationLecture 11 Data storage and LIMS solutions. Stéphane LE CROM lecrom@biologie.ens.fr
Lecture 11 Data storage and LIMS solutions Stéphane LE CROM lecrom@biologie.ens.fr Various steps of a DNA microarray experiment Experimental steps Data analysis Experimental design set up Chips on catalog
More informationThe Future of the Electronic Health Record. Gerry Higgins, Ph.D., Johns Hopkins
The Future of the Electronic Health Record Gerry Higgins, Ph.D., Johns Hopkins Topics to be covered Near Term Opportunities: Commercial, Usability, Unification of different applications. OMICS : The patient
More informationA Primer of Genome Science THIRD
A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:
More informationIntroduction to Bioinformatics 2. DNA Sequence Retrieval and comparison
Introduction to Bioinformatics 2. DNA Sequence Retrieval and comparison Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 matthewb@ba.ars.usda.gov
More informationIntegrating DNA Motif Discovery and Genome-Wide Expression Analysis. Erin M. Conlon
Integrating DNA Motif Discovery and Genome-Wide Expression Analysis Department of Mathematics and Statistics University of Massachusetts Amherst Statistics in Functional Genomics Workshop Ascona, Switzerland
More informationRETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison
RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the
More informationBiological Databases and Protein Sequence Analysis
Biological Databases and Protein Sequence Analysis Introduction M. Madan Babu, Center for Biotechnology, Anna University, Chennai 25, India Bioinformatics is the application of Information technology to
More informationIntegrating Bioinformatics, Medical Sciences and Drug Discovery
Integrating Bioinformatics, Medical Sciences and Drug Discovery M. Madan Babu Centre for Biotechnology, Anna University, Chennai - 600025 phone: 44-4332179 :: email: madanm1@rediffmail.com Bioinformatics
More informationBioinformatics Resources at a Glance
Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences
More informationGenome Viewing. Module 2. Using Genome Browsers to View Annotation of the Human Genome
Module 2 Genome Viewing Using Genome Browsers to View Annotation of the Human Genome Bert Overduin, Ph.D. PANDA Coordination & Outreach EMBL - European Bioinformatics Institute Wellcome Trust Genome Campus
More informationAGILENT S BIOINFORMATICS ANALYSIS SOFTWARE
ACCELERATING PROGRESS IS IN OUR GENES AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE GENESPRING GENE EXPRESSION (GX) MASS PROFILER PROFESSIONAL (MPP) PATHWAY ARCHITECT (PA) See Deeper. Reach Further. BIOINFORMATICS
More informationIngenuity Pathway Analysis (IPA )
ProductProfile Ingenuity Pathway Analysis (IPA ) For the analysis and interpretation of omics data IPA is a web-based software application for the analysis, integration, and interpretation of data derived
More informationAn agent-based layered middleware as tool integration
An agent-based layered middleware as tool integration Flavio Corradini Leonardo Mariani Emanuela Merelli University of L Aquila University of Milano University of Camerino ITALY ITALY ITALY Helsinki FSE/ESEC
More informationFlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem
FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem Elsa Bernard Laurent Jacob Julien Mairal Jean-Philippe Vert September 24, 2013 Abstract FlipFlop implements a fast method for de novo transcript
More informationPathway Analysis : An Introduction
Pathway Analysis : An Introduction Experiments Literature and other KB Data Knowledge Structure in Data through statistics Structure in Knowledge through GO and other Ontologies Gain insight into Data
More informationAn unsupervised fuzzy ensemble algorithmic scheme for gene expression data analysis
An unsupervised fuzzy ensemble algorithmic scheme for gene expression data analysis Roberto Avogadri 1, Giorgio Valentini 1 1 DSI, Dipartimento di Scienze dell Informazione, Università degli Studi di Milano,Via
More informationBIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS
BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS NEW YORK CITY COLLEGE OF TECHNOLOGY The City University Of New York School of Arts and Sciences Biological Sciences Department Course title:
More informationTutorial. Reference Genome Tracks. Sample to Insight. November 27, 2015
Reference Genome Tracks November 27, 2015 Sample to Insight CLC bio, a QIAGEN Company Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.clcbio.com support-clcbio@qiagen.com Reference
More informationBioinformatics Tools Tutorial Project Gene ID: KRas
Bioinformatics Tools Tutorial Project Gene ID: KRas Bednarski 2011 Original project funded by HHMI Bioinformatics Projects Introduction and Tutorial Purpose of this tutorial Illustrate the link between
More informationSyllabus of B.Sc. (Bioinformatics) Subject- Bioinformatics (as one subject) B.Sc. I Year Semester I Paper I: Basic of Bioinformatics 85 marks
Syllabus of B.Sc. (Bioinformatics) Subject- Bioinformatics (as one subject) B.Sc. I Year Semester I Paper I: Basic of Bioinformatics 85 marks Semester II Paper II: Mathematics I 85 marks B.Sc. II Year
More informationA Tutorial in Genetic Sequence Classification Tools and Techniques
A Tutorial in Genetic Sequence Classification Tools and Techniques Jake Drew Data Mining CSE 8331 Southern Methodist University jakemdrew@gmail.com www.jakemdrew.com Sequence Characters IUPAC nucleotide
More informationGenomes and SNPs in Malaria and Sickle Cell Anemia
Genomes and SNPs in Malaria and Sickle Cell Anemia Introduction to Genome Browsing with Ensembl Ensembl The vast amount of information in biological databases today demands a way of organising and accessing
More informationSequence Formats and Sequence Database Searches. Gloria Rendon SC11 Education June, 2011
Sequence Formats and Sequence Database Searches Gloria Rendon SC11 Education June, 2011 Sequence A is the primary structure of a biological molecule. It is a chain of residues that form a precise linear
More informationVad är bioinformatik och varför behöver vi det i vården? a bioinformatician's perspectives
Vad är bioinformatik och varför behöver vi det i vården? a bioinformatician's perspectives Dirk.Repsilber@oru.se 2015-05-21 Functional Bioinformatics, Örebro University Vad är bioinformatik och varför
More informationSchool of Nursing. Presented by Yvette Conley, PhD
Presented by Yvette Conley, PhD What we will cover during this webcast: Briefly discuss the approaches introduced in the paper: Genome Sequencing Genome Wide Association Studies Epigenomics Gene Expression
More informationTRACKS GENETIC EPIDEMIOLOGY
Dr. Priya Duggal, Director In the post-genomic era where larger amounts of genetic data are now readily available, it has become increasingly important to design studies and use analytical techniques that
More informationProcessing Genome Data using Scalable Database Technology. My Background
Johann Christoph Freytag, Ph.D. freytag@dbis.informatik.hu-berlin.de http://www.dbis.informatik.hu-berlin.de Stanford University, February 2004 PhD @ Harvard Univ. Visiting Scientist, Microsoft Res. (2002)
More informationBig Data. Tom Plunkett Senior Consultant
Big Data Tom Plunkett Senior Consultant 2 Copyright 2013, Oracle and/or its affiliates. All rights reserved. Big Data in Healthcare Find relationship between gene to cancer interaction Use Case Cross-referenced
More informationSurvey of clinical data mining applications on big data in health informatics
Survey of clinical data mining applications on big data in health informatics Matthew Herland, Taghi M. Khoshgoftaar, and Randall Wald 劉 俊 成 Survey of clinical data mining applications on big data in health
More informationAlison Yao, Ph.D. July 2014
* Alison Yao, Ph.D. Program Officer, Office of Genomics and Advanced Technologies Division of Microbiology and Infectious Diseases National Institute of Allergy and Infectious Diseases National Institutes
More informationDECLARATION OF PERFORMANCE NO. HU-DOP_TN-212-25_001
NO. HU-DOP_TN-212-25_001 Product type 212 (TN) 3,5x25 mm EN 14566:2008+A1:2009 NO. HU-DOP_TN-212-35_001 Product type 212 (TN) 3,5x35 mm EN 14566:2008+A1:2009 NO. HU-DOP_TN-212-45_001 Product type 212 (TN)
More informationWeb-Based Genomic Information Integration with Gene Ontology
Web-Based Genomic Information Integration with Gene Ontology Kai Xu 1 IMAGEN group, National ICT Australia, Sydney, Australia, kai.xu@nicta.com.au Abstract. Despite the dramatic growth of online genomic
More informationTargeted. sequencing solutions. Accurate, scalable, fast TARGETED
Targeted TARGETED Sequencing sequencing solutions Accurate, scalable, fast Sequencing for every lab, every budget, every application Ion Torrent semiconductor sequencing Ion Torrent technology has pioneered
More informationIntegration of data management and analysis for genome research
Integration of data management and analysis for genome research Volker Brendel Deparment of Zoology & Genetics and Department of Statistics Iowa State University 2112 Molecular Biology Building Ames, Iowa
More informationDNA Sequence formats
DNA Sequence formats [Plain] [EMBL] [FASTA] [GCG] [GenBank] [IG] [IUPAC] [How Genomatix represents sequence annotation] Plain sequence format A sequence in plain format may contain only IUPAC characters
More informationGenome and DNA Sequence Databases. BME 110/BIOL 181 CompBio Tools Todd Lowe March 31, 2009
Genome and DNA Sequence Databases BME 110/BIOL 181 CompBio Tools Todd Lowe March 31, 2009 Admin Reading: Chapters 1 & 2 Notes available in PDF format on-line (see class calendar page): http://www.soe.ucsc.edu/classes/bme110/spring09/bme110-calendar.html
More informationBIOINF 585 Fall 2015 Machine Learning for Systems Biology & Clinical Informatics http://www.ccmb.med.umich.edu/node/1376
Course Director: Dr. Kayvan Najarian (DCM&B, kayvan@umich.edu) Lectures: Labs: Mondays and Wednesdays 9:00 AM -10:30 AM Rm. 2065 Palmer Commons Bldg. Wednesdays 10:30 AM 11:30 AM (alternate weeks) Rm.
More informationRT 2 Profiler PCR Array: Web-Based Data Analysis Tutorial
RT 2 Profiler PCR Array: Web-Based Data Analysis Tutorial Samuel J. Rulli, Jr., Ph.D. qpcr-applications Scientist Samuel.Rulli@QIAGEN.com Pathway Focused Research from Sample Prep to Data Analysis! -2-
More informationBagged Ensembles of Support Vector Machines for Gene Expression Data Analysis
Bagged Ensembles of Support Vector Machines for Gene Expression Data Analysis Giorgio Valentini DSI, Dip. di Scienze dell Informazione Università degli Studi di Milano, Italy INFM, Istituto Nazionale di
More informationGMQL Functional Comparison with BEDTools and BEDOPS
GMQL Functional Comparison with BEDTools and BEDOPS Genomic Computing Group Dipartimento di Elettronica, Informazione e Bioingegneria Politecnico di Milano This document presents a functional comparison
More informationScientific databases. Biological data management
Scientific databases Biological data management The term paper within the framework of the course Principles of Modern Database Systems by Aleksejs Kontijevskis PhD student The Linnaeus Centre for Bioinformatics
More informationModule 1. Sequence Formats and Retrieval. Charles Steward
The Open Door Workshop Module 1 Sequence Formats and Retrieval Charles Steward 1 Aims Acquaint you with different file formats and associated annotations. Introduce different nucleotide and protein databases.
More informationAnalisi in silicoe relazione tra enterotossine stafilococciche e tossine ipotetiche
IZSTO Istituto Zooprofilattico Sperimentale del Piemonte, Liguria e Valle d Aosta VI WORKSHOP DEL LABORATORIO NAZIONALE DI RIFERIMENTO (NRL) PER GLI STAFILOCOCCHI COAGULASI POSITIVI COMPRESO S.AUREUS 12
More informationSeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications
Product Bulletin Sequencing Software SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications Comprehensive reference sequence handling Helps interpret the role of each
More informationdiagnosis through Random
Convegno Calcolo ad Alte Prestazioni "Biocomputing" Bio-molecular diagnosis through Random Subspace Ensembles of Learning Machines Alberto Bertoni, Raffaella Folgieri, Giorgio Valentini DSI Dipartimento
More informationData Integration and Decision-Making For Biomarkers Discovery, Validation and Evaluation. D. POLVERARI, CTO October 06-07 2008
Data Integration and Decision-Making For Biomarkers Discovery, Validation and Evaluation D. POLVERARI, CTO October 06-07 2008 Data integration definition and aims Definition : Data integration consists
More informationBiomedical Big Data and Precision Medicine
Biomedical Big Data and Precision Medicine Jie Yang Department of Mathematics, Statistics, and Computer Science University of Illinois at Chicago October 8, 2015 1 Explosion of Biomedical Data 2 Types
More informationHow To Use The Assembly Database In A Microarray (Perl) With A Microarcode) (Perperl 2) (For Macrogenome) (Genome 2)
The Ensembl Core databases and API Useful links Installation instructions: http://www.ensembl.org/info/docs/api/api_installation.html Schema description: http://www.ensembl.org/info/docs/api/core/core_schema.html
More informationBig Data and Text Mining
Big Data and Text Mining Dr. Ian Lewin Senior NLP Resource Specialist Ian.lewin@linguamatics.com www.linguamatics.com About Linguamatics Boston, USA Cambridge, UK Software Consulting Hosted content Agile,
More informationPresente e futuro del Web Semantico
Sistemi di Elaborazione dell informazione II Corso di Laurea Specialistica in Ingegneria Telematica II anno 4 CFU Università Kore Enna A.A. 2009-2010 Alessandro Longheu http://www.diit.unict.it/users/alongheu
More informationLecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs)
Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs) Single nucleotide polymorphisms or SNPs (pronounced "snips") are DNA sequence variations that occur
More informationHow To Become A Geneticist
Number of Biostatistically, Epidemiologically, or Biologically based Courses Number of Health Management/Law based classes School Courses Centers Other Boston U BS858 Statistical 3 2 BS860 Statistical
More informationEnhancing Functionality of EHRs for Genomic Research, Including E- Phenotying, Integrating Genomic Data, Transportable CDS, Privacy Threats
Enhancing Functionality of EHRs for Genomic Research, Including E- Phenotying, Integrating Genomic Data, Transportable CDS, Privacy Threats Genomic Medicine 8 meeting Alexa McCray Christopher G Chute Rex
More informationFRANCESCO BELLOCCHIO S CURRICULUM VITAE ET STUDIORUM
FRANCESCO BELLOCCHIO S CURRICULUM VITAE ET STUDIORUM April 2011 Index Personal details and education 1 Research activities 2 Teaching and tutorial activities 3 Conference organization and review activities
More informationA Multiple DNA Sequence Translation Tool Incorporating Web Robot and Intelligent Recommendation Techniques
Proceedings of the 2007 WSEAS International Conference on Computer Engineering and Applications, Gold Coast, Australia, January 17-19, 2007 402 A Multiple DNA Sequence Translation Tool Incorporating Web
More informationIntroduction to Bioinformatics 3. DNA editing and contig assembly
Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 matthewb@ba.ars.usda.gov
More informationHuman Genome and Human Genome Project. Louxin Zhang
Human Genome and Human Genome Project Louxin Zhang A Primer to Genomics Cells are the fundamental working units of every living systems. DNA is made of 4 nucleotide bases. The DNA sequence is the particular
More informationBIO 3352: BIOINFORMATICS II HYBRID COURSE SYLLABUS
BIO 3352: BIOINFORMATICS II HYBRID COURSE SYLLABUS NEW YORK CITY COLLEGE OF TECHNOLOGY The City University Of New York School of Arts and Sciences Biological Sciences Department Course title: Bioinformatics
More informationCurrent Motif Discovery Tools and their Limitations
Current Motif Discovery Tools and their Limitations Philipp Bucher SIB / CIG Workshop 3 October 2006 Trendy Concepts and Hypotheses Transcription regulatory elements act in a context-dependent manner.
More informationUsing Graph Theory to Analyze Gene Network Coherence
Using Graph Theory to Analyze Gene Network Coherence Francisco A. Gómez-Vela fgomez@upo.es Norberto Díaz-Díaz ndiaz@upo.es José A. Lagares José A. Sánchez Jesús S. Aguilar 1 Outlines Introduction Proposed
More informationGenevestigator Training
Genevestigator Training Gent, 6 November 2012 Philip Zimmermann, Nebion AG Goals Get to know Genevestigator What Genevestigator is for For who Genevestigator was created How to use Genevestigator for your
More informationBiological Sequence Data Formats
Biological Sequence Data Formats Here we present three standard formats in which biological sequence data (DNA, RNA and protein) can be stored and presented. Raw Sequence: Data without description. FASTA
More informationHealth Data Analytics and Decision Support Prof.Dr. Bart De Moor
Bart.DeMoor@iminds.be iminds Department MEDICAL IT Health Data Analytics and Decision Support Prof.Dr. Bart De Moor Department Med IT Trends P3 x P4 medicine Decision support cases MEDICAL IT DEPARTMENT
More informationNote: This document wh_informatics_practical.doc and supporting materials can be downloaded at
Woods Hole Zebrafish Genetics and Development Bioinformatics/Genomics Lab Ian Woods Note: This document wh_informatics_practical.doc and supporting materials can be downloaded at http://faculty.ithaca.edu/iwoods/docs/wh/
More informationPengyu Hong BioX program, Department of Statistics, Stanford University, Stanford, CA 94305-4065. Email: pengyuhong@stanford.edu
UBIC 2 Towards Ubiquitous Bio-Information Computing: Data Protocols, Middleware, and Web Services for Heterogeneous Biological Information Integration and Retrieval Pengyu Hong BioX program, Department
More informationMicroarray Data Analysis. A step by step analysis using BRB-Array Tools
Microarray Data Analysis A step by step analysis using BRB-Array Tools 1 EXAMINATION OF DIFFERENTIAL GENE EXPRESSION (1) Objective: to find genes whose expression is changed before and after chemotherapy.
More informationBecker Muscular Dystrophy
Muscular Dystrophy A Case Study of Positional Cloning Described by Benjamin Duchenne (1868) X-linked recessive disease causing severe muscular degeneration. 100 % penetrance X d Y affected male Frequency
More informationGlobal and Discovery Proteomics Lecture Agenda
Global and Discovery Proteomics Christine A. Jelinek, Ph.D. Johns Hopkins University School of Medicine Department of Pharmacology and Molecular Sciences Middle Atlantic Mass Spectrometry Laboratory Global
More informationDistributed Data Mining in Discovery Net. Dr. Moustafa Ghanem Department of Computing Imperial College London
Distributed Data Mining in Discovery Net Dr. Moustafa Ghanem Department of Computing Imperial College London 1. What is Discovery Net 2. Distributed Data Mining for Compute Intensive Tasks 3. Distributed
More informationResearch Data Integration of Retrospective Studies for Prediction of Disease Progression A White Paper. By Erich A. Gombocz
Research Data Integration of Retrospective Studies for Prediction of Disease Progression A White Paper By Erich A. Gombocz 2 Research Data Integration of Retrospective Studies for Prediction of Disease
More informationDistributed Bioinformatics Computing System for DNA Sequence Analysis
Global Journal of Computer Science and Technology: A Hardware & Computation Volume 14 Issue 1 Version 1.0 Type: Double Blind Peer Reviewed International Research Journal Publisher: Global Journals Inc.
More informationFrom Immunotherapy of Cancer to the Discovery of Kidney Cancer Genes
ISSN 2154-4006 The Genetic Basis of Human Disease zbar Colloquium series on Series Editor: Michael Dean, Ph.D., Head, Human Genetics Section, Senior Investigator, Laboratory of Experimental Immunology
More informationZFIN Anatomy Pages - 3 Great Reasons Why You Need to Use Them
ZFIN NEWS The Zebrafish Information Network http://zfin.org Volume 5, Number 1 Spring 2008 In this issue: Maximizing Data Impact (pg.1) (pg.1) Full Text publications (pg.3) Morpholino Database (MODB) and
More informationSoftware reviews. Expression Pro ler: A suite of web-based tools for the analysis of microarray gene expression data
Expression Pro ler: A suite of web-based tools for the analysis of microarray gene expression data DNA microarray analysis 1±3 has become one of the most widely used tools for the analysis of gene expression
More informationSearch and Data Mining: Techniques. Applications Anya Yarygina Boris Novikov
Search and Data Mining: Techniques Applications Anya Yarygina Boris Novikov Introduction Data mining applications Data mining system products and research prototypes Additional themes on data mining Social
More informationCore Facility Genomics
Core Facility Genomics versatile genome or transcriptome analyses based on quantifiable highthroughput data ascertainment 1 Topics Collaboration with Harald Binder and Clemens Kreutz Project: Microarray
More informationData Integration of Bioinformatics Database Based on Web Services
Data Integration of Bioinformatics Database Based on Web Services Yuelan Liu, Jian hua Wang College of Computer, Harbin Normal University Intelligent Education Information Technology Emphases Lab of Heilongjiang
More informationSuperior TrueMAB TM monoclonal antibodies for the recognition of proteins native epitopes
Superior TrueMAB TM monoclonal antibodies for the recognition of proteins native epitopes Outlines Brief introduction of OriGene s mission on gene-centric product solution. TrueMAB monoclonal antibody
More informationA leader in the development and application of information technology to prevent and treat disease.
A leader in the development and application of information technology to prevent and treat disease. About MOLECULAR HEALTH Molecular Health was founded in 2004 with the vision of changing healthcare. Today
More informationPreparing the scenario for the use of patient s genome sequences in clinic. Joaquín Dopazo
Preparing the scenario for the use of patient s genome sequences in clinic Joaquín Dopazo Computational Medicine Institute, Centro de Investigación Príncipe Felipe (CIPF), Functional Genomics Node, (INB),
More informationM110.726 The Nucleus M110.727 The Cytoskeleton M340.703 Cell Structure and Dynamics
of Biochemistry and Molecular Biology 1. Master the knowledge base of current biochemistry, molecular biology, and cellular physiology Describe current knowledge in metabolic transformations conducted
More informationBIOINF 525 Winter 2016 Foundations of Bioinformatics and Systems Biology http://tinyurl.com/bioinf525-w16
Course Director: Dr. Barry Grant (DCM&B, bjgrant@med.umich.edu) Description: This is a three module course covering (1) Foundations of Bioinformatics, (2) Statistics in Bioinformatics, and (3) Systems
More informationAnalyzing rare diseases terms in biomedical terminologies
Analyzing rare diseases terms in biomedical terminologies Erika Pasceri Introduction A rare disease is a pathological condition with low prevalence and incidence. There are between 6000 and 8000 rare diseases.
More informationSoftware and Methods for the Analysis of Affymetrix GeneChip Data. Rafael A Irizarry Department of Biostatistics Johns Hopkins University
Software and Methods for the Analysis of Affymetrix GeneChip Data Rafael A Irizarry Department of Biostatistics Johns Hopkins University Outline Overview Bioconductor Project Examples 1: Gene Annotation
More informationDEPARTMENT OF HEALTH AND HUMAN SERVICES NATIONAL INSTITUTES OF HEALTH. National Library of Medicine (NLM) Organization Chart...2
DEPARTMENT OF HEALTH AND HUMAN SERVICES NATIONAL INSTITUTES OF HEALTH (NLM) FY 2015 Budget Page No. Organization Chart...2 Appropriation Language...3 Amounts Available for Obligation...4 Budget Mechanism
More informationDNA and the Cell. Version 2.3. English version. ELLS European Learning Laboratory for the Life Sciences
DNA and the Cell Anastasios Koutsos Alexandra Manaia Julia Willingale-Theune Version 2.3 English version ELLS European Learning Laboratory for the Life Sciences Anastasios Koutsos, Alexandra Manaia and
More informationarxiv:1305.4455v1 [cs.dl] 20 May 2013
SHARE: A Web Service Based Framework for Distributed Querying and Reasoning on the Semantic Web Ben P Vandervalk, E Luke McCarthy, and Mark D Wilkinson arxiv:1305.4455v1 [cs.dl] 20 May 2013 The Providence
More informationCURRICULUM VITAE. Ilaria.giordani@disco.unimib.it. Phd in computer science
CURRICULUM VITAE PERSONAL INFORMATION Name Address Giordani Ilaria Via Volturno 13 22063 Cantù (Co) Mobile phone number (+ 39) 333.8725026 Phone number (+ 39) 031.712957 E-mail Ilaria.giordani@disco.unimib.it
More informationUser. Annotation. Interfaces. Flatfile ASN.1 NCBI GDB GSDB. GenBank. sequence data. experimental verification. annotation database.
The GAIA Software Framework for Genome Annotation G. Christian Overton, Charles Bailey, Jonathan Crabtree, Mark Gibson, Stephen Fischer and Jonathan Schug Center for Bioinformatics University ofpennsylvania
More information