Applying data integration into reconstruction of gene networks from micro

Size: px
Start display at page:

Download "Applying data integration into reconstruction of gene networks from micro"

Transcription

1 Applying data integration into reconstruction of gene networks from microarray data PhD Thesis Proposal Dipartimento di Informatica e Scienze dell Informazione Università degli Studi di Genova December 3, 2009

2 Contents Data-driven biomarker discovery Baseline knowledge (microarray data) Prior knowledge (biologically relevant data) Data-driven/knowledge-driven biomarker discovery Data fusion strategy Knowledge representation

3 Data-driven biomarker discovery

4 Baseline knowledge source: ArrayExpress (EBI)

5 Baseline knowledge In data-driven biomarker discovery model, statistical learning is performed on gene expression data matrix (numerical data) Post-processing involves sample annotations and gene annotations For example, it is possible to find a mapping between microarray probesets and functionality of the genes (using Genbank annotations)

6 Prior knowledge Gene Ontology (more insight into functionality) Online Mendelian Inheritance in Man (more insight into genetic disease research) Kyoto Encyclopedia of Genes and Genomes (more insight into biochemical data, among others) Genbank (more insight into putative functionality, reference sequence database)

7 Gene Ontology

8 OMIM <?xml version= " 1.0 "?> <!DOCTYPE Mim e n t r i e s PUBLIC " //NLM / / NCBI Mim / / EN" " h t t p : / /www. ncbi. nlm. nih. gov / dtd / NCBI_Mim. dtd " > <Mim e n t r i e s > <Mim e n t r y > <Mim entry_mimnumber>143100< / Mim entry_mimnumber> <Mim entry_mimtype value= " pound ">3< /Mim entry_mimtype> <Mim e n t r y _ t i t l e >HUNTINGTON DISEASE ; HD< / Mim e n t r y _ t i t l e > <Mim e n t r y _copyright>copyright ( c ) Johns Hopkins U n i v e r s i t y < /Mim e n t r y _copyright> <Mim entry_symbol>htt< / Mim entry_symbol> <Mim entry_locus>4p16.3< / Mim entry_locus> <Mim e n t r y _ a l i a s e s > <Mim entry_aliases_e>huntington CHOREA< / Mim entry_aliases_e> < / Mim e n t r y _ a l i a s e s > <Mim entry_seealso> <Mim c i t > <Mim cit_number>17< / Mim cit_number> <Mim c i t _ a u t h o r >Barinaga< / Mim c i t _ a u t h o r > <Mim c i t _ o t h e r s >< / Mim c i t _ o t h e r s > <Mim c i t _ y e a r >1996< / Mim c i t _ y e a r > < / Mim c i t > Beginning of record for Huntington Disease (XML, 1.4MB)

9 KEGG PC Substance : : = { s i d { i d , version 5 }, source db { name "KEGG", source i d s t r " D00287 " }, synonyms { " ", " Cyclophosphamide ", " Cyclophosphamide (USP) ", " Cyclophosphamide hydrate ", " Cyclophosphamide hydrate ( JP15 ) ", " Cytoxan ", " Cytoxan (TN) ", " D00287 ", " Neosar ", " Neosar (TN) " }, comment { " A n t i n e o p l a s t i c ", Beginning of record for cyclophosphamine (ASN.1, 46KB), listed as drug for neuroblastoma cancer, obtained from PubChem through KEGG links

10 Genbank >gi gb W W57613 zd24f07. s1 Soares_fetal_heart_NbHH19W Homo sapiens cdna clone IMAGE: , mrna sequence CAGTGTCCACAAGTAAAGCTTTATTGAAATACATTCACGTTCATTCATTTATATATTGTCAAGGGCTGCT TTTGCACTACATATGGTCAGAGTGGGTAGTTATGACATATTGAATGGCCCACAAGGCTAAACTATTTGCT ATCTGATCCCTTACAGTAAGTAAAGTTAGCCAACTTGTGATTTAGACAGTAGAGGAATCAAATGAAATAG CATCAAAAAGTTGTAGGATCATTGGGCCATTCTAACCCTAAGTCAGAGGAAGAAATGGAATGGGAAGTAG AGGGTGAACAGAAAGAACACAATACATCTGAGTGGGACGCACACATGTTGAGTAGTAAAAATCTCTGAGG ACTTCTTGTTAGGGGGATGCCAAAAAGTGGGGCCCTACCCAAGAAGATATAAAAAGGCTGAGATTAGGGC CGGGGTGCCGGTGGCTCCACACTTTGTAATCCCCAGCACTTTGGAGAAGGCTGAAGCCGGGTNGGATAAC CCTGGGATCCAGGAGNTTCCAGAACCAGNCCTTGGGCCCACATTNGGGGAACCCCCATTTTC FASTA record of transcript W57613, identified by l 1 -l 2 method as member of hypoxia gene signature, with no known functionality

11 Data-driven/knowledge-driven biomarker discovery

12 Data fusion strategy General strategy: Linear combination of elementary kernels κ = {K 1,...,K m }, producing superkernel K = m i=1 µ i K i where µ i 0 for i = 1,...,m, used further in statistical learning phase Primary question: How to design suitable elementary kernels for heterogeneous information from databanks? Secondary question 1: Is it possible to use linear combination property to construct kernels that can accumulate knowledge at a time? Secondary question 2: Is it possible to define other data fusion strategies?

13 Knowledge representation General goal: treating numerical matrix as baseline data type, define set of operations, involving information taken from other data sources, that will enhance results produced in statistical learning phase when using that matrix Primary question: Is it possible to achieve this without reformulating original SL regularization algorithms? Secondary question: Is it possible to adapt SL regularization algorithms for using with data types other than numerical matrices?

The human gene encoding Glucose-6-phosphate dehydrogenase (G6PD) is located on chromosome X in cytogenetic band q28.

The human gene encoding Glucose-6-phosphate dehydrogenase (G6PD) is located on chromosome X in cytogenetic band q28. Tutorial Module 5 BioMart You will learn about BioMart, a joint project developed and maintained at EBI and OiCR www.biomart.org How to use BioMart to quickly obtain lists of gene information from Ensembl

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources 1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools

More information

GenBank, Entrez, & FASTA

GenBank, Entrez, & FASTA GenBank, Entrez, & FASTA Nucleotide Sequence Databases First generation GenBank is a representative example started as sort of a museum to preserve knowledge of a sequence from first discovery great repositories,

More information

An Introduction to the Use of Bayesian Network to Analyze Gene Expression Data

An Introduction to the Use of Bayesian Network to Analyze Gene Expression Data n Introduction to the Use of ayesian Network to nalyze Gene Expression Data Cristina Manfredotti Dipartimento di Informatica, Sistemistica e Comunicazione (D.I.S.Co. Università degli Studi Milano-icocca

More information

org.rn.eg.db December 16, 2015 org.rn.egaccnum is an R object that contains mappings between Entrez Gene identifiers and GenBank accession numbers.

org.rn.eg.db December 16, 2015 org.rn.egaccnum is an R object that contains mappings between Entrez Gene identifiers and GenBank accession numbers. org.rn.eg.db December 16, 2015 org.rn.egaccnum Map Entrez Gene identifiers to GenBank Accession Numbers org.rn.egaccnum is an R object that contains mappings between Entrez Gene identifiers and GenBank

More information

Human Genetics: Online Resources

Human Genetics: Online Resources Human Genetics: Online Resources David A Adler, ZymoGenetics, Seattle, Washington, USA There is a large source of information concerning human genetics available on a variety of different Internet sites,

More information

Laboratorio di Bioinformatica

Laboratorio di Bioinformatica Laboratorio di Bioinformatica Lezione #2 Dr. Marco Fondi Contact: marco.fondi@unifi.it www.unifi.it/dblemm/ tel. 0552288308 Dip.to di Biologia Evoluzionistica Laboratorio di Evoluzione Microbica e Molecolare,

More information

PREDA S4-classes. Francesco Ferrari October 13, 2015

PREDA S4-classes. Francesco Ferrari October 13, 2015 PREDA S4-classes Francesco Ferrari October 13, 2015 Abstract This document provides a description of custom S4 classes used to manage data structures for PREDA: an R package for Position RElated Data Analysis.

More information

Teaching Bioinformatics to Undergraduates

Teaching Bioinformatics to Undergraduates Teaching Bioinformatics to Undergraduates http://www.med.nyu.edu/rcr/asm Stuart M. Brown Research Computing, NYU School of Medicine I. What is Bioinformatics? II. Challenges of teaching bioinformatics

More information

Importance of Statistics in creating high dimensional data

Importance of Statistics in creating high dimensional data Importance of Statistics in creating high dimensional data Hemant K. Tiwari, PhD Section on Statistical Genetics Department of Biostatistics University of Alabama at Birmingham History of Genomic Data

More information

Using the Grid for the interactive workflow management in biomedicine. Andrea Schenone BIOLAB DIST University of Genova

Using the Grid for the interactive workflow management in biomedicine. Andrea Schenone BIOLAB DIST University of Genova Using the Grid for the interactive workflow management in biomedicine Andrea Schenone BIOLAB DIST University of Genova overview background requirements solution case study results background A multilevel

More information

Lecture 11 Data storage and LIMS solutions. Stéphane LE CROM lecrom@biologie.ens.fr

Lecture 11 Data storage and LIMS solutions. Stéphane LE CROM lecrom@biologie.ens.fr Lecture 11 Data storage and LIMS solutions Stéphane LE CROM lecrom@biologie.ens.fr Various steps of a DNA microarray experiment Experimental steps Data analysis Experimental design set up Chips on catalog

More information

The Future of the Electronic Health Record. Gerry Higgins, Ph.D., Johns Hopkins

The Future of the Electronic Health Record. Gerry Higgins, Ph.D., Johns Hopkins The Future of the Electronic Health Record Gerry Higgins, Ph.D., Johns Hopkins Topics to be covered Near Term Opportunities: Commercial, Usability, Unification of different applications. OMICS : The patient

More information

A Primer of Genome Science THIRD

A Primer of Genome Science THIRD A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:

More information

Introduction to Bioinformatics 2. DNA Sequence Retrieval and comparison

Introduction to Bioinformatics 2. DNA Sequence Retrieval and comparison Introduction to Bioinformatics 2. DNA Sequence Retrieval and comparison Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 matthewb@ba.ars.usda.gov

More information

Integrating DNA Motif Discovery and Genome-Wide Expression Analysis. Erin M. Conlon

Integrating DNA Motif Discovery and Genome-Wide Expression Analysis. Erin M. Conlon Integrating DNA Motif Discovery and Genome-Wide Expression Analysis Department of Mathematics and Statistics University of Massachusetts Amherst Statistics in Functional Genomics Workshop Ascona, Switzerland

More information

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the

More information

Biological Databases and Protein Sequence Analysis

Biological Databases and Protein Sequence Analysis Biological Databases and Protein Sequence Analysis Introduction M. Madan Babu, Center for Biotechnology, Anna University, Chennai 25, India Bioinformatics is the application of Information technology to

More information

Integrating Bioinformatics, Medical Sciences and Drug Discovery

Integrating Bioinformatics, Medical Sciences and Drug Discovery Integrating Bioinformatics, Medical Sciences and Drug Discovery M. Madan Babu Centre for Biotechnology, Anna University, Chennai - 600025 phone: 44-4332179 :: email: madanm1@rediffmail.com Bioinformatics

More information

Bioinformatics Resources at a Glance

Bioinformatics Resources at a Glance Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences

More information

Genome Viewing. Module 2. Using Genome Browsers to View Annotation of the Human Genome

Genome Viewing. Module 2. Using Genome Browsers to View Annotation of the Human Genome Module 2 Genome Viewing Using Genome Browsers to View Annotation of the Human Genome Bert Overduin, Ph.D. PANDA Coordination & Outreach EMBL - European Bioinformatics Institute Wellcome Trust Genome Campus

More information

AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE

AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE ACCELERATING PROGRESS IS IN OUR GENES AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE GENESPRING GENE EXPRESSION (GX) MASS PROFILER PROFESSIONAL (MPP) PATHWAY ARCHITECT (PA) See Deeper. Reach Further. BIOINFORMATICS

More information

Ingenuity Pathway Analysis (IPA )

Ingenuity Pathway Analysis (IPA ) ProductProfile Ingenuity Pathway Analysis (IPA ) For the analysis and interpretation of omics data IPA is a web-based software application for the analysis, integration, and interpretation of data derived

More information

An agent-based layered middleware as tool integration

An agent-based layered middleware as tool integration An agent-based layered middleware as tool integration Flavio Corradini Leonardo Mariani Emanuela Merelli University of L Aquila University of Milano University of Camerino ITALY ITALY ITALY Helsinki FSE/ESEC

More information

FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem

FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem Elsa Bernard Laurent Jacob Julien Mairal Jean-Philippe Vert September 24, 2013 Abstract FlipFlop implements a fast method for de novo transcript

More information

Pathway Analysis : An Introduction

Pathway Analysis : An Introduction Pathway Analysis : An Introduction Experiments Literature and other KB Data Knowledge Structure in Data through statistics Structure in Knowledge through GO and other Ontologies Gain insight into Data

More information

An unsupervised fuzzy ensemble algorithmic scheme for gene expression data analysis

An unsupervised fuzzy ensemble algorithmic scheme for gene expression data analysis An unsupervised fuzzy ensemble algorithmic scheme for gene expression data analysis Roberto Avogadri 1, Giorgio Valentini 1 1 DSI, Dipartimento di Scienze dell Informazione, Università degli Studi di Milano,Via

More information

BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS

BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS NEW YORK CITY COLLEGE OF TECHNOLOGY The City University Of New York School of Arts and Sciences Biological Sciences Department Course title:

More information

Tutorial. Reference Genome Tracks. Sample to Insight. November 27, 2015

Tutorial. Reference Genome Tracks. Sample to Insight. November 27, 2015 Reference Genome Tracks November 27, 2015 Sample to Insight CLC bio, a QIAGEN Company Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.clcbio.com support-clcbio@qiagen.com Reference

More information

Bioinformatics Tools Tutorial Project Gene ID: KRas

Bioinformatics Tools Tutorial Project Gene ID: KRas Bioinformatics Tools Tutorial Project Gene ID: KRas Bednarski 2011 Original project funded by HHMI Bioinformatics Projects Introduction and Tutorial Purpose of this tutorial Illustrate the link between

More information

Syllabus of B.Sc. (Bioinformatics) Subject- Bioinformatics (as one subject) B.Sc. I Year Semester I Paper I: Basic of Bioinformatics 85 marks

Syllabus of B.Sc. (Bioinformatics) Subject- Bioinformatics (as one subject) B.Sc. I Year Semester I Paper I: Basic of Bioinformatics 85 marks Syllabus of B.Sc. (Bioinformatics) Subject- Bioinformatics (as one subject) B.Sc. I Year Semester I Paper I: Basic of Bioinformatics 85 marks Semester II Paper II: Mathematics I 85 marks B.Sc. II Year

More information

A Tutorial in Genetic Sequence Classification Tools and Techniques

A Tutorial in Genetic Sequence Classification Tools and Techniques A Tutorial in Genetic Sequence Classification Tools and Techniques Jake Drew Data Mining CSE 8331 Southern Methodist University jakemdrew@gmail.com www.jakemdrew.com Sequence Characters IUPAC nucleotide

More information

Genomes and SNPs in Malaria and Sickle Cell Anemia

Genomes and SNPs in Malaria and Sickle Cell Anemia Genomes and SNPs in Malaria and Sickle Cell Anemia Introduction to Genome Browsing with Ensembl Ensembl The vast amount of information in biological databases today demands a way of organising and accessing

More information

Sequence Formats and Sequence Database Searches. Gloria Rendon SC11 Education June, 2011

Sequence Formats and Sequence Database Searches. Gloria Rendon SC11 Education June, 2011 Sequence Formats and Sequence Database Searches Gloria Rendon SC11 Education June, 2011 Sequence A is the primary structure of a biological molecule. It is a chain of residues that form a precise linear

More information

Vad är bioinformatik och varför behöver vi det i vården? a bioinformatician's perspectives

Vad är bioinformatik och varför behöver vi det i vården? a bioinformatician's perspectives Vad är bioinformatik och varför behöver vi det i vården? a bioinformatician's perspectives Dirk.Repsilber@oru.se 2015-05-21 Functional Bioinformatics, Örebro University Vad är bioinformatik och varför

More information

School of Nursing. Presented by Yvette Conley, PhD

School of Nursing. Presented by Yvette Conley, PhD Presented by Yvette Conley, PhD What we will cover during this webcast: Briefly discuss the approaches introduced in the paper: Genome Sequencing Genome Wide Association Studies Epigenomics Gene Expression

More information

TRACKS GENETIC EPIDEMIOLOGY

TRACKS GENETIC EPIDEMIOLOGY Dr. Priya Duggal, Director In the post-genomic era where larger amounts of genetic data are now readily available, it has become increasingly important to design studies and use analytical techniques that

More information

Processing Genome Data using Scalable Database Technology. My Background

Processing Genome Data using Scalable Database Technology. My Background Johann Christoph Freytag, Ph.D. freytag@dbis.informatik.hu-berlin.de http://www.dbis.informatik.hu-berlin.de Stanford University, February 2004 PhD @ Harvard Univ. Visiting Scientist, Microsoft Res. (2002)

More information

Big Data. Tom Plunkett Senior Consultant

Big Data. Tom Plunkett Senior Consultant Big Data Tom Plunkett Senior Consultant 2 Copyright 2013, Oracle and/or its affiliates. All rights reserved. Big Data in Healthcare Find relationship between gene to cancer interaction Use Case Cross-referenced

More information

Survey of clinical data mining applications on big data in health informatics

Survey of clinical data mining applications on big data in health informatics Survey of clinical data mining applications on big data in health informatics Matthew Herland, Taghi M. Khoshgoftaar, and Randall Wald 劉 俊 成 Survey of clinical data mining applications on big data in health

More information

Alison Yao, Ph.D. July 2014

Alison Yao, Ph.D. July 2014 * Alison Yao, Ph.D. Program Officer, Office of Genomics and Advanced Technologies Division of Microbiology and Infectious Diseases National Institute of Allergy and Infectious Diseases National Institutes

More information

DECLARATION OF PERFORMANCE NO. HU-DOP_TN-212-25_001

DECLARATION OF PERFORMANCE NO. HU-DOP_TN-212-25_001 NO. HU-DOP_TN-212-25_001 Product type 212 (TN) 3,5x25 mm EN 14566:2008+A1:2009 NO. HU-DOP_TN-212-35_001 Product type 212 (TN) 3,5x35 mm EN 14566:2008+A1:2009 NO. HU-DOP_TN-212-45_001 Product type 212 (TN)

More information

Web-Based Genomic Information Integration with Gene Ontology

Web-Based Genomic Information Integration with Gene Ontology Web-Based Genomic Information Integration with Gene Ontology Kai Xu 1 IMAGEN group, National ICT Australia, Sydney, Australia, kai.xu@nicta.com.au Abstract. Despite the dramatic growth of online genomic

More information

Targeted. sequencing solutions. Accurate, scalable, fast TARGETED

Targeted. sequencing solutions. Accurate, scalable, fast TARGETED Targeted TARGETED Sequencing sequencing solutions Accurate, scalable, fast Sequencing for every lab, every budget, every application Ion Torrent semiconductor sequencing Ion Torrent technology has pioneered

More information

Integration of data management and analysis for genome research

Integration of data management and analysis for genome research Integration of data management and analysis for genome research Volker Brendel Deparment of Zoology & Genetics and Department of Statistics Iowa State University 2112 Molecular Biology Building Ames, Iowa

More information

DNA Sequence formats

DNA Sequence formats DNA Sequence formats [Plain] [EMBL] [FASTA] [GCG] [GenBank] [IG] [IUPAC] [How Genomatix represents sequence annotation] Plain sequence format A sequence in plain format may contain only IUPAC characters

More information

Genome and DNA Sequence Databases. BME 110/BIOL 181 CompBio Tools Todd Lowe March 31, 2009

Genome and DNA Sequence Databases. BME 110/BIOL 181 CompBio Tools Todd Lowe March 31, 2009 Genome and DNA Sequence Databases BME 110/BIOL 181 CompBio Tools Todd Lowe March 31, 2009 Admin Reading: Chapters 1 & 2 Notes available in PDF format on-line (see class calendar page): http://www.soe.ucsc.edu/classes/bme110/spring09/bme110-calendar.html

More information

BIOINF 585 Fall 2015 Machine Learning for Systems Biology & Clinical Informatics http://www.ccmb.med.umich.edu/node/1376

BIOINF 585 Fall 2015 Machine Learning for Systems Biology & Clinical Informatics http://www.ccmb.med.umich.edu/node/1376 Course Director: Dr. Kayvan Najarian (DCM&B, kayvan@umich.edu) Lectures: Labs: Mondays and Wednesdays 9:00 AM -10:30 AM Rm. 2065 Palmer Commons Bldg. Wednesdays 10:30 AM 11:30 AM (alternate weeks) Rm.

More information

RT 2 Profiler PCR Array: Web-Based Data Analysis Tutorial

RT 2 Profiler PCR Array: Web-Based Data Analysis Tutorial RT 2 Profiler PCR Array: Web-Based Data Analysis Tutorial Samuel J. Rulli, Jr., Ph.D. qpcr-applications Scientist Samuel.Rulli@QIAGEN.com Pathway Focused Research from Sample Prep to Data Analysis! -2-

More information

Bagged Ensembles of Support Vector Machines for Gene Expression Data Analysis

Bagged Ensembles of Support Vector Machines for Gene Expression Data Analysis Bagged Ensembles of Support Vector Machines for Gene Expression Data Analysis Giorgio Valentini DSI, Dip. di Scienze dell Informazione Università degli Studi di Milano, Italy INFM, Istituto Nazionale di

More information

GMQL Functional Comparison with BEDTools and BEDOPS

GMQL Functional Comparison with BEDTools and BEDOPS GMQL Functional Comparison with BEDTools and BEDOPS Genomic Computing Group Dipartimento di Elettronica, Informazione e Bioingegneria Politecnico di Milano This document presents a functional comparison

More information

Scientific databases. Biological data management

Scientific databases. Biological data management Scientific databases Biological data management The term paper within the framework of the course Principles of Modern Database Systems by Aleksejs Kontijevskis PhD student The Linnaeus Centre for Bioinformatics

More information

Module 1. Sequence Formats and Retrieval. Charles Steward

Module 1. Sequence Formats and Retrieval. Charles Steward The Open Door Workshop Module 1 Sequence Formats and Retrieval Charles Steward 1 Aims Acquaint you with different file formats and associated annotations. Introduce different nucleotide and protein databases.

More information

Analisi in silicoe relazione tra enterotossine stafilococciche e tossine ipotetiche

Analisi in silicoe relazione tra enterotossine stafilococciche e tossine ipotetiche IZSTO Istituto Zooprofilattico Sperimentale del Piemonte, Liguria e Valle d Aosta VI WORKSHOP DEL LABORATORIO NAZIONALE DI RIFERIMENTO (NRL) PER GLI STAFILOCOCCHI COAGULASI POSITIVI COMPRESO S.AUREUS 12

More information

SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications

SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications Product Bulletin Sequencing Software SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications Comprehensive reference sequence handling Helps interpret the role of each

More information

diagnosis through Random

diagnosis through Random Convegno Calcolo ad Alte Prestazioni "Biocomputing" Bio-molecular diagnosis through Random Subspace Ensembles of Learning Machines Alberto Bertoni, Raffaella Folgieri, Giorgio Valentini DSI Dipartimento

More information

Data Integration and Decision-Making For Biomarkers Discovery, Validation and Evaluation. D. POLVERARI, CTO October 06-07 2008

Data Integration and Decision-Making For Biomarkers Discovery, Validation and Evaluation. D. POLVERARI, CTO October 06-07 2008 Data Integration and Decision-Making For Biomarkers Discovery, Validation and Evaluation D. POLVERARI, CTO October 06-07 2008 Data integration definition and aims Definition : Data integration consists

More information

Biomedical Big Data and Precision Medicine

Biomedical Big Data and Precision Medicine Biomedical Big Data and Precision Medicine Jie Yang Department of Mathematics, Statistics, and Computer Science University of Illinois at Chicago October 8, 2015 1 Explosion of Biomedical Data 2 Types

More information

How To Use The Assembly Database In A Microarray (Perl) With A Microarcode) (Perperl 2) (For Macrogenome) (Genome 2)

How To Use The Assembly Database In A Microarray (Perl) With A Microarcode) (Perperl 2) (For Macrogenome) (Genome 2) The Ensembl Core databases and API Useful links Installation instructions: http://www.ensembl.org/info/docs/api/api_installation.html Schema description: http://www.ensembl.org/info/docs/api/core/core_schema.html

More information

Big Data and Text Mining

Big Data and Text Mining Big Data and Text Mining Dr. Ian Lewin Senior NLP Resource Specialist Ian.lewin@linguamatics.com www.linguamatics.com About Linguamatics Boston, USA Cambridge, UK Software Consulting Hosted content Agile,

More information

Presente e futuro del Web Semantico

Presente e futuro del Web Semantico Sistemi di Elaborazione dell informazione II Corso di Laurea Specialistica in Ingegneria Telematica II anno 4 CFU Università Kore Enna A.A. 2009-2010 Alessandro Longheu http://www.diit.unict.it/users/alongheu

More information

Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs)

Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs) Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs) Single nucleotide polymorphisms or SNPs (pronounced "snips") are DNA sequence variations that occur

More information

How To Become A Geneticist

How To Become A Geneticist Number of Biostatistically, Epidemiologically, or Biologically based Courses Number of Health Management/Law based classes School Courses Centers Other Boston U BS858 Statistical 3 2 BS860 Statistical

More information

Enhancing Functionality of EHRs for Genomic Research, Including E- Phenotying, Integrating Genomic Data, Transportable CDS, Privacy Threats

Enhancing Functionality of EHRs for Genomic Research, Including E- Phenotying, Integrating Genomic Data, Transportable CDS, Privacy Threats Enhancing Functionality of EHRs for Genomic Research, Including E- Phenotying, Integrating Genomic Data, Transportable CDS, Privacy Threats Genomic Medicine 8 meeting Alexa McCray Christopher G Chute Rex

More information

FRANCESCO BELLOCCHIO S CURRICULUM VITAE ET STUDIORUM

FRANCESCO BELLOCCHIO S CURRICULUM VITAE ET STUDIORUM FRANCESCO BELLOCCHIO S CURRICULUM VITAE ET STUDIORUM April 2011 Index Personal details and education 1 Research activities 2 Teaching and tutorial activities 3 Conference organization and review activities

More information

A Multiple DNA Sequence Translation Tool Incorporating Web Robot and Intelligent Recommendation Techniques

A Multiple DNA Sequence Translation Tool Incorporating Web Robot and Intelligent Recommendation Techniques Proceedings of the 2007 WSEAS International Conference on Computer Engineering and Applications, Gold Coast, Australia, January 17-19, 2007 402 A Multiple DNA Sequence Translation Tool Incorporating Web

More information

Introduction to Bioinformatics 3. DNA editing and contig assembly

Introduction to Bioinformatics 3. DNA editing and contig assembly Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 matthewb@ba.ars.usda.gov

More information

Human Genome and Human Genome Project. Louxin Zhang

Human Genome and Human Genome Project. Louxin Zhang Human Genome and Human Genome Project Louxin Zhang A Primer to Genomics Cells are the fundamental working units of every living systems. DNA is made of 4 nucleotide bases. The DNA sequence is the particular

More information

BIO 3352: BIOINFORMATICS II HYBRID COURSE SYLLABUS

BIO 3352: BIOINFORMATICS II HYBRID COURSE SYLLABUS BIO 3352: BIOINFORMATICS II HYBRID COURSE SYLLABUS NEW YORK CITY COLLEGE OF TECHNOLOGY The City University Of New York School of Arts and Sciences Biological Sciences Department Course title: Bioinformatics

More information

Current Motif Discovery Tools and their Limitations

Current Motif Discovery Tools and their Limitations Current Motif Discovery Tools and their Limitations Philipp Bucher SIB / CIG Workshop 3 October 2006 Trendy Concepts and Hypotheses Transcription regulatory elements act in a context-dependent manner.

More information

Using Graph Theory to Analyze Gene Network Coherence

Using Graph Theory to Analyze Gene Network Coherence Using Graph Theory to Analyze Gene Network Coherence Francisco A. Gómez-Vela fgomez@upo.es Norberto Díaz-Díaz ndiaz@upo.es José A. Lagares José A. Sánchez Jesús S. Aguilar 1 Outlines Introduction Proposed

More information

Genevestigator Training

Genevestigator Training Genevestigator Training Gent, 6 November 2012 Philip Zimmermann, Nebion AG Goals Get to know Genevestigator What Genevestigator is for For who Genevestigator was created How to use Genevestigator for your

More information

Biological Sequence Data Formats

Biological Sequence Data Formats Biological Sequence Data Formats Here we present three standard formats in which biological sequence data (DNA, RNA and protein) can be stored and presented. Raw Sequence: Data without description. FASTA

More information

Health Data Analytics and Decision Support Prof.Dr. Bart De Moor

Health Data Analytics and Decision Support Prof.Dr. Bart De Moor Bart.DeMoor@iminds.be iminds Department MEDICAL IT Health Data Analytics and Decision Support Prof.Dr. Bart De Moor Department Med IT Trends P3 x P4 medicine Decision support cases MEDICAL IT DEPARTMENT

More information

Note: This document wh_informatics_practical.doc and supporting materials can be downloaded at

Note: This document wh_informatics_practical.doc and supporting materials can be downloaded at Woods Hole Zebrafish Genetics and Development Bioinformatics/Genomics Lab Ian Woods Note: This document wh_informatics_practical.doc and supporting materials can be downloaded at http://faculty.ithaca.edu/iwoods/docs/wh/

More information

Pengyu Hong BioX program, Department of Statistics, Stanford University, Stanford, CA 94305-4065. Email: pengyuhong@stanford.edu

Pengyu Hong BioX program, Department of Statistics, Stanford University, Stanford, CA 94305-4065. Email: pengyuhong@stanford.edu UBIC 2 Towards Ubiquitous Bio-Information Computing: Data Protocols, Middleware, and Web Services for Heterogeneous Biological Information Integration and Retrieval Pengyu Hong BioX program, Department

More information

Microarray Data Analysis. A step by step analysis using BRB-Array Tools

Microarray Data Analysis. A step by step analysis using BRB-Array Tools Microarray Data Analysis A step by step analysis using BRB-Array Tools 1 EXAMINATION OF DIFFERENTIAL GENE EXPRESSION (1) Objective: to find genes whose expression is changed before and after chemotherapy.

More information

Becker Muscular Dystrophy

Becker Muscular Dystrophy Muscular Dystrophy A Case Study of Positional Cloning Described by Benjamin Duchenne (1868) X-linked recessive disease causing severe muscular degeneration. 100 % penetrance X d Y affected male Frequency

More information

Global and Discovery Proteomics Lecture Agenda

Global and Discovery Proteomics Lecture Agenda Global and Discovery Proteomics Christine A. Jelinek, Ph.D. Johns Hopkins University School of Medicine Department of Pharmacology and Molecular Sciences Middle Atlantic Mass Spectrometry Laboratory Global

More information

Distributed Data Mining in Discovery Net. Dr. Moustafa Ghanem Department of Computing Imperial College London

Distributed Data Mining in Discovery Net. Dr. Moustafa Ghanem Department of Computing Imperial College London Distributed Data Mining in Discovery Net Dr. Moustafa Ghanem Department of Computing Imperial College London 1. What is Discovery Net 2. Distributed Data Mining for Compute Intensive Tasks 3. Distributed

More information

Research Data Integration of Retrospective Studies for Prediction of Disease Progression A White Paper. By Erich A. Gombocz

Research Data Integration of Retrospective Studies for Prediction of Disease Progression A White Paper. By Erich A. Gombocz Research Data Integration of Retrospective Studies for Prediction of Disease Progression A White Paper By Erich A. Gombocz 2 Research Data Integration of Retrospective Studies for Prediction of Disease

More information

Distributed Bioinformatics Computing System for DNA Sequence Analysis

Distributed Bioinformatics Computing System for DNA Sequence Analysis Global Journal of Computer Science and Technology: A Hardware & Computation Volume 14 Issue 1 Version 1.0 Type: Double Blind Peer Reviewed International Research Journal Publisher: Global Journals Inc.

More information

From Immunotherapy of Cancer to the Discovery of Kidney Cancer Genes

From Immunotherapy of Cancer to the Discovery of Kidney Cancer Genes ISSN 2154-4006 The Genetic Basis of Human Disease zbar Colloquium series on Series Editor: Michael Dean, Ph.D., Head, Human Genetics Section, Senior Investigator, Laboratory of Experimental Immunology

More information

ZFIN Anatomy Pages - 3 Great Reasons Why You Need to Use Them

ZFIN Anatomy Pages - 3 Great Reasons Why You Need to Use Them ZFIN NEWS The Zebrafish Information Network http://zfin.org Volume 5, Number 1 Spring 2008 In this issue: Maximizing Data Impact (pg.1) (pg.1) Full Text publications (pg.3) Morpholino Database (MODB) and

More information

Software reviews. Expression Pro ler: A suite of web-based tools for the analysis of microarray gene expression data

Software reviews. Expression Pro ler: A suite of web-based tools for the analysis of microarray gene expression data Expression Pro ler: A suite of web-based tools for the analysis of microarray gene expression data DNA microarray analysis 1±3 has become one of the most widely used tools for the analysis of gene expression

More information

Search and Data Mining: Techniques. Applications Anya Yarygina Boris Novikov

Search and Data Mining: Techniques. Applications Anya Yarygina Boris Novikov Search and Data Mining: Techniques Applications Anya Yarygina Boris Novikov Introduction Data mining applications Data mining system products and research prototypes Additional themes on data mining Social

More information

Core Facility Genomics

Core Facility Genomics Core Facility Genomics versatile genome or transcriptome analyses based on quantifiable highthroughput data ascertainment 1 Topics Collaboration with Harald Binder and Clemens Kreutz Project: Microarray

More information

Data Integration of Bioinformatics Database Based on Web Services

Data Integration of Bioinformatics Database Based on Web Services Data Integration of Bioinformatics Database Based on Web Services Yuelan Liu, Jian hua Wang College of Computer, Harbin Normal University Intelligent Education Information Technology Emphases Lab of Heilongjiang

More information

Superior TrueMAB TM monoclonal antibodies for the recognition of proteins native epitopes

Superior TrueMAB TM monoclonal antibodies for the recognition of proteins native epitopes Superior TrueMAB TM monoclonal antibodies for the recognition of proteins native epitopes Outlines Brief introduction of OriGene s mission on gene-centric product solution. TrueMAB monoclonal antibody

More information

A leader in the development and application of information technology to prevent and treat disease.

A leader in the development and application of information technology to prevent and treat disease. A leader in the development and application of information technology to prevent and treat disease. About MOLECULAR HEALTH Molecular Health was founded in 2004 with the vision of changing healthcare. Today

More information

Preparing the scenario for the use of patient s genome sequences in clinic. Joaquín Dopazo

Preparing the scenario for the use of patient s genome sequences in clinic. Joaquín Dopazo Preparing the scenario for the use of patient s genome sequences in clinic Joaquín Dopazo Computational Medicine Institute, Centro de Investigación Príncipe Felipe (CIPF), Functional Genomics Node, (INB),

More information

M110.726 The Nucleus M110.727 The Cytoskeleton M340.703 Cell Structure and Dynamics

M110.726 The Nucleus M110.727 The Cytoskeleton M340.703 Cell Structure and Dynamics of Biochemistry and Molecular Biology 1. Master the knowledge base of current biochemistry, molecular biology, and cellular physiology Describe current knowledge in metabolic transformations conducted

More information

BIOINF 525 Winter 2016 Foundations of Bioinformatics and Systems Biology http://tinyurl.com/bioinf525-w16

BIOINF 525 Winter 2016 Foundations of Bioinformatics and Systems Biology http://tinyurl.com/bioinf525-w16 Course Director: Dr. Barry Grant (DCM&B, bjgrant@med.umich.edu) Description: This is a three module course covering (1) Foundations of Bioinformatics, (2) Statistics in Bioinformatics, and (3) Systems

More information

Analyzing rare diseases terms in biomedical terminologies

Analyzing rare diseases terms in biomedical terminologies Analyzing rare diseases terms in biomedical terminologies Erika Pasceri Introduction A rare disease is a pathological condition with low prevalence and incidence. There are between 6000 and 8000 rare diseases.

More information

Software and Methods for the Analysis of Affymetrix GeneChip Data. Rafael A Irizarry Department of Biostatistics Johns Hopkins University

Software and Methods for the Analysis of Affymetrix GeneChip Data. Rafael A Irizarry Department of Biostatistics Johns Hopkins University Software and Methods for the Analysis of Affymetrix GeneChip Data Rafael A Irizarry Department of Biostatistics Johns Hopkins University Outline Overview Bioconductor Project Examples 1: Gene Annotation

More information

DEPARTMENT OF HEALTH AND HUMAN SERVICES NATIONAL INSTITUTES OF HEALTH. National Library of Medicine (NLM) Organization Chart...2

DEPARTMENT OF HEALTH AND HUMAN SERVICES NATIONAL INSTITUTES OF HEALTH. National Library of Medicine (NLM) Organization Chart...2 DEPARTMENT OF HEALTH AND HUMAN SERVICES NATIONAL INSTITUTES OF HEALTH (NLM) FY 2015 Budget Page No. Organization Chart...2 Appropriation Language...3 Amounts Available for Obligation...4 Budget Mechanism

More information

DNA and the Cell. Version 2.3. English version. ELLS European Learning Laboratory for the Life Sciences

DNA and the Cell. Version 2.3. English version. ELLS European Learning Laboratory for the Life Sciences DNA and the Cell Anastasios Koutsos Alexandra Manaia Julia Willingale-Theune Version 2.3 English version ELLS European Learning Laboratory for the Life Sciences Anastasios Koutsos, Alexandra Manaia and

More information

arxiv:1305.4455v1 [cs.dl] 20 May 2013

arxiv:1305.4455v1 [cs.dl] 20 May 2013 SHARE: A Web Service Based Framework for Distributed Querying and Reasoning on the Semantic Web Ben P Vandervalk, E Luke McCarthy, and Mark D Wilkinson arxiv:1305.4455v1 [cs.dl] 20 May 2013 The Providence

More information

CURRICULUM VITAE. Ilaria.giordani@disco.unimib.it. Phd in computer science

CURRICULUM VITAE. Ilaria.giordani@disco.unimib.it. Phd in computer science CURRICULUM VITAE PERSONAL INFORMATION Name Address Giordani Ilaria Via Volturno 13 22063 Cantù (Co) Mobile phone number (+ 39) 333.8725026 Phone number (+ 39) 031.712957 E-mail Ilaria.giordani@disco.unimib.it

More information

User. Annotation. Interfaces. Flatfile ASN.1 NCBI GDB GSDB. GenBank. sequence data. experimental verification. annotation database.

User. Annotation. Interfaces. Flatfile ASN.1 NCBI GDB GSDB. GenBank. sequence data. experimental verification. annotation database. The GAIA Software Framework for Genome Annotation G. Christian Overton, Charles Bailey, Jonathan Crabtree, Mark Gibson, Stephen Fischer and Jonathan Schug Center for Bioinformatics University ofpennsylvania

More information