Biomedical Big Data and Precision Medicine
|
|
|
- Kathryn Watkins
- 10 years ago
- Views:
Transcription
1 Biomedical Big Data and Precision Medicine Jie Yang Department of Mathematics, Statistics, and Computer Science University of Illinois at Chicago October 8, 2015
2 1 Explosion of Biomedical Data 2 Types and Sources of Biomedical Data Electronic clinical data DNA sequencing data DNA variation: SNP data Gene expression data: DNA microarray and RNA-Seq CNV and DNA methylation data 3 Precision Medicine Precision medicine vs. personalized medicine Precision medicine in genetic disease Precision medicine: prevention Biobanking and data sharing 4 Permanental Classification Approach
3 Explosion of Biomedical Data: Electronic Medical Records Hospitals and medical centers are collecting and maintaining comprehensive medical records electronically. For example, a comprehensive dataset extracted from the Advocate Health and Hospitals Corporation database contains the electronic medical records of 109,421 adult inpatients (162,466 encounters) discharged between March 1, 2011 and July 31, Electronic medical data may facilitate health study researchers to identify important traits associated with complex disease and evaluate the corresponding treatments or therapies.
4 Explosion of Biomedical Data: Genomic Data Genomic data of a large cohort of individuals are assembled and become available for health study researches. The emerge consortium funded by the National Human Genome Research Institute combines electronic medical records and genomic data from almost 200,000 individuals (Ashley, 2015). The combined data are extremely high-dimensional and also becoming bigger and bigger, especially the genomic part. The first-generation genomic data from genotyping chips targets genetic variants of about 20,000 genes, while the gnome sequencing technique (about 10-fold more expensive than chips) can provide 1000-fold more data (Ashley, 2015).
5 Electronic Clinical Data: Advocate Database Collected from eight Advocate Health Care hospitals. It includes 109,421 adult inpatients (162,466 index admissions) discharged from March 1, 2011 to July 31, There are 298 independent variables, including: (1) administration variables: age, gender, race, quarter of index admission, insurance, medical service group, language, employment status, marriage status, discharge disposition, against medical advice (AMA) at discharge, AMA history, Braden score, Charlson comorbidity index, number of emergency room, number of observation and number of inpatient in the last year and the last 6 months; (2) current and history condition, procedure and medication variables; (3) lab test results during the index admission.
6 Request Data from Database: An SQL Example drop table IF EXISTS de ; select distinct population_id, empi_id into local temp table de ON COMMIT PRESERVE ROWS from( union: select distinct empi_id,population_id from APP_IL_2014.PH_F_Claim_detail where service_from_date>= and service_to_date< union select distinct empi_id,population_id from APP_IL_2014.PH_F_Claim where stmt_from_date>= and stmt_to_date< )a where population_id= 2feb2cb1-be a21f-4e2ef1a40340 ;
7 Genomic Data: DNA Sequencing Data A genome is the sum of all the DNA in an organism. There are four types of chemical bases in a genome: A, T, C, and G. The human genome consists of 23 chromosome pairs and has 3 billion pairs of bases ( nucleotides). Shotgun sequencing: Developed in Break longer DNA sequences into random small segments and sequence them to obtain reads, then assemble short reads into a continuous sequence. High-throughput (or next-generation) sequencing: First developed in Parallelize the sequencing process and producing thousands or millions of sequences at once.
8 DNA Sequencing Data: An Example >gi ref NC_ Homo sapiens chromosome 1, GRCh38.p2 Primary Assembly... CCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTA ACCCTAACCCTAACCCTAACCCTAACCCAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCC TAACCCTAACCCTAACCCTAACCCTAACCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACC CTAACCCTAACCCCTAACCCTAACCCTAAACCCTAAACCCTAACCCTAACCCTAACCCTAACCCTAACCC CAACCCCAACCCCAACCCCAACCCCAACCCCAACCCTAACCCCTAACCCTAACCCTAACCCTACCCTAAC CCTAACCCTAACCCTAACCCTAACCCTAACCCCTAACCCCTAACCCTAACCCTAACCCTAACCCTAACCC TAACCCTAACCCCTAACCCTAACCCTAACCCTAACCCTCGCGGTACCCTCAGCCGGCCCGCCCGCCCGGG TCTGACCTGAGGAGAACTGTGCTCCGCCTTCAGAGTACCACCGAAATCTGTGCAGAGGACAACGCAGCTC CGCCCTCGCGGTGCTCTCCGGGTCTGTGCTGAGGAGAACGCAACTCCGCCGTTGCAAAGGCGCGCCGCGC CGGCGCAGGCGCAGAGAGGCGCGCCGCGCCGGCGCAGGCGCAGAGAGGCGCGCCGCGCCGGCGCAGGCGC AGAGAGGCGCGCCGCGCCGGCGCAGGCGCAGAGAGGCGCGCCGCGCCGGCGCAGGCGCAGAGAGGCGCGC CGCGCCGGCGCAGGCGCAGACACATGCTAGCGCGTCGGGGTGGAGGCGTGGCGCAGGCGCAGAGAGGCGC GCCGCGCCGGCGCAGGCGCAGAGACACATGCTACCGCGTCCAGGGGTGGAGGCGTGGCGCAGGCGCAGAG AGGCGCACCGCGCCGGCGCAGGCGCAGAGACACATGCTAGCGCGTCCAGGGGTGGAGGCGTGGCGCAGGC GCAGAGACGCAAGCCTACGGGCGGGGGTTGGGGGGGCGTGTGTTGCAGGAGCAAAGTCGCACGGCGCCGG GCTGGGGCGGGGGGAGGGTGGCGCCGTGCACGCGCAGAAACTCACGTCACGGTGGCGCGGCGCAGAGACG...
9 Single Nucleotide Polymorphism (SNP) A single nucleotide polymorphism (SNP, pronounced snip) is a DNA sequence variation occurring commonly within a population (e.g. 1%). For example, two sequenced DNA fragments from different individuals, AAGCCTA to AAGCTTA, contain a difference in a single nucleotide. SNPs occur in non-coding regions more frequently than in coding regions. As of June 8, 2015, dbsnp listed 149,735,377 SNPs in humans ( A single SNP may cause a Mendelian disease. Examples include sickle-cell anemia, cystic fibrosis. For complex diseases, SNPs do not usually function individually.
10 DNA Microarray Data A DNA microarray (also known as DNA chip) measures the expression levels of large numbers of genes simultaneously. For example, Arrayit s H25K ( contains 25,509 fully annotated human genes.
11 Alternative Technology: RNA-Seq RNA-seq (RNA sequencing) uses next-generation sequencing to reveal a snapshot of RNA presence, which can detect previously unidentified genes or transcripts.
12 Other Types of Genomic Data Copy number variation (CNV): a structural variation, more than one copies of sections of DNA. DNA methylation: Methyl groups are added to DNA (see
13 Precision Medicine Initiative Precision medicine refers to precisely classifying individuals into subpopulations according to a particular disease and precisely tailoring of medical treatments to subcategories of the disease (Committee on a Framework for Developing a New Taxonomy of Disease, 2011; Collins and Varmus, 2015; Ashley, 2015). Most medical treatments have been designed for the average patient. Treatments can be very successful for some patients but not for others. Precision medicine takes into account individual differences in peoples genes, environments, and lifestyles for disease prevention and treatment. Launched with a $215 million investment in the President s 2016 Budget, the Precision Medicine Initiative will pioneer a new model of patient-powered research.
14 Precision Medicine vs. Personalized Medicine Precision Medicine classifies individuals into subpopulations. Personalized Medicine literally means the creation of drugs or medical devices that are unique to a patient.
15 Precision Medicine in Genetic Disease: An Example An example of precision medicine is the treatment of cystic fibrosis (inherited life-threatening disorder that damages the lungs and digestive system) with ivacaftor (Ramsey et al., 2011). The disease can be divided according to whether the defective channel reaches the cell surface or not. Ivacaftor (a potential treatment) increases the opening probability of the channel so that it is only effective in the subset of patients in whom the channel reaches the surface. The Cystic Fibrosis Foundation co-invested $150 million in the development of a particular drug targeting a precise subclass of patients. That initial investment increased in value to $3.3 billion by the time of the sale of the royalty rights in 2014 (Ashley, 2015).
16 Precision Medicine: Prevention A more sophisticated understanding of disease will almost certainly lead to more targeted and cost effective screening. One example is familial hypercholesterolemia (a genetic disorder characterized by high cholesterol levels), which carries a tier 1 recommendation for family screening from the Centers for Disease Control and Prevention. This genetic condition, which may be as common as 1:250 in the population, is associated with early myocardial infarction (heart attack). Cascade family screening with lipid panels and genetic testing has been shown to be highly cost-effective in identifying cases for potentially life-saving cholesterol-lowering therapy.
17 Biobanking and Data Sharing (Ashley, 2015) One major focus of the precision medicine initiative is the assembly of a large cohort of individuals willing to share their electronic medical record data and genomic data. In the first generation, genotyping chips targets the sequence of the approximately 20,000 genes. The next-generation sequencing technology is about 10-fold more expensive than chips, albeit for 1000-fold more data. The Million Veteran Program reports recruitment currently at more than 300,000 individuals, with thousands having been sequenced and hundreds of thousands having been genotyped. The emerge consortium combines electronic medical record data and genomic data from almost 200,000 individuals.
18 High-dimensional Classification and Clustering Achieving the goals of precision medicine requires sophisticated statistical and computational methods for high-dimensional classification and clustering. For a good review on commonly used classification and clustering methods, see, for example, Hastie et al. (2009). The medical records and genomic data of some patients may be collected under the same class label, say, lung cancer. How do we cluster the lung cancer patients into homogeneous subgroups so that the patients belonging to the same subgroup could be treated by a same therapy successfully? This is a clustering problem. If the clustering is successful, the next step would be classifying a new patient into one of the identified subgroups so that the patient could be treated by the most suitable therapy. This is a classification problem.
19 Permanental Classification Approach (Yang, Miescke, and McCullagh, 2012) Permanental classification approach assumes that the observations of each cluster follow a permanental process (a Cox process with a special random intensity). Given the observations x = {x 1,..., x n } with or without class labels y = {y 1,..., y n }, the conditional distribution of the labels is p n (y x) = per α 1 ( K[x (1) ] ) per αk ( K[x (k) ] ) per α1 + +α k (K[x]) Given a new unit u with feature value x, p n+1 (y(u ) = r data) per α r ( K[x (r) {x }] ) per αr ( K[x (r) ] )
20 Leukemia Data (Golub et al., 1999)
21 Two-Dimensional Display of Training Data Training data: 38 samples (27 ALL, 11 AML) Testing data: 34 samples (20 ALL, 14 AML) Uncertain testing units (Golub et al., 1999): No. 54, 57, 60, 66, 67 Two Dim Display Based on Training Data 1st PCA ALL AML Testing Unit mean difference
22 Number of Test Errors on Average (Dudoit et al. 2002) number of errors on average DLDA k NN SVM K2 K number of genes used
23 Predicting Hypertension (Huang, Xu, and Yang, 2014) Genome-wide association study (GWAS) data of 1043 individuals, three measurements for most participants, four time intervals (1981 to 1996, 1997 to 2000, 1998 to 2006 and 2009 to 2011), single-nucleotide polymorphisms (SNPs) Prediction Errors of SVM and PC Using Common Variants Number of SNPs n=0 n=5 n=10 n=20 n=50 n=100 n=200 SVM (training) SVM (testing) PC (training) PC (testing) The best prediction error rates of SVM and PC are both close to 12%, which is much better than the error rate 22% based on logistic regression model.
24 Reference Ashley, E. (2015). The precision medicine initiative: A new national effort. JAMA, 313(21), Wang, Gerstein, and Snyder (2009). RNA-Seq: a revolutionary tool for transcriptomics, Nature Reviews Genetics, 10, Collins, F. and H. Varmus (2015). A new initiative on precision medicine. New England Journal of Medicine, 372(9), Hastie, T., R. Tibshirani, and J. Friedman (2009). The Elements of Statistical Learning: Data Mining, Inference, and Prediction. Springer, 2nd ed. Huang, HH, Xu, T., and Yang, J. (2014). Comparing Logistic Regression, Support Vector Machines and Permanental Classification Methods in Predicting Hypertension, BMC Proceedings, 8, Suppl.1:S96. Ramsey BW, Davies J, McElvaney NG, et al; VX Study Group (2011). A CFTR potentiator in patients with cystic fibrosis and the G551D mutation. New England Journal of Medicine, 365(18), Yang, J., Miescke, K., and McCullagh, P. (2012). Classification based on a permanental process with cyclic approximation. Biometrika, 99,
School of Nursing. Presented by Yvette Conley, PhD
Presented by Yvette Conley, PhD What we will cover during this webcast: Briefly discuss the approaches introduced in the paper: Genome Sequencing Genome Wide Association Studies Epigenomics Gene Expression
GENETIC DATA ANALYSIS
GENETIC DATA ANALYSIS 1 Genetic Data: Future of Personalized Healthcare To achieve personalization in Healthcare, there is a need for more advancements in the field of Genomics. The human genome is made
A Primer of Genome Science THIRD
A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:
Core Facility Genomics
Core Facility Genomics versatile genome or transcriptome analyses based on quantifiable highthroughput data ascertainment 1 Topics Collaboration with Harald Binder and Clemens Kreutz Project: Microarray
NGS and complex genetics
NGS and complex genetics Robert Kraaij Genetic Laboratory Department of Internal Medicine [email protected] Gene Hunting Rotterdam Study and GWAS Next Generation Sequencing Gene Hunting Mendelian gene
14.3 Studying the Human Genome
14.3 Studying the Human Genome Lesson Objectives Summarize the methods of DNA analysis. State the goals of the Human Genome Project and explain what we have learned so far. Lesson Summary Manipulating
Biological Sciences Initiative. Human Genome
Biological Sciences Initiative HHMI Human Genome Introduction In 2000, researchers from around the world published a draft sequence of the entire genome. 20 labs from 6 countries worked on the sequence.
Genomes and SNPs in Malaria and Sickle Cell Anemia
Genomes and SNPs in Malaria and Sickle Cell Anemia Introduction to Genome Browsing with Ensembl Ensembl The vast amount of information in biological databases today demands a way of organising and accessing
Human Genome Organization: An Update. Genome Organization: An Update
Human Genome Organization: An Update Genome Organization: An Update Highlights of Human Genome Project Timetable Proposed in 1990 as 3 billion dollar joint venture between DOE and NIH with 15 year completion
Factors for success in big data science
Factors for success in big data science Damjan Vukcevic Data Science Murdoch Childrens Research Institute 16 October 2014 Big Data Reading Group (Department of Mathematics & Statistics, University of Melbourne)
Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center
Computational Challenges in Storage, Analysis and Interpretation of Next-Generation Sequencing Data Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center Next Generation Sequencing
Mathematical Models of Supervised Learning and their Application to Medical Diagnosis
Genomic, Proteomic and Transcriptomic Lab High Performance Computing and Networking Institute National Research Council, Italy Mathematical Models of Supervised Learning and their Application to Medical
Sequencing and microarrays for genome analysis: complementary rather than competing?
Sequencing and microarrays for genome analysis: complementary rather than competing? Simon Hughes, Richard Capper, Sandra Lam and Nicole Sparkes Introduction The human genome is comprised of more than
Comparison of Non-linear Dimensionality Reduction Techniques for Classification with Gene Expression Microarray Data
CMPE 59H Comparison of Non-linear Dimensionality Reduction Techniques for Classification with Gene Expression Microarray Data Term Project Report Fatma Güney, Kübra Kalkan 1/15/2013 Keywords: Non-linear
Next Generation Sequencing: Adjusting to Big Data. Daniel Nicorici, Dr.Tech. Statistikot Suomen Lääketeollisuudessa 29.10.2013
Next Generation Sequencing: Adjusting to Big Data Daniel Nicorici, Dr.Tech. Statistikot Suomen Lääketeollisuudessa 29.10.2013 Outline Human Genome Project Next-Generation Sequencing Personalized Medicine
How many of you have checked out the web site on protein-dna interactions?
How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss
SAP HANA Enabling Genome Analysis
SAP HANA Enabling Genome Analysis Joanna L. Kelley, PhD Postdoctoral Scholar, Stanford University Enakshi Singh, MSc HANA Product Management, SAP Labs LLC Outline Use cases Genomics review Challenges in
Gene mutation and molecular medicine Chapter 15
Gene mutation and molecular medicine Chapter 15 Lecture Objectives What Are Mutations? How Are DNA Molecules and Mutations Analyzed? How Do Defective Proteins Lead to Diseases? What DNA Changes Lead to
Human Genome and Human Genome Project. Louxin Zhang
Human Genome and Human Genome Project Louxin Zhang A Primer to Genomics Cells are the fundamental working units of every living systems. DNA is made of 4 nucleotide bases. The DNA sequence is the particular
SNP Essentials The same SNP story
HOW SNPS HELP RESEARCHERS FIND THE GENETIC CAUSES OF DISEASE SNP Essentials One of the findings of the Human Genome Project is that the DNA of any two people, all 3.1 billion molecules of it, is more than
Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs)
Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs) Single nucleotide polymorphisms or SNPs (pronounced "snips") are DNA sequence variations that occur
Genetic diagnostics the gateway to personalized medicine
Micronova 20.11.2012 Genetic diagnostics the gateway to personalized medicine Kristiina Assoc. professor, Director of Genetic Department HUSLAB, Helsinki University Central Hospital The Human Genome Packed
G E N OM I C S S E RV I C ES
GENOMICS SERVICES THE NEW YORK GENOME CENTER NYGC is an independent non-profit implementing advanced genomic research to improve diagnosis and treatment of serious diseases. capabilities. N E X T- G E
IMPLEMENTING BIG DATA IN TODAY S HEALTH CARE PRAXIS: A CONUNDRUM TO PATIENTS, CAREGIVERS AND OTHER STAKEHOLDERS - WHAT IS THE VALUE AND WHO PAYS
IMPLEMENTING BIG DATA IN TODAY S HEALTH CARE PRAXIS: A CONUNDRUM TO PATIENTS, CAREGIVERS AND OTHER STAKEHOLDERS - WHAT IS THE VALUE AND WHO PAYS 29 OCTOBER 2015 DR. DIRK J. EVERS BACKGROUND TreatmentMAP
CCR Biology - Chapter 9 Practice Test - Summer 2012
Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible
An example of bioinformatics application on plant breeding projects in Rijk Zwaan
An example of bioinformatics application on plant breeding projects in Rijk Zwaan Xiangyu Rao 17-08-2012 Introduction of RZ Rijk Zwaan is active worldwide as a vegetable breeding company that focuses on
Molecular Genetics: Challenges for Statistical Practice. J.K. Lindsey
Molecular Genetics: Challenges for Statistical Practice J.K. Lindsey 1. What is a Microarray? 2. Design Questions 3. Modelling Questions 4. Longitudinal Data 5. Conclusions 1. What is a microarray? A microarray
Cystic Fibrosis Webquest Sarah Follenweider, The English High School 2009 Summer Research Internship Program
Cystic Fibrosis Webquest Sarah Follenweider, The English High School 2009 Summer Research Internship Program Introduction: Cystic fibrosis (CF) is an inherited chronic disease that affects the lungs and
Genetic Testing in Research & Healthcare
We Innovate Healthcare Genetic Testing in Research & Healthcare We Innovate Healthcare Genetic Testing in Research and Healthcare Human genetic testing is a growing science. It is used to study genes
Targeted. sequencing solutions. Accurate, scalable, fast TARGETED
Targeted TARGETED Sequencing sequencing solutions Accurate, scalable, fast Sequencing for every lab, every budget, every application Ion Torrent semiconductor sequencing Ion Torrent technology has pioneered
Speaker First Plenary Session THE USE OF "BIG DATA" - WHERE ARE WE AND WHAT DOES THE FUTURE HOLD? William H. Crown, PhD
Speaker First Plenary Session THE USE OF "BIG DATA" - WHERE ARE WE AND WHAT DOES THE FUTURE HOLD? William H. Crown, PhD Optum Labs Cambridge, MA, USA Statistical Methods and Machine Learning ISPOR International
Towards Integrating the Detection of Genetic Variants into an In-Memory Database
Towards Integrating the Detection of Genetic Variants into an 2nd International Workshop on Big Data in Bioinformatics and Healthcare Oct 27, 2014 Motivation Genome Data Analysis Process DNA Sample Base
Electronic Medical Records and Genomics: Possibilities, Realities, Ethical Issues to Consider
Electronic Medical Records and Genomics: Possibilities, Realities, Ethical Issues to Consider Daniel Masys, M.D. Affiliate Professor Biomedical and Health Informatics University of Washington, Seattle
Data Integration. Lectures 16 & 17. ECS289A, WQ03, Filkov
Data Integration Lectures 16 & 17 Lectures Outline Goals for Data Integration Homogeneous data integration time series data (Filkov et al. 2002) Heterogeneous data integration microarray + sequence microarray
SHAHID AZIZ DO, FACOI.
SHAHID AZIZ DO, FACOI. ASSOCIATE CLINICAL PROFESSOR OF GI AND LIVER DISEASE. UT SOUTHWESTERN HEALTH SCIENCE CENTER, DALLAS ADJUNCT CLINICAL ASSISTANT PROFESSOR DEPT OF MEDICINE UNT HEALTH SCIENCE CENTER
Data Mining On Diabetics
Data Mining On Diabetics Janani Sankari.M 1,Saravana priya.m 2 Assistant Professor 1,2 Department of Information Technology 1,Computer Engineering 2 Jeppiaar Engineering College,Chennai 1, D.Y.Patil College
The Human Genome Project
The Human Genome Project Brief History of the Human Genome Project Physical Chromosome Maps Genetic (or Linkage) Maps DNA Markers Sequencing and Annotating Genomic DNA What Have We learned from the HGP?
Presentation by: Ahmad Alsahaf. Research collaborator at the Hydroinformatics lab - Politecnico di Milano MSc in Automation and Control Engineering
Johann Bernoulli Institute for Mathematics and Computer Science, University of Groningen 9-October 2015 Presentation by: Ahmad Alsahaf Research collaborator at the Hydroinformatics lab - Politecnico di
Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
BIOINF 525 Winter 2016 Foundations of Bioinformatics and Systems Biology http://tinyurl.com/bioinf525-w16
Course Director: Dr. Barry Grant (DCM&B, [email protected]) Description: This is a three module course covering (1) Foundations of Bioinformatics, (2) Statistics in Bioinformatics, and (3) Systems
Exploratory data analysis for microarray data
Eploratory data analysis for microarray data Anja von Heydebreck Ma Planck Institute for Molecular Genetics, Dept. Computational Molecular Biology, Berlin, Germany [email protected] Visualization
European Genome-phenome Archive database of human data consented for use in biomedical research at the European Bioinformatics Institute
European Genome-phenome Archive database of human data consented for use in biomedical research at the European Bioinformatics Institute Justin Paschall Team Leader Genetic Variation / EGA ! European Genome-phenome
Single Nucleotide Polymorphisms (SNPs)
Single Nucleotide Polymorphisms (SNPs) Additional Markers 13 core STR loci Obtain further information from additional markers: Y STRs Separating male samples Mitochondrial DNA Working with extremely degraded
12.1 The Role of DNA in Heredity
12.1 The Role of DNA in Heredity Only in the last 50 years have scientists understood the role of DNA in heredity. That understanding began with the discovery of DNA s structure. In 1952, Rosalind Franklin
The Future of the Electronic Health Record. Gerry Higgins, Ph.D., Johns Hopkins
The Future of the Electronic Health Record Gerry Higgins, Ph.D., Johns Hopkins Topics to be covered Near Term Opportunities: Commercial, Usability, Unification of different applications. OMICS : The patient
Analysis of gene expression data. Ulf Leser and Philippe Thomas
Analysis of gene expression data Ulf Leser and Philippe Thomas This Lecture Protein synthesis Microarray Idea Technologies Applications Problems Quality control Normalization Analysis next week! Ulf Leser:
TOWARD BIG DATA ANALYSIS WORKSHOP
TOWARD BIG DATA ANALYSIS WORKSHOP 邁 向 巨 量 資 料 分 析 研 討 會 摘 要 集 2015.06.05-06 巨 量 資 料 之 矩 陣 視 覺 化 陳 君 厚 中 央 研 究 院 統 計 科 學 研 究 所 摘 要 視 覺 化 (Visualization) 與 探 索 式 資 料 分 析 (Exploratory Data Analysis, EDA)
Overview of Genetic Testing and Screening
Integrating Genetics into Your Practice Webinar Series Overview of Genetic Testing and Screening Genetic testing is an important tool in the screening and diagnosis of many conditions. New technology is
Gene Expression Analysis
Gene Expression Analysis Jie Peng Department of Statistics University of California, Davis May 2012 RNA expression technologies High-throughput technologies to measure the expression levels of thousands
Data Analysis for Ion Torrent Sequencing
IFU022 v140202 Research Use Only Instructions For Use Part III Data Analysis for Ion Torrent Sequencing MANUFACTURER: Multiplicom N.V. Galileilaan 18 2845 Niel Belgium Revision date: August 21, 2014 Page
Next Generation Sequencing: Technology, Mapping, and Analysis
Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University [email protected] http://tandem.bu.edu/ The Human Genome Project took
Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company
Genetic engineering: humans Gene replacement therapy or gene therapy Many technical and ethical issues implications for gene pool for germ-line gene therapy what traits constitute disease rather than just
Information leaflet. Centrum voor Medische Genetica. Version 1/20150504 Design by Ben Caljon, UZ Brussel. Universitair Ziekenhuis Brussel
Information on genome-wide genetic testing Array Comparative Genomic Hybridization (array CGH) Single Nucleotide Polymorphism array (SNP array) Massive Parallel Sequencing (MPS) Version 120150504 Design
SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE
AP Biology Date SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE LEARNING OBJECTIVES Students will gain an appreciation of the physical effects of sickle cell anemia, its prevalence in the population,
BIOINF 585 Fall 2015 Machine Learning for Systems Biology & Clinical Informatics http://www.ccmb.med.umich.edu/node/1376
Course Director: Dr. Kayvan Najarian (DCM&B, [email protected]) Lectures: Labs: Mondays and Wednesdays 9:00 AM -10:30 AM Rm. 2065 Palmer Commons Bldg. Wednesdays 10:30 AM 11:30 AM (alternate weeks) Rm.
Genomic CDS: an example of a complex ontology for pharmacogenetics and clinical decision support
Genomic CDS: an example of a complex ontology for pharmacogenetics and clinical decision support Matthias Samwald 1 1 Medical University of Vienna, Vienna, Austria [email protected] Abstract.
Overview of Next Generation Sequencing platform technologies
Overview of Next Generation Sequencing platform technologies Dr. Bernd Timmermann Next Generation Sequencing Core Facility Max Planck Institute for Molecular Genetics Berlin, Germany Outline 1. Technologies
Focusing on results not data comprehensive data analysis for targeted next generation sequencing
Focusing on results not data comprehensive data analysis for targeted next generation sequencing Daniel Swan, Jolyon Holdstock, Angela Matchan, Richard Stark, John Shovelton, Duarte Mohla and Simon Hughes
FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem
FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem Elsa Bernard Laurent Jacob Julien Mairal Jean-Philippe Vert September 24, 2013 Abstract FlipFlop implements a fast method for de novo transcript
The Human Genome Project. From genome to health From human genome to other genomes and to gene function Structural Genomics initiative
The Human Genome Project From genome to health From human genome to other genomes and to gene function Structural Genomics initiative June 2000 What is the Human Genome Project? U.S. govt. project coordinated
Go where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe
Go where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe Go where the biology takes you. To published results faster With proven scalability To the forefront of discovery To limitless applications
Information for patients and the public and patient information about DNA / Biobanking across Europe
Information for patients and the public and patient information about DNA / Biobanking across Europe BIOBANKING / DNA BANKING SUMMARY: A biobank is a store of human biological material, used for the purposes
Cloud-Based Big Data Analytics in Bioinformatics
Cloud-Based Big Data Analytics in Bioinformatics Presented By Cephas Mawere Harare Institute of Technology, Zimbabwe 1 Introduction 2 Big Data Analytics Big Data are a collection of data sets so large
2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.
1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence
Validation and Replication
Validation and Replication Overview Definitions of validation and replication Difficulties and limitations Working examples from our group and others Why? False positive results still occur. even after
Leading Genomics. Diagnostic. Discove. Collab. harma. Shanghai Cambridge, MA Reykjavik
Leading Genomics Diagnostic harma Discove Collab Shanghai Cambridge, MA Reykjavik Global leadership for using the genome to create better medicine WuXi NextCODE provides a uniquely proven and integrated
Globally, about 9.7% of cancers in men are prostate cancers, and the risk of developing the
Chapter 5 Analysis of Prostate Cancer Association Study Data 5.1 Risk factors for Prostate Cancer Globally, about 9.7% of cancers in men are prostate cancers, and the risk of developing the disease has
Differential privacy in health care analytics and medical research An interactive tutorial
Differential privacy in health care analytics and medical research An interactive tutorial Speaker: Moritz Hardt Theory Group, IBM Almaden February 21, 2012 Overview 1. Releasing medical data: What could
Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology
Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,
Genetic Testing: Scientific Background for Policymakers
Genetic Testing: Scientific Background for Policymakers Amanda K. Sarata Specialist in Health Policy December 19, 2011 CRS Report for Congress Prepared for Members and Committees of Congress Congressional
A leader in the development and application of information technology to prevent and treat disease.
A leader in the development and application of information technology to prevent and treat disease. About MOLECULAR HEALTH Molecular Health was founded in 2004 with the vision of changing healthcare. Today
Statistical issues in the analysis of microarray data
Statistical issues in the analysis of microarray data Daniel Gerhard Institute of Biostatistics Leibniz University of Hannover ESNATS Summerschool, Zermatt D. Gerhard (LUH) Analysis of microarray data
Survey of clinical data mining applications on big data in health informatics
Survey of clinical data mining applications on big data in health informatics Matthew Herland, Taghi M. Khoshgoftaar, and Randall Wald 劉 俊 成 Survey of clinical data mining applications on big data in health
MUTATION, DNA REPAIR AND CANCER
MUTATION, DNA REPAIR AND CANCER 1 Mutation A heritable change in the genetic material Essential to the continuity of life Source of variation for natural selection New mutations are more likely to be harmful
RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison
RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the
This fact sheet describes how genes affect our health when they follow a well understood pattern of genetic inheritance known as autosomal recessive.
11111 This fact sheet describes how genes affect our health when they follow a well understood pattern of genetic inheritance known as autosomal recessive. In summary Genes contain the instructions for
Cancer Genomics: What Does It Mean for You?
Cancer Genomics: What Does It Mean for You? The Connection Between Cancer and DNA One person dies from cancer each minute in the United States. That s 1,500 deaths each day. As the population ages, this
Genetic Mutations. Indicator 4.8: Compare the consequences of mutations in body cells with those in gametes.
Genetic Mutations Indicator 4.8: Compare the consequences of mutations in body cells with those in gametes. Agenda Warm UP: What is a mutation? Body cell? Gamete? Notes on Mutations Karyotype Web Activity
Final Project Report
CPSC545 by Introduction to Data Mining Prof. Martin Schultz & Prof. Mark Gerstein Student Name: Yu Kor Hugo Lam Student ID : 904907866 Due Date : May 7, 2007 Introduction Final Project Report Pseudogenes
Machine Learning CS 6830. Lecture 01. Razvan C. Bunescu School of Electrical Engineering and Computer Science [email protected]
Machine Learning CS 6830 Razvan C. Bunescu School of Electrical Engineering and Computer Science [email protected] What is Learning? Merriam-Webster: learn = to acquire knowledge, understanding, or skill
Big Data for Population Health and Personalised Medicine through EMR Linkages
Big Data for Population Health and Personalised Medicine through EMR Linkages Zheng-Ming CHEN Professor of Epidemiology Nuffield Dept. of Population Health, University of Oxford Big Data for Health Policy
Recombinant DNA and Biotechnology
Recombinant DNA and Biotechnology Chapter 18 Lecture Objectives What Is Recombinant DNA? How Are New Genes Inserted into Cells? What Sources of DNA Are Used in Cloning? What Other Tools Are Used to Study
Technical Issues in Aggregating and Analyzing Data from Heterogeneous EHR Systems
Technical Issues in Aggregating and Analyzing Data from Heterogeneous EHR Systems Josh Denny, MD, MS [email protected] Vanderbilt University, Nashville, Tennessee, USA 2/12/2015 EHR data are dense
Incorporating Research Into Sight (IRIS) Essentia Rural Health Institute Marshfield Clinic Penn State University
Incorporating Research Into Sight (IRIS) Essentia Rural Health Institute Marshfield Clinic Penn State University Aim 1. Develop and validate electronic algorithms for ophthalmic conditions and efficacy
The Data Mining Process
Sequence for Determining Necessary Data. Wrong: Catalog everything you have, and decide what data is important. Right: Work backward from the solution, define the problem explicitly, and map out the data
Introduction to genetic testing and pharmacogenomics
Introduction to genetic testing and pharmacogenomics Cecile Janssens Erasmus University Medical Center Rotterdam, Rotterdam, the Netherlands ([email protected]) Genetic prediction of monogenic diseases
Validation parameters: An introduction to measures of
Validation parameters: An introduction to measures of test accuracy Types of tests All tests are fundamentally quantitative Sometimes we use the quantitative result directly However, it is often necessary
TRACKS GENETIC EPIDEMIOLOGY
Dr. Priya Duggal, Director In the post-genomic era where larger amounts of genetic data are now readily available, it has become increasingly important to design studies and use analytical techniques that
Online Supplement to Polygenic Influence on Educational Attainment. Genotyping was conducted with the Illumina HumanOmni1-Quad v1 platform using
Online Supplement to Polygenic Influence on Educational Attainment Construction of Polygenic Score for Educational Attainment Genotyping was conducted with the Illumina HumanOmni1-Quad v1 platform using
Appendix G STATISTICAL METHODS INFECTIOUS METHODS STATISTICAL ROADMAP. Prepared in Support of: CDC/NCEH Cross Sectional Assessment Study.
Appendix G STATISTICAL METHODS INFECTIOUS METHODS STATISTICAL ROADMAP Prepared in Support of: CDC/NCEH Cross Sectional Assessment Study Prepared by: Centers for Disease Control and Prevention National
Big Data Healthcare. Fei Wang Associate Professor Department of Computer Science and Engineering School of Engineering University of Connecticut
Big Data Healthcare Fei Wang Associate Professor Department of Computer Science and Engineering School of Engineering University of Connecticut Healthcare Is in Crisis Hersh, W., Jacko, J. A., Greenes,
Gene Therapy. The use of DNA as a drug. Edited by Gavin Brooks. BPharm, PhD, MRPharmS (PP) Pharmaceutical Press
Gene Therapy The use of DNA as a drug Edited by Gavin Brooks BPharm, PhD, MRPharmS (PP) Pharmaceutical Press Contents Preface xiii Acknowledgements xv About the editor xvi Contributors xvii An introduction
Introduction To Epigenetic Regulation: How Can The Epigenomics Core Services Help Your Research? Maria (Ken) Figueroa, M.D. Core Scientific Director
Introduction To Epigenetic Regulation: How Can The Epigenomics Core Services Help Your Research? Maria (Ken) Figueroa, M.D. Core Scientific Director Gene expression depends upon multiple factors Gene Transcription
Next generation DNA sequencing technologies. theory & prac-ce
Next generation DNA sequencing technologies theory & prac-ce Outline Next- Genera-on sequencing (NGS) technologies overview NGS applica-ons NGS workflow: data collec-on and processing the exome sequencing
Bioinformatics: course introduction
Bioinformatics: course introduction Filip Železný Czech Technical University in Prague Faculty of Electrical Engineering Department of Cybernetics Intelligent Data Analysis lab http://ida.felk.cvut.cz
