PCR was carried out in a reaction volume of 20 µl using the ABI AmpliTaq GOLD kit (ABI,

Size: px
Start display at page:

Download "PCR was carried out in a reaction volume of 20 µl using the ABI AmpliTaq GOLD kit (ABI,"

Transcription

1 Supplemental Text/Tables PCR Amplification and Sequencing PCR was carried out in a reaction volume of 20 µl using the ABI AmpliTaq GOLD kit (ABI, Foster City, CA). Each PCR reaction contained 20 ng genomic DNA; 0.8 µl 10 mm dntps ; 6.4 pmol PCR primer mix; 2 µl 10X PCR Buffer (15 mm MgCl 2 ); 0.2-μL AmpliTaq GOLD (5 U/μL). Thermal cycling was performed using the ABI GeneAmp PCR System 9700 using the following program: 95 C for 10 min; [98 C for 10 sec, 60 C for 1 min, 70 C for 1 min] x 7 cycles; [96 C for 10 sec, 68 C for 2 min] x 31 cycles; 4 C Hold. PCR products (4 µl) were analyzed on 2% agarose gels for 15 min to confirm proper amplification. The remaining 16 µl PCR products were diluted with ddh 2 0 to 100 µl and purified using the Millipore Montage PCR96 purification plates at a constant vacuum of 15 in Hg for 10 min. For sequencing, 5.5 µl purified products were added to 5 µl ABI BigDye Terminator v1.1 master mix (2 µl DBT; 1 µl 5X Sequencing Buffer; 1 µl M13 Forward or M13 Reverse sequencing primer; 1 µl ddh 2 0). Sequence reactions were cycled using the ABI GeneAmp PCR System 9700 using the following program: 96 C for 2 min; [96 C for 10 sec, 50 C for 5 sec, 60 C for 2 min] x 25 cycles; 4 C Hold. Sequence reactions were purified using Princeton Separations CentriSep 96-well spin-columns. EGFR and HER2 samples were sequenced using the ABI 3730xl Analyzer, followed by mutation analysis using Sequencher v4.5 software (Gene Codes, Ann Arbor, MI). Cloning of EGFR Point Mutants EGFR mutants were originally described by Lynch et al. (11). A full-length clone of EGFR was used as a template for PCR. Primers were designed for each point mutation, as indicated in Table S2. 1

2 Mutagenesis was performed using Stratagene s Quick-change (Turbo polymerase) kit (Stratagene, La Jolla, CA). Conditions for mutagenesis: 95 o C for 30 sec; [95 o C for 30 sec, 55 o C for 1 min, 68 o C for 18 min (2 min per kb vector + insert)] for 12 cycles for each point mutation. Mutated PCR products were cloned in pcr2.1 (Invitrogen, Carlsbad, CA). All mutants were subjected to full-length sequencing on the ABI 3730 XL Genetic Analyzer. Mutant clones were then sub-cloned into pcdna3.1(-) vector (Invitrogen). Cloning of EGFR Deletion Mutants Using the full-length wild-type EGFR clone as a template for PCR, a unique EcoRV restriction site was introduced by mutagenesis of 1bp (2228). Products of mutagenesis were prepared using minispin kit (Qiagen, Valencia, CA) and then fully sequenced using ABI 3730 XL Genetic Analyzer (ABI). A clone with the newly introduced EcoRV site was selected for further use. Primers were designed to incorporate an EcoRV site and to delete out an area specific to each deletion mutant to be made: del15, aa , primer (5'-GTCGATATCAAGACATCTCCGAAAGCCAACAAGG-3'), del18, aa with insertion of a serine at position aa753, (5'- GTCGATATCAAGGAATCGAAAGCCAACAAGGAAATCCTCG-3'). PCR products were amplified using Phusion Taq (Finnzymes, Espoo Finland) and cloned into pcr2.1 (Invitrogen). Sequence analysis of these clones yielded new 3 -end clones with the specified deletions. Full-length gene reconstruction was accomplished by restriction digestion of the cloned products from the 5'-end (with EcoRV mutation) and 3'-end deletion clones. Fragments were cut with EcoRV, gel-isolated and ligated together with T4 DNA ligase (Roche, Nutley, NJ). Sequencing 2

3 of the full-length EGFR gene with the deletions present was again confirmed on the ABI machine and analyzed by Sequencher software. Mutagenesis was performed to restore the native sequence (destroying introduced EcoRV site) (Stratagene) (primers not shown). Deletion clones with the native sequence restored at this site were selected. Final expression constructs were made by restriction digest of the full-length mutants with Xho I- Hind III. Fragments were gel-isolated and sub-cloned into the compatible sites in the pcdna3.1(-) vector (Invitrogen). Final sequence confirmation was performed to ensure proper orientation of final construct. Cloning of HER2 Mutants HER2 mutants used in this study were originally described by (22). A full-length clone of HER2 was used as a template for PCR. The 5'-end of the HER2 gene was amplified using the indicated primers for each mutant (Table S4). Insertion mutants were prepared using primers containing the insertion sequences and were designed around an internal Nde I site. Mutant PCR products were subcloned into the pcr2.1 vector (Invitrogen) and sequenced using ABI 3730 XL Genetic Analyzer (ABI). Clones with the correct insertion sequences were selected. The full-length mutated HER2 gene was reassembled in the pcr 2.1 vector backbone using the unique internal NdeI site in the native HER2 gene. These mutated HER2 clones were used as templates for amplification of the full-length mutated gene and cloned into pcdna3.1d (Invitrogen). HER2 insertion mutations were prepared using standard amplification and restriction enzyme digestion procedures. Clones with the required mutations were selected and subcloned into an expression vector. 3

4 Protein Purification of EGFR Mutants for Enzyme Analyses Briefly, frozen cell pellets were thawed and suspended with 5 volumes of Buffer A (25 mm Hepes, ph 7.5, 250 mm NaCl, 1 mm CHAPS, 10% glycerol and 25 mm imidazole). The cells were lysed with one pass through an APV homogenizer at psi followed by a x g spin to remove insoluble proteins and cell debris. The supernatant was loaded on a Chelating Sepharose (GE Healthcare) column equilibrated with Buffer A. The column was washed and the enzyme was eluted with Buffer B (25 mm HEPES, ph 7.5, 250 mm NaCl, 1 mm CHAPS, 10% glycerol and 250 mm imidazole). Fractions containing enzyme were pool, aliquoted and stored at -80 o C. Preparation of Inhibitor Stocks and Dilutions Powdered lapatinib and gefitinib were dissolved in DMSO at 10 mm and serially diluted 1:3 or 1:4 (H1781S cells only) in DMSO. Ten concentrations of each compound were prepared. The DMSO stocks were diluted as necessary in RPMI 1640, and 100 µl diluted compound was added to the cells. The final inhibitor concentrations were as follows (µm): 30, 10, 3.3, 1.1, 0.37, 0.12, 0.041, 0.014, 0.005, except for H1781 cells, which were dosed at (µm): 30, 7.5, 1.9, 0.47, 0.12, 0.029, , , , and A no inhibitor control (0 µm) was also prepared. Final DMSO concentration was 0.3%. Methylene Blue Assay The culture medium was removed and cells were stained for 30 min with 90 µl/well 0.5% methylene blue (Sigma, St Louis, MO) in 50% ethanol. The staining solution was aspirated, and plates were rinsed by immersion in deionized water and air dried. The stain was solubilized in 100 µl/well of 1% n-lauroylsarcosine (Sigma) in PBS for 30 min with shaking, and absorbance at 620 nm was determined on a Tecan Genosys microplate reader. Data were normalized to cells treated with 0.3% DMSO (vehicle) alone. Values for the inhibition of 50% of vehicle treated control (IC 50 ) cells were determined by the method of Levenberg and Marquardt (30) with the equation, A n x y = V max 1 (A) n n K + x Where V max equals the normalized absorbance in the absence of compound, x equals the concentration of compound, n equals the slope of the curve and K equals the IC 50. A minimum of 2 IC 50 determinations were performed for each cell line. 4

5 Table S1. Lapatinib and Gefitinib-mediated Inhibition of pegfr or pher2 Cell Line Receptor Status IC 50 (µm) Lapatinib IC 50 (µm) Gefitinib H358 EGFR wt H1734 EGFR wt H1650 EGFR del15 >3.3 <0.014 H1781S HER2 G776VinsC >3.3 5

6 Table S2 - PCR Primers for Sequencing EGFR Exons (M13 sequences have been removed for mapping purposes) Forward Primer Sequence Reverse Primer Sequence Exon2 TCACAAATTTCTTTGCTGTGTCC AGCTGGTAAAATGGCTTTCTCAT Exon3 TTATCACAGGGGTCAAAGGCTAA AAATAAAAGCCTTCTCCGAGGTG Exon4 GCTAATTGCGGGACTCTTGTTC AACAGCAGCTCTTCTCAGGACA Exon5 CAAGGAACCTCAAATTCATGAAAAA ATTAACTGCATGCGGTGAGATTT Exon6 GGGCATGGTTTGACTTAGTTTGA GCATCTCATCATTTAAGCATTCA Exon 7 GGAACACTAGGCTGCAAAGACA CCACCCAAAGACTCTCCAAGAT Exon8 CTTTAAAGGTGAGAGCAGGTGGA GAAGATGTGTTCCTTTGGAGGTG Exon9-10 CCAACAAATGTGAACGGAATACA CTGGACTTAACGTGTCCCCTTTT Exon11 TCATCTGCCTTACAGGGTTTTTG TCTGGTCCCTGTGATAAGATGTG Exon12 GGAACTATCTTTTGCCTGGAGGA TAATTTGCTTCTTAAGGAACTGAAAA Exon13 CACTGTCAGGCACATTTCAGTCT AGAAAACCCAAAACCTCCAAAAG Exon14 GCTTGCTTACCCAATATGCAAAA GCAGGCTAATGTGTGTGCTAATG Exon15 GAATATCATTTCTTTCATGCTGGTGT TGGGGACCAAAACACCTTAAGTA Exon16 CTGTGTCAAAAGCCAGATGTGAA AACTTTCCCTCCACTGAGGACA Exon17 AATGAGGAAAAGTGTGCCTGGTA GATGGATGTACCAACATGTCACC Exon18 CCAGTTAATAGGCGTGGAAACAG AAAACACTGGAGTTTCCCAAACA Exon19 CTAAATAATCAGTGTGATTCGTGGA AGATGCCAGTAATTGCCTGTTTC Exon20 ACAGCTTTTCCTCCATGAGTACG GCTGATTGATGAGAGTTTCCACAT Exon21 GCCTTTCCATTCTTTGGATCAGT CTGGGGATAACATCCTCATTCAC Exon22 CCTGAACTCCGTCAGACTGAAA GAGAGCCGTTTCCTAAGCTCTTT Exon23 AGCAAGGGATTGTGATTGTTCAT TAGGGCAACTCGGTATTTCATTG Exon24 AGGAAGAGTGGGCGTAGAAAAAC GGATGCTGCTTAGTTCACGATGT Exon25 TTGAATCTCATGTAGGGGCTTTC ACCATTTGGTTAAAATTGACTTCAT Exon26 CCATGGGCAACTTCTCTGTTTC CCCACACAGGAAGAAAACTCAAG Exon27 ACCGGAGTAACCTTCCCTCATT GCAGAGAGAACAGGGATCAAATC Exon28a GGTGCTTTGCTGATTACTTCACC TAGTCGGTGTAAACGTTGCAAAA Exon28b GCAGTGAATTTATTGGAGCATGA GGATCTTTAGTGTTTTGCAGTGGA 6

7 Table S2. Primers for Constructing EGFR Mutants G719C-MUT1 G719C-MUT2 G719S-MUT1 G719S-MUT2 L858R-MUT1 L858R-MUT2 L861Q-MUT1 L861Q-MUT2 T790M-MUT1 T790M-MUT2 AAAGATCAAAGTGCTGTGCTCCGGTGCGTTCGGC GCCGAACGCACCGGAGCACAGCACTTTGATCTTT AAAGATCAAAGTGCTGAGCTCCGGTGCGTTCGGC GCCGAACGCACCGGAGCTCAGCACTTTGATCTTT ATCACAGATTTTGGGCGGGCCAAACTGCTGGGT ACCCAGCAGTTTGGCCCGCCCAAAATCTGTGAT TTTGGGCTGGCCAAACAGCTGGGTGCGGAAGAGA TCTCTTCCGCACCCAGCTGTTTGGCCAGCCCAAA CCGTGCAGCTCATCATGCAGCTCATGCCCTTCGG CCGAAGGGCATGAGCTGCATGATGAGCTGCACGG 7

8 Table S3 PCR Primer Pairs for Sequencing HER2 TK Domain (M13 sequences have been removed for mapping purposes) Forward Primer Sequence Reverse Primer Sequence Exon 18 GTGAAGTCCTCCCAGCCCGC CTCCCATCAGAACTGCCGACC Exon 19 TGGAGGACAAGTAATGATCTCCTGG AAGAGAGACCAGAGCCCAGACCTG Exon 20 GCCATGGCTGTGGTTTGTGATGG ATCCTAGCCCCTTGTGGACATAGG Exon 21 GGACTCTTGCTGGGCATGTGG CCACTCAGAGTTCTCCCATGG Exon 22 CCATGGGAGAACTCTGAGTGG TCCCTTCACATGCTGAGGTGG Exon 23 AGACTCCTGAGCAGAACCTCTG AGCCAGCACAGCTCAGCCAC Exon 24 ACTGTCTAGACCAGACTGGAGG GAGGGTGCTCTTAGCCACAGG 8

9 Table S4 Primers for Cloning HER2 Mutants G776V-C-1 G776V-C-2 YVMAins-1 YVMAins-2 CGAAGCATACGTGATGGCTGTTTGTGTGGGCTCCC CATATGTC GACATATGGGGAGCCCACACAAACAGCCATCACG TATGCTTCG CGAAGCATACGTGATGGCTTACGTGATGGCTGGT GTGGGCTCCCCATATG CATATGGGGAGCCCACACCAGCCATCACGTAAGC CATCACGTATGCTTCG Insertion of TTT (nuc ) at aa 776 mutates Gly to Val and inserts a Cys. Insertion of duplicate sequence (nuc ) TACGTGATGGCT, produces a insert of 4 aa (YVMA) at aa

RT-PCR: Two-Step Protocol

RT-PCR: Two-Step Protocol RT-PCR: Two-Step Protocol We will provide both one-step and two-step protocols for RT-PCR. We recommend the twostep protocol for this class. In the one-step protocol, the components of RT and PCR are mixed

More information

TIANquick Mini Purification Kit

TIANquick Mini Purification Kit TIANquick Mini Purification Kit For purification of PCR products, 100 bp to 20 kb www.tiangen.com TIANquick Mini Purification Kit (Spin column) Cat no. DP203 Kit Contents Contents Buffer BL Buffer PB Buffer

More information

Troubleshooting Sequencing Data

Troubleshooting Sequencing Data Troubleshooting Sequencing Data Troubleshooting Sequencing Data No recognizable sequence (see page 7-10) Insufficient Quantitate the DNA. Increase the amount of DNA in the sequencing reactions. See page

More information

BacReady TM Multiplex PCR System

BacReady TM Multiplex PCR System BacReady TM Multiplex PCR System Technical Manual No. 0191 Version 10112010 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI Detailed Experimental

More information

Overview. KAPAHiFi HotStart is the engineered KAPAHiFi DNA Polymerase with an antibody-based hot start technology and improved buffer system.

Overview. KAPAHiFi HotStart is the engineered KAPAHiFi DNA Polymerase with an antibody-based hot start technology and improved buffer system. Overview KAPAHiFi HotStart is the engineered KAPAHiFi DNA Polymerase with an antibody-based hot start technology and improved buffer system. KAPAHiFi HotStart exhibits: World leading fidelity confirmed

More information

Cloning of genes from genomic DNA: Part 3-Restriction Enzyme Digestion and Agarose Gel Electrophoresis

Cloning of genes from genomic DNA: Part 3-Restriction Enzyme Digestion and Agarose Gel Electrophoresis Cloning of genes from genomic DNA: Part 3-Restriction Enzyme Digestion and Agarose Gel Electrophoresis Continuing from our isolation of genomic DNA and PCR amplification of either the evenskipped gene

More information

4 General PCR Methods Page

4 General PCR Methods Page Table of Contents General PCR Methods Page PCR Protocol Selection Guide...65.1 Basic PCR... 66.1.1 Hot Start PCR - The new Standard... 66.1.1.1 Reagents and Equipment Required... 66.1.1.2 General Considerations

More information

Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation

Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation BDGP Resources Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation For recovery of sequences flanking PZ, PlacW and PEP elements E. Jay Rehm Berkeley Drosophila Genome Project I.

More information

NimbleGen DNA Methylation Microarrays and Services

NimbleGen DNA Methylation Microarrays and Services NimbleGen DNA Methylation Microarrays and Services Sample Preparation Instructions Outline This protocol describes the process for preparing samples for NimbleGen DNA Methylation microarrays using the

More information

360 Master Mix. , and a supplementary 360 GC Enhancer.

360 Master Mix. , and a supplementary 360 GC Enhancer. Product Bulletin AmpliTaq Gold 360 Master Mix and 360 DNA Polymerase AmpliTaq Gold 360 Master Mix AmpliTaq Gold 360 DNA Polymerase 360 Coverage for a Full Range of Targets AmpliTaq Gold 360 Master Mix

More information

ptune Inducible Vector

ptune Inducible Vector ptune Inducible Vector Application Guide Table of Contents Package contents and Storage Conditions:...2 Related products:...2 Introduction...2 Figure 1. Schematic Diagrams of ptune Inducible vector...3

More information

Technical Manual No. 0173 Update Date 10112010

Technical Manual No. 0173 Update Date 10112010 TissueDirect TM Multiplex PCR System Technical Manual No. 0173 Update Date 10112010 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 3 V Simplified Procedures. 3 VI Detailed

More information

GenScript BloodReady TM Multiplex PCR System

GenScript BloodReady TM Multiplex PCR System GenScript BloodReady TM Multiplex PCR System Technical Manual No. 0174 Version 20040915 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI

More information

Genomic DNA Extraction Kit INSTRUCTION MANUAL

Genomic DNA Extraction Kit INSTRUCTION MANUAL Genomic DNA Extraction Kit INSTRUCTION MANUAL Table of Contents Introduction 3 Kit Components 3 Storage Conditions 4 Recommended Equipment and Reagents 4 Introduction to the Protocol 4 General Overview

More information

Application Guide... 2

Application Guide... 2 Protocol for GenomePlex Whole Genome Amplification from Formalin-Fixed Parrafin-Embedded (FFPE) tissue Application Guide... 2 I. Description... 2 II. Product Components... 2 III. Materials to be Supplied

More information

RevertAid Premium First Strand cdna Synthesis Kit

RevertAid Premium First Strand cdna Synthesis Kit RevertAid Premium First Strand cdna Synthesis Kit #K1651, #K1652 CERTIFICATE OF ANALYSIS #K1651 Lot QUALITY CONTROL RT-PCR using 100 fg of control GAPDH RNA and GAPDH control primers generated a prominent

More information

Chromatin Immunoprecipitation (ChIP)

Chromatin Immunoprecipitation (ChIP) Chromatin Immunoprecipitation (ChIP) Day 1 A) DNA shearing 1. Samples Dissect tissue (One Mouse OBs) of interest and transfer to an eppendorf containing 0.5 ml of dissecting media (on ice) or PBS but without

More information

PrimeSTAR HS DNA Polymerase

PrimeSTAR HS DNA Polymerase Cat. # R010A For Research Use PrimeSTAR HS DNA Polymerase Product Manual Table of Contents I. Description...3 II. III. IV. Components...3 Storage...3 Features...3 V. General Composition of PCR Reaction

More information

High-quality genomic DNA isolation and sensitive mutation analysis

High-quality genomic DNA isolation and sensitive mutation analysis Application Note High-quality genomic DNA isolation and sensitive mutation analysis Izabela Safin, Ivonne Schröder-Stumberger and Peter Porschewski Introduction A major objective of cancer research is

More information

Sanger Sequencing: Sample Preparation Guide

Sanger Sequencing: Sample Preparation Guide Sanger Sequencing: Sample Preparation Guide Use this as a guide to prepare your samples for Sanger sequencing at AGRF CONTENTS 1 Overview... 2 1.1 Capillary Separation (CS) or electrophoretic separation

More information

KAPA HiFi. Site-directed Mutagenesis. DNA Polymerase. Application Note. 1. Introduction. 2. Materials.

KAPA HiFi. Site-directed Mutagenesis. DNA Polymerase. Application Note. 1. Introduction. 2. Materials. KAPA HiFi DNA Polymerase 1. Introduction Site-directed mutagenesis is a powerful tool for protein engineering and the study of protein structure and function. Numerous methods of site-directed mutagenesis

More information

Lab 1: Who s Your Daddy? (AKA DNA Purification and PCR)

Lab 1: Who s Your Daddy? (AKA DNA Purification and PCR) Lab 1: Who s Your Daddy? (AKA DNA Purification and PCR) Goals of the lab: 1. To understand how DNA s chemical properties can be exploited for purification 2. To learn practical applications of DNA purification

More information

Gene Expression Assays

Gene Expression Assays APPLICATION NOTE TaqMan Gene Expression Assays A mpl i fic ationef ficienc yof TaqMan Gene Expression Assays Assays tested extensively for qpcr efficiency Key factors that affect efficiency Efficiency

More information

TaKaRa Ex Taq 1PCR PRODUCTS. High Performance PCR. Kit Components RR001A. Applications RR01AM. Description. Concentration. Form. Storage.

TaKaRa Ex Taq 1PCR PRODUCTS. High Performance PCR. Kit Components RR001A. Applications RR01AM. Description. Concentration. Form. Storage. 1PCR PRODUCTS TaKaRa Ex Taq TaKaRa Ex Taq Cat.# RR001A 250 U TaKaRa Ex Taq Cat.# RR001B 1000 U (4 250 U TaKaRa Ex Taq Cat.# RR001C 3,000 U (12 250 U TaKaRa Ex Taq (Mg 2+ free Buffer Cat.# RR01AM 250 U

More information

The RNAi Consortium (TRC) Broad Institute

The RNAi Consortium (TRC) Broad Institute TRC Laboratory Protocols Protocol Title: One Step PCR Preparation of Samples for Illumina Sequencing Current Revision Date: 11/10/2012 RNAi Platform,, trc_info@broadinstitute.org Brief Description: This

More information

PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-)

PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-) PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-) FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE Lucigen Corporation 2905 Parmenter St, Middleton, WI 53562 USA Toll Free: (888) 575-9695 (608)

More information

MLX BCG Buccal Cell Genomic DNA Extraction Kit. Performance Characteristics

MLX BCG Buccal Cell Genomic DNA Extraction Kit. Performance Characteristics MLX BCG Buccal Cell Genomic DNA Extraction Kit Performance Characteristics Monolythix, Inc. 4720 Calle Carga Camarillo, CA 93012 Tel: (805) 484-8478 monolythix.com Page 2 of 9 MLX BCG Buccal Cell Genomic

More information

FOR REFERENCE PURPOSES

FOR REFERENCE PURPOSES BIOO LIFE SCIENCE PRODUCTS FOR REFERENCE PURPOSES This manual is for Reference Purposes Only. DO NOT use this protocol to run your assays. Periodically, optimizations and revisions are made to the kit

More information

GENOTYPING ASSAYS AT ZIRC

GENOTYPING ASSAYS AT ZIRC GENOTYPING ASSAYS AT ZIRC A. READ THIS FIRST - DISCLAIMER Dear ZIRC user, We now provide detailed genotyping protocols for a number of zebrafish lines distributed by ZIRC. These protocols were developed

More information

Thermo Scientific Phusion Site-Directed Mutagenesis Kit #F-541

Thermo Scientific Phusion Site-Directed Mutagenesis Kit #F-541 PRODUCT INFORMATION Thermo Scientific Phusion Site-Directed Mutagenesis Kit #F-541 Lot _ Store at -20 C Expiry Date _ www.thermoscientific.com/onebio CERTIFICATE OF ANALYSIS The Phusion Site-Directed Mutagenesis

More information

Cloning Blunt-End Pfu DNA Polymerase- Generated PCR Fragments into pgem -T Vector Systems

Cloning Blunt-End Pfu DNA Polymerase- Generated PCR Fragments into pgem -T Vector Systems Promega Notes Number 71, 1999, p. 10 Blunt-End Pfu DNA Polymerase- Generated PCR Fragments into pgem -T Vector Systems By Kimberly Knoche, Ph.D., and Dan Kephart, Ph.D. Promega Corporation Corresponding

More information

Zback Faster Ligation Kit

Zback Faster Ligation Kit Zback Faster Ligation Kit For the highest efficiency cloning of PCR products either blunt or sticky-end Kit Contents Contents TGVTB04 TGVTB04-2 pzback/blunt vector 10 µl 20 µl T4 DNA Ligase 5 µl 10 µl

More information

PicoMaxx High Fidelity PCR System

PicoMaxx High Fidelity PCR System PicoMaxx High Fidelity PCR System Instruction Manual Catalog #600420 (100 U), #600422 (500 U), and #600424 (1000 U) Revision C Research Use Only. Not for Use in Diagnostic Procedures. 600420-12 LIMITED

More information

SybGREEN qpcr Primers and Standards

SybGREEN qpcr Primers and Standards SybGREEN qpcr Primers and Standards Tools for RT-PCR Application Guide Table of Contents Package Contents and Storage Conditions... 1 Introduction... 3 SybGREEN qpcr Primer Pairs... 3 Gene Specific qpcr

More information

Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual

Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual F- 470S 20 cdna synthesis reactions (20 µl each) F- 470L 100 cdna synthesis reactions (20 µl each) Table of contents 1. Description...

More information

Real-time monitoring of rolling circle amplification using aggregation-induced emission: applications for biological detection

Real-time monitoring of rolling circle amplification using aggregation-induced emission: applications for biological detection Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 215 Supplementary Information Real-time monitoring of rolling circle amplification using aggregation-induced

More information

Rapid Acquisition of Unknown DNA Sequence Adjacent to a Known Segment by Multiplex Restriction Site PCR

Rapid Acquisition of Unknown DNA Sequence Adjacent to a Known Segment by Multiplex Restriction Site PCR Rapid Acquisition of Unknown DNA Sequence Adjacent to a Known Segment by Multiplex Restriction Site PCR BioTechniques 25:415-419 (September 1998) ABSTRACT The determination of unknown DNA sequences around

More information

Microbiology Laboratory: MOLECULAR IDENTIFICATION OF UNKNOWN BACTERIA

Microbiology Laboratory: MOLECULAR IDENTIFICATION OF UNKNOWN BACTERIA Microbiology Laboratory: MOLECULAR IDENTIFICATION OF UNKNOWN BACTERIA Classical Microbiology courses are typically structured to introduce the identification of bacterial species using a series of biochemical

More information

Improved methods for site-directed mutagenesis using Gibson Assembly TM Master Mix

Improved methods for site-directed mutagenesis using Gibson Assembly TM Master Mix CLONING & MAPPING DNA CLONING DNA AMPLIFICATION & PCR EPIGENETICS RNA ANALYSIS Improved methods for site-directed mutagenesis using Gibson Assembly TM Master Mix LIBRARY PREP FOR NET GEN SEQUENCING PROTEIN

More information

UltraClean Soil DNA Isolation Kit

UltraClean Soil DNA Isolation Kit PAGE 1 UltraClean Soil DNA Isolation Kit Catalog # 12800-50 50 preps New improved PCR inhibitor removal solution (IRS) included Instruction Manual (New Alternative Protocol maximizes yields) Introduction

More information

CompleteⅡ 1st strand cdna Synthesis Kit

CompleteⅡ 1st strand cdna Synthesis Kit Instruction Manual CompleteⅡ 1st strand cdna Synthesis Kit Catalog # GM30401, GM30402 Green Mountain Biosystems. LLC Web: www.greenmountainbio.com Tel: 800-942-1160 Sales: Sales@ greenmountainbio.com Support:

More information

Description: Molecular Biology Services and DNA Sequencing

Description: Molecular Biology Services and DNA Sequencing Description: Molecular Biology s and DNA Sequencing DNA Sequencing s Single Pass Sequencing Sequence data only, for plasmids or PCR products Plasmid DNA or PCR products Plasmid DNA: 20 100 ng/μl PCR Product:

More information

qstar mirna qpcr Detection System

qstar mirna qpcr Detection System qstar mirna qpcr Detection System Table of Contents Table of Contents...1 Package Contents and Storage Conditions...2 For mirna cdna synthesis kit...2 For qstar mirna primer pairs...2 For qstar mirna qpcr

More information

Introduction. Preparation of Template DNA

Introduction. Preparation of Template DNA Procedures and Recommendations for DNA Sequencing at the Plant-Microbe Genomics Facility Ohio State University Biological Sciences Building Room 420, 484 W. 12th Ave., Columbus OH 43210 Telephone: 614/247-6204;

More information

Frequently Asked Questions

Frequently Asked Questions SPARK DNA Sample Prep Kit Ion Torrent (SPK0002-V08) Frequently Asked Questions Under what circumstances would I use SPARK DNA Sample Prep Kit for Ion Torrent? Enzymatics SPARK DNA Sample Prep Kit for Ion

More information

Chromatin Immunoprecipitation

Chromatin Immunoprecipitation Chromatin Immunoprecipitation A) Prepare a yeast culture (see the Galactose Induction Protocol for details). 1) Start a small culture (e.g. 2 ml) in YEPD or selective media from a single colony. 2) Spin

More information

Advantages of pspark over other popular DNA Cloning systems on the market: pgem -T and TOPO TA cloning

Advantages of pspark over other popular DNA Cloning systems on the market: pgem -T and TOPO TA cloning Advantages of pspark over other popular DNA Cloning systems on the market: pgem -T and TOPO TA cloning This study compares the efficiency of the pspark I DNA Cloning system with other popular cloning systems,

More information

PCR Optimization: Reaction Conditions and Components Sample Volume and Reaction Tubes Vapor Barrier and Thermal Transfer Fluid Template DNA or RNA

PCR Optimization: Reaction Conditions and Components Sample Volume and Reaction Tubes Vapor Barrier and Thermal Transfer Fluid Template DNA or RNA PCR Optimization: Reaction Conditions and Components The GeneAmp PCR process is widely employed in a tremendous variety of experimental applications to produce high yields of specific DNA target sequences.

More information

TransformAid Bacterial Transformation Kit

TransformAid Bacterial Transformation Kit Home Contacts Order Catalog Support Search Alphabetical Index Numerical Index Restriction Endonucleases Modifying Enzymes PCR Kits Markers Nucleic Acids Nucleotides & Oligonucleotides Media Transfection

More information

mircute mirna qpcr Detection Kit (SYBR Green)

mircute mirna qpcr Detection Kit (SYBR Green) mircute mirna qpcr Detection Kit (SYBR Green) For detection of mirna using real-time RT-PCR (SYBR Green I) www.tiangen.com QP110302 mircute mirna qpcr Detection Kit (SYBR Green) Kit Contents Cat. no. FP401

More information

Table of Contents. I. Description... 2. II. Kit Components... 2. III. Storage... 2. IV. 1st Strand cdna Synthesis Reaction... 3

Table of Contents. I. Description... 2. II. Kit Components... 2. III. Storage... 2. IV. 1st Strand cdna Synthesis Reaction... 3 Table of Contents I. Description... 2 II. Kit Components... 2 III. Storage... 2 IV. 1st Strand cdna Synthesis Reaction... 3 V. RT-PCR, Real-time RT-PCR... 4 VI. Application... 5 VII. Preparation of RNA

More information

RNA SEQ ENRICHMENT PROTOCOL

RNA SEQ ENRICHMENT PROTOCOL A finalized protocol for depletion of rrnas and human mrnas has been established and is ready to be shared with the HMP and dental research communities. The procedure used involves the following basic

More information

All-in-One First-Strand cdna Synthesis Kit

All-in-One First-Strand cdna Synthesis Kit All-in-One First-Strand cdna Synthesis Kit For reliable first-strand cdna synthesis from all RNA sources Cat. No. AORT-0020 (20 synthesis reactions) Cat. No. AORT-0050 (50 synthesis reactions) User Manual

More information

PstI-MspI GBS. Genotyping-by-sequencing Protocol PstI-MspI. J. Poland, USDA- ARS / Kansas State University. Patrick Brown, University of Illinois

PstI-MspI GBS. Genotyping-by-sequencing Protocol PstI-MspI. J. Poland, USDA- ARS / Kansas State University. Patrick Brown, University of Illinois Genotyping-by-sequencing Protocol PstI-MspI J. Poland, USDA- ARS / Kansas State University Patrick Brown, University of Illinois 20 Dec 2011 ADAPTERS The adapters are ordered as normal oligos (IDT with

More information

1) Vector Preparation sg 1371 w/blp1 Ef1α puro t29 BFP (602 ng/ul)

1) Vector Preparation sg 1371 w/blp1 Ef1α puro t29 BFP (602 ng/ul) 1) Vector Preparation sg 1371 w/blp1 Ef1α puro t29 BFP (602 ng/ul) a) Digest 5 ug of vector with Thermo Scientific FastDigest BstX1 and Blp1 for 1h at 37ºC. Set up reaction as follows: 100 ul Reaction

More information

ID kit. imegen Anchovies II. and E. japonicus) DNA detection by. User manual. Anchovies species (E. encrasicolus. sequencing.

ID kit. imegen Anchovies II. and E. japonicus) DNA detection by. User manual. Anchovies species (E. encrasicolus. sequencing. User manual imegen Anchovies II ID kit Anchovies species (E. encrasicolus and E. japonicus) DNA detection by sequencing Reference: Made in Spain The information in this guide is subject to change without

More information

Introduction to cloning

Introduction to cloning 1 of 14 Introduction to cloning Aim The aim of this protocol is to serve as a general guideline to mainstream molecular cloning of Gene of Interest ( GOI ). Overview GOI Sequence Transformation into Bacteria

More information

Protein extraction from Tissues and Cultured Cells using Bioruptor Standard & Plus

Protein extraction from Tissues and Cultured Cells using Bioruptor Standard & Plus Protein extraction from Tissues and Cultured Cells using Bioruptor Standard & Plus Introduction Protein extraction from tissues and cultured cells is the first step for many biochemical and analytical

More information

Preparing Samples for Sequencing Genomic DNA

Preparing Samples for Sequencing Genomic DNA Preparing Samples for Sequencing Genomic DNA FOR RESEARCH ONLY Topics 3 Introduction 5 Kit Contents and Equipment Checklist 7 Fragment the Genomic DNA 11 Perform End Repair 12 Add A Bases to the 3' End

More information

Terra PCR Direct Polymerase Mix User Manual

Terra PCR Direct Polymerase Mix User Manual Clontech Laboratories, Inc. Terra PCR Direct Polymerase Mix User Manual Cat. Nos. 639269, 639270, 639271 PT5126-1 (031416) Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra Bella Avenue, Mountain

More information

Genomic DNA Clean & Concentrator Catalog Nos. D4010 & D4011

Genomic DNA Clean & Concentrator Catalog Nos. D4010 & D4011 Page 0 INSTRUCTION MANUAL Catalog Nos. D4010 & D4011 Highlights Quick (5 minute) spin column recovery of large-sized DNA (e.g., genomic, mitochondrial, plasmid (BAC/PAC), viral, phage, (wga)dna, etc.)

More information

Our new breed is the center of attention.

Our new breed is the center of attention. Our new breed is the center of attention. PfuUltra II enzyme for highest fidelity enzyme for superior yield Our next generation of high fidelity Pfu-based fusion enzymes sets a new standard in high fidelity

More information

QUANTITATIVE RT-PCR. A = B (1+e) n. A=amplified products, B=input templates, n=cycle number, and e=amplification efficiency.

QUANTITATIVE RT-PCR. A = B (1+e) n. A=amplified products, B=input templates, n=cycle number, and e=amplification efficiency. QUANTITATIVE RT-PCR Application: Quantitative RT-PCR is used to quantify mrna in both relative and absolute terms. It can be applied for the quantification of mrna expressed from endogenous genes, and

More information

Updated: July 2005. 5' End label RNA markers 18.113 (18mer) and 44.12 (24mer) with Kinase and 32P-gamma-ATP. Gel purify labeled markers.

Updated: July 2005. 5' End label RNA markers 18.113 (18mer) and 44.12 (24mer) with Kinase and 32P-gamma-ATP. Gel purify labeled markers. RNA Cloning Method Flowchart Extract total RNA containing small RNAs. Check quality on denaturing gel with EtBr staining 5' End label RNA markers 18.113 (18mer) and 44.12 (24mer) with Kinase and 32P-gamma-ATP.

More information

Western Blot Protocol Protein isolation

Western Blot Protocol Protein isolation Western Blot Protocol Protein isolation A. Preparation of cell lysates. - Preparation of materials: -Dial the microcentrifuge temperature control setting to 4 C -Prepare a bucket of ice -Prepare lysis

More information

SOLIDscript Solid Phase cdna Synthesis Kit Instruction Manual

SOLIDscript Solid Phase cdna Synthesis Kit Instruction Manual Toll Free: 866-252-7771 752A Lincoln Blvd. Phone: 732-469-7771 Fax: 732-469-7782 Middlesex, NJ 08846 Web: www.purebiotechllc.com SOLIDscript Solid Phase cdna Synthesis Kit Instruction Manual Product: SOLIDscript

More information

First Strand cdna Synthesis

First Strand cdna Synthesis 380PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name First Strand cdna Synthesis (Cat. # 786 812) think proteins! think G-Biosciences

More information

DDK phosphorylation of Mcm2 is required for cell growth. Protein expression and purification- Mcm2: Full-length Mcm2 and fragments were

DDK phosphorylation of Mcm2 is required for cell growth. Protein expression and purification- Mcm2: Full-length Mcm2 and fragments were DDK phosphorylation of Mcm2 is required for cell growth Supplemental Data Protein expression and purification- Mcm2: Full-length Mcm2 and fragments were cloned into pet33b (NdeI/BamHI). The plasmids were

More information

HighPure Maxi Plasmid Kit

HighPure Maxi Plasmid Kit HighPure Maxi Plasmid Kit For purification of high pure plasmid DNA with high yields www.tiangen.com PP120109 HighPure Maxi Plasmid Kit Kit Contents Storage Cat.no. DP116 Contents RNaseA (100 mg/ml) Buffer

More information

TruePrime Single Cell WGA Kit

TruePrime Single Cell WGA Kit TruePrime SINGLE CELL WGA KIT HANDBOOK TruePrime Single Cell WGA Kit INDEX Legal...4 Intended use...4 Kit contents...5 Shipping and storage...5 Handling...6 Quality control...6 Reagents and equipment to

More information

Procedures For DNA Sequencing

Procedures For DNA Sequencing Procedures For DNA Sequencing Plant-Microbe Genomics Facility (PMGF) Ohio State University 420 Biological Sciences Building 484 W. 12th Ave., Columbus OH 43210 Telephone: 614/247-6204 FAX: 614/292-6337

More information

PicoMaxx High Fidelity PCR System

PicoMaxx High Fidelity PCR System PicoMaxx High Fidelity PCR System Instruction Manual Catalog #600420 (100 U), #600422 (500 U), and #600424 (1000 U) Revision B Research Use Only. Not for Use in Diagnostic Procedures. 600420-12 LIMITED

More information

gblocks Gene Fragments Cloning Protocols

gblocks Gene Fragments Cloning Protocols gblocks Gene Fragments Cloning Protocols Contents Background 1 General instructions 3 Cloning gblocks Gene Fragments using the Gibson Assembly method 3 Cohesive-end restriction cloning of gblocks Gene

More information

Exercise 5: Detection of a Human Alu Element by PCR

Exercise 5: Detection of a Human Alu Element by PCR Exercise 5: Detection of a Human Alu Element by PCR (adapted from Dolan DNA Learning Center, Cold Spring Harbor Laboratory, NY and Science Outreach, Washington University, St. Louis, MO) Background Information

More information

User Manual. CelluLyser Lysis and cdna Synthesis Kit. Version 1.4 Oct 2012 From cells to cdna in one tube

User Manual. CelluLyser Lysis and cdna Synthesis Kit. Version 1.4 Oct 2012 From cells to cdna in one tube User Manual CelluLyser Lysis and cdna Synthesis Kit Version 1.4 Oct 2012 From cells to cdna in one tube CelluLyser Lysis and cdna Synthesis Kit Table of contents Introduction 4 Contents 5 Storage 5 Additionally

More information

HiPer RT-PCR Teaching Kit

HiPer RT-PCR Teaching Kit HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The

More information

Chen et al., Human Mutation 1

Chen et al., Human Mutation 1 Chen et al., Human Mutation 1 A B Supp. Figure S1. Optical coherence tomogram (OCT) of a patient with PHARC. A. a normal control. B. cystic retinal edema in the patient. Chen et al., Human Mutation 2 A

More information

Protocols. Internal transcribed spacer region (ITS) region. Niklaus J. Grünwald, Frank N. Martin, and Meg M. Larsen (2013)

Protocols. Internal transcribed spacer region (ITS) region. Niklaus J. Grünwald, Frank N. Martin, and Meg M. Larsen (2013) Protocols Internal transcribed spacer region (ITS) region Niklaus J. Grünwald, Frank N. Martin, and Meg M. Larsen (2013) The nuclear ribosomal RNA (rrna) genes (small subunit, large subunit and 5.8S) are

More information

In vitro analysis of pri-mirna processing. by Drosha-DGCR8 complex. (Narry Kim s lab)

In vitro analysis of pri-mirna processing. by Drosha-DGCR8 complex. (Narry Kim s lab) In vitro analysis of pri-mirna processing by Drosha-DGCR8 complex (Narry Kim s lab) 1-1. Preparation of radiolabeled pri-mirna transcript The RNA substrate for a cropping reaction can be prepared by in

More information

SeqDirect PCR Cleaning Kit SeqDirect 96 PCR Cleaning Kit. High throughput cleaning of PCR reactions for fluorescent cycle sequencing

SeqDirect PCR Cleaning Kit SeqDirect 96 PCR Cleaning Kit. High throughput cleaning of PCR reactions for fluorescent cycle sequencing SeqDirect PCR Cleaning Kit SeqDirect 96 PCR Cleaning Kit High throughput cleaning of PCR reactions for fluorescent cycle sequencing Revision # 9903/4-100-9k14 SeqDirect PCR Cleaning Kit SeqDirect 96 PCR

More information

ELUTION OF DNA FROM AGAROSE GELS

ELUTION OF DNA FROM AGAROSE GELS ELUTION OF DNA FROM AGAROSE GELS OBTECTIVE: To isolate specific bands or regions of agarose-separated DNA for use in subsequent experiments and/or procedures. INTRODUCTION: It is sometimes necessary to

More information

Real-time quantitative RT -PCR (Taqman)

Real-time quantitative RT -PCR (Taqman) Real-time quantitative RT -PCR (Taqman) Author: SC, Patti Lab, 3/03 This is performed as a 2-step reaction: 1. cdna synthesis from DNase 1-treated total RNA 2. PCR 1. cdna synthesis (Advantage RT-for-PCR

More information

Sanger Sequencing. Troubleshooting Guide. Failed sequence

Sanger Sequencing. Troubleshooting Guide. Failed sequence Sanger Sequencing Troubleshooting Guide Below are examples of the main problems experienced in ABI Sanger sequencing. Possible causes for failure and their solutions are listed below each example. The

More information

Constructing Normalized cdna Libraries

Constructing Normalized cdna Libraries Constructing Normalized cdna Libraries The Center for Genomics and Bioinformatics Indiana University By: Zach Smith A. Introduction: In order to obtain high quality, low redundancy cdna libraries, it is

More information

FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE.

FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE. Instruction manual KOD -Plus- 0902 F0934K KOD -Plus- Contents [1] Introduction [2] Components [3] Quality testing [4] Primer design [5] Cloning of PCR products [6] Protocol 1. Standard reaction setup 2.

More information

Aurora Forensic Sample Clean-up Protocol

Aurora Forensic Sample Clean-up Protocol Aurora Forensic Sample Clean-up Protocol 106-0008-BA-D 2015 Boreal Genomics, Inc. All rights reserved. All trademarks are property of their owners. http://www.borealgenomics.com support@borealgenomics.com

More information

Reference Dye N/A ROX & ROX II (as separate tubes) ROX & ROX II (as separate tubes)

Reference Dye N/A ROX & ROX II (as separate tubes) ROX & ROX II (as separate tubes) Comparison of TaKaRa s and qrt-pcr Kits SYBR Premix Ex Taq (Tli RNase H+) Premix Ex Taq (Probe qpcr) SYBR Premix Ex Taq II (Tli RNase H+) Cat.# RR420A RR390A RR820A Reactions/Kit 200 (50 µl reaction size)

More information

Sequencing Guidelines Adapted from ABI BigDye Terminator v3.1 Cycle Sequencing Kit and Roswell Park Cancer Institute Core Laboratory website

Sequencing Guidelines Adapted from ABI BigDye Terminator v3.1 Cycle Sequencing Kit and Roswell Park Cancer Institute Core Laboratory website Biomolecular Core Facility AI Dupont Hospital for Children, Rockland Center One, Room 214 Core: (302) 651-6712, Office: (302) 651-6707, mbcore@nemours.org Katia Sol-Church, Ph.D., Director Jennifer Frenck

More information

Isolation and Electrophoresis of Plasmid DNA

Isolation and Electrophoresis of Plasmid DNA Name Date Isolation and Electrophoresis of Plasmid DNA Prior to lab you should be able to: o Explain what cloning a gene accomplishes for a geneticist. o Describe what a plasmid is. o Describe the function

More information

EXPERIMENT 4 CLONING THE PROMOTER REGION OF THE GENE-OF-INTEREST

EXPERIMENT 4 CLONING THE PROMOTER REGION OF THE GENE-OF-INTEREST EXPERIMENT 4 CLONING THE PROMOTER REGION OF THE GENE-OF-INTEREST Purposes: 1. (Long term) To determine the activity of the promoter of the gene-of-interest at the cellular and tissue levels in Arabidopsis

More information

RealStar HBV PCR Kit 1.0 11/2012

RealStar HBV PCR Kit 1.0 11/2012 RealStar HBV PCR Kit 1.0 11/2012 RealStar HBV PCR Kit 1.0 For research use only! (RUO) Product No.: 201003 96 rxns INS-201000-GB-02 Store at -25 C... -15 C November 2012 altona Diagnostics GmbH Mörkenstraße

More information

Extraction from Buccal Epithelial Cells

Extraction from Buccal Epithelial Cells Genomic DNA Extraction from Buccal Epithelial Cells The purpose of this lab is to collect a DNA sample from the cells that line the inside of your mouth and to use this sample to explore one of the most

More information

POLYMERASE CHAIN REACTION (PCR)

POLYMERASE CHAIN REACTION (PCR) POLYMERASE CHAIN REACTION (PCR) The polymerase chain reaction (PCR) is a technique used to amplify specific segments of DNA that may range in size from ca. 200-2000 or more base pairs. Two recent papers

More information

Idaho Technology Inc. Kit No. HRLS-ASY Reactions Kit No. HRLS-ASY Reactions

Idaho Technology Inc.  Kit No. HRLS-ASY Reactions Kit No. HRLS-ASY Reactions Idaho Technology Inc. www.idahotech.com Kit No. HRLS-ASY-0002 100 Reactions Kit No. HRLS-ASY-0003 500 Reactions Kit Contents Quantity 1 x 100 Reactions OR 5 x 100 Reactions Description 2.5X Master Mix

More information

PrimeSTAR GXL DNA Polymerase

PrimeSTAR GXL DNA Polymerase For Research Use PrimeSTAR GXL DNA Polymerase Product Manual Table of Contents I. Description...3 II. Components...3 III. Storage...3 IV. Protocols...4 V. Optimization of Parameters...6 VI. Electrophoresis,

More information

UltraClean PCR Clean-Up Kit

UltraClean PCR Clean-Up Kit UltraClean PCR Clean-Up Kit Catalog No. Quantity 12500-50 50 Preps 12500-100 100 Preps 12500-250 250 Preps Instruction Manual Please recycle Version: 02212013 1 Table of Contents Introduction... 3 Protocol

More information

Troubleshooting the Single-step PCR Site-directed Mutagenesis Procedure Intended to Create a Non-functional rop Gene in the pbr322 Plasmid

Troubleshooting the Single-step PCR Site-directed Mutagenesis Procedure Intended to Create a Non-functional rop Gene in the pbr322 Plasmid Troubleshooting the Single-step PCR Site-directed Mutagenesis Procedure Intended to Create a Non-functional rop Gene in the pbr322 Plasmid Lina Jew Department of Microbiology & Immunology, University of

More information

Reverse Transcription System

Reverse Transcription System TECHNICAL BULLETIN Reverse Transcription System Instruc ons for use of Product A3500 Revised 1/14 TB099 Reverse Transcription System All technical literature is available on the Internet at: www.promega.com/protocols/

More information

Sputum-Based Mycobacterium tuberculosis PCR Detection Kit Product # 42100

Sputum-Based Mycobacterium tuberculosis PCR Detection Kit Product # 42100 3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Sputum-Based Mycobacterium tuberculosis PCR Detection Kit Product

More information

Competitive PCR Guide

Competitive PCR Guide Lit. # L0126 Rev. 8/99 Competitive PCR Guide Table of Contents I. What is Competitive PCR? A. Difficulties of Quantitative Analysis in Normal PCR... 2 B. Principle of Competitive PCR... 3 C. Competitive

More information