Different types of microarrays
|
|
|
- Theodora Bishop
- 7 years ago
- Views:
Transcription
1 Different types of microarrays # of samples hybridized Method of generating probes cdna Library Synthesized Single-channel Affymetrix (25-mer) NimbleGen (50-75-mer) Agilent (60-mer) Illumina (50-mer) Dual-channel cdna spotted arrays (Stanford) NimbleGen Agilent Illumina
2 What Is Microarray Technology? Different Approaches How DNA sequences are laid down Length of DNA sequences Stanford/ Pat Brown Spotting cdna(complet e sequences) Affymetrix Photolithography Oligonucleotides
3 complementary DNA (cdna) cdna is a strand of DNA that is complementary to part of an mrna sequence. mrna cdna...ccugauagaugg......ggactatctacc... cdna can be formed by extracting mrna and then using mrna as a template for formation of cdna cdna sequences can be copied rapidly using PCR (polymerase chain reaction). These sequences can be spotted on glass slides to serves as microarray probes. Sequence length varies from a few hundred bases to a thousand or so.
4 cdna Microarrays Glass slides or similar supports containing cdna sequences that serve as probes for measuring mrna levels in target samples cdnas are arrayed on each slide in a grid of spots. Each spot contains thousands of copies of a sequence that matches a segment of a gene s coding sequence. A sequence and its complement are present in the same spot.
5 cdna Microarray (continued) Different spots typically represent different genes, but some genes may be represented by multiple spots The spotted sequences are known (or can be determined) and their locations on the array are known. The sequence locations do not change from slide to slide. A single slide typically contains thousands of spots.
6 cdna microarray slide 1 cdna microarray slide 2 spot for gene 201 GATATG... GATATG GATATG... spot for gene 201 GATATG... GATATG GATATG... spot for gene 576 TTCCAG... TTCCAG TTCCAG... spot for gene 576 TTCCAG... TTCCAG TTCCAG... Each spot contains many copies of a sequence along with its complement (not shown).
7 Spotting cdna Probes on Microarrays Solutions containing probes are transferred from a plate to a microarray slide by a robotic arrayer. The robot picks up a small amount of solution containing a probe by dipping a pin into a well on a plate. The robot then deposits a small drop of the solution on the microarray slide by touching the pin onto the slide. The pin is washed and the process is repeated for a different probe. Most arrayers use several pins so that multiple probes are spotted simultaneously on a slide. Most arrayers print multiple slides together so that probes are deposited on several slides prior to washing.
8 Cartoon of Printing Process (side view from the table top) Plate with wells containing probes microarray slides vacuum wash station
9 Spotting the Probes on the Microarray 8 X 4 Print Head microarray slide plate with wells holding probes in solution All spots of the same color are made at the same time. All spots in the same sector are made by the same pin.
10 Using cdna Microarrays to Measure mrna Levels RNA is extracted from a target sample of interest. mrna are reverse transcribed into cdna. The resulting cdna are labeled with a fluorescent dye. The dyed cdna are placed on a microarray slide. Dyed cdna sequences hybridize to complementary probes spotted on the array. A laser excites the dye and a scanner records an image of the slide. The image is quantified to obtain measures of fluorescence intensity for each pixel. Pixel values are processed to obtain measures of mrna abundance for each probe spotted on the array.
11 Using cdna Microarrays to Measure mrna Levels (ctd.) Usually two samples, dyed with different dyes, are hybridized to a single slide. The dyes fluoresce at different wavelengths so it is possible to get separate images for each dye. Cyanine 3 (Cy3) and Cyanine 5 (Cy5) are currently the two most commonly used dyes. Images from the scanner are black and white, but it is typical to display Cy3 images as green and Cy5 images are displayed as red. It is common to superimpose the two images using yellow to indicate a mixture of green and red.
12
13 There are many ways to obtain a labeled target sample. Here s a simplified version of one method. mrna cdna target...ggcuuaaugagccuuaaaaaa...a... CCGAATT ACTCG GAA TTTTTT...T poly-a tail viral enzyme reverse transcriptase recognizes poly-t bound to poly-a and begins to add complementary DNA nucleotides. The C nucleotides are dyed. poly-t primer
14 Difficult to Make Meaningful Comparisons between Genes The measures of mrna levels are affected by several factors that are partly or completely confounded with genes (e.g., cdna source plate, cdna well, print pin, slide position, length of mrna sequence, base composition of mrna sequence, specificity of probe sequence, etc.). Within-gene comparisons of multiple cell types or across multiple treatment conditions are much more meaningful.
15 Using cdna Microarrays to Measure mrna Levels Microarray Slide Sample 1 ACCTG...G ACCTG...G ACCTG...G TTCTG...A TTCTG...A TTCTG...A GGCTT...C GGCTT...C GGCTT...C ATCTA...A ATCTA...A ATCTA...A Spots (Probes) Sample 2 ACGGG...T ACGGG...T ACGGG...T CGATA...G CGATA...G CGATA...G Unknown mrna Sequences (Target)
16 Extract mrna Sample 1 ACCTG...G ACCTG...G ACCTG...G TTCTG...A TTCTG...A TTCTG...A GGCTT...C GGCTT...C GGCTT...C ATCTA...A ATCTA...A ATCTA...A Sample 2 ACGGG...T ACGGG...T ACGGG...T CGATA...G CGATA...G CGATA...G
17 Convert to cdna and Label with Fluorescent Dyes Sample 1 ACCTG...G ACCTG...G ACCTG...G TTCTG...A TTCTG...A TTCTG...A GGCTT...C GGCTT...C GGCTT...C ATCTA...A ATCTA...A ATCTA...A Sample 2 ACGGG...T ACGGG...T ACGGG...T CGATA...G CGATA...G CGATA...G
18 Mix Labeled cdna Sample 1 ACCTG...G ACCTG...G ACCTG...G TTCTG...A TTCTG...A TTCTG...A GGCTT...C GGCTT...C GGCTT...C ATCTA...A ATCTA...A ATCTA...A Sample 2 ACGGG...T ACGGG...T ACGGG...T CGATA...G CGATA...G CGATA...G
19 Hybridize cdna to the Slide Sample 1 ACCTG...G ACCTG...G ACCTG...G TTCTG...A TTCTG...A TTCTG...A GGCTT...C GGCTT...C GGCTT...C ATCTA...A ATCTA...A ATCTA...A Sample 2 ACGGG...T ACGGG...T ACGGG...T CGATA...G CGATA...G CGATA...G
20 Excite Dyes with Laser Sample 1 ACCTG...G ACCTG...G ACCTG...G TTCTG...A TTCTG...A TTCTG...A GGCTT...C GGCTT...C GGCTT...C ATCTA...A ATCTA...A ATCTA...A Sample 2 ACGGG...T ACGGG...T ACGGG...T CGATA...G CGATA...G CGATA...G
21 Scan Sample 1 ACCTG...G ACCTG...G ACCTG...G TTCTG...A TTCTG...A TTCTG...A GGCTT...C GGCTT...C GGCTT...C ATCTA...A ATCTA...A ATCTA...A Sample 2 ACGGG...T ACGGG...T ACGGG...T CGATA...G CGATA...G CGATA...G
22 Quantify Signals Sample 1 ACCTG...G TTCTG...A GGCTT...C ATCTA...A Sample 2 ACGGG...T CGATA...G
23 cdna Arrays: Advantages Non-redundant clone sets are available for numerous organisms (humans, mouse, rats, drosophila, yeast, c.elegans, arabidopsis) Prior knowledge of gene sequence is not necessary: good choice for gene discovery Large cdna size is great for hybridization Glass or membrane spotting technology is readily available
24 cdna Arrays: Disadvantages Processing cdnas to generate spotting-ready material is cumbersome Low density compared to oligonucleotide arrays cdnas may contain repetitive sequences (like Alu in humans) Common sequences from gene families (ex: zinc fingers) are present in all cdnas from these genes: potential for cross-hybridization Clone authentication can be difficult
25 Oligonucleotides An oligonucleotide is a short sequence of nucleotides. (oligonucleotide=oligo for short) An oligonucleotide microarray is a microarray whose probes consist of synthetically created DNA oligonucleotides. Probes sequences are chosen to have good and relatively uniform hybridization characteristics. A probe is chosen to match a portion of its target mrna transcript that is unique to that sequence. Oligo probes can distinguish among multiple mrna transcripts with similar sequences.
26 Simplified Example... gene 1... oligo probe for gene 1 ATTACTAAGCATAGATTGCCGTATA gene shared blue regions indicate high degree of sequence similarity throughout much of the transcript GCGTATGGCATGCCCGGTAAACTGG oligo probe for gene 2
27 Oligo Microarray Fabrication Oligos can be synthesized and stored in solution for spotting as is done with cdna microarrays. Oligo sequences can be synthesized on a slide or chip using various commercial technologies. In one approach, sequences are synthesized on a slide using ink-jet technology similar to that used in color printers. Separate cartridges for the four bases (A, C, G, T) are used to build nucleotides on a slide. The company Affymetrix uses a photolithographic approach which we will describe briefly.
28 Affymetrix GeneChips Affymetrix ( is a company that manufactures GeneChips. GeneChips are oligonucleotide arrays. Each gene (more accurately sequence of interest or feature) is represented by multiple short (25-nucleotide) oligo probes. Some GeneChips include probes for around 60,000 genes. mrna that has been extracted from a biological sample can be labeled (dyed) and hybridized to a GeneChip in a manner similar to that described for cdna microarrays. Only one sample is hybridized to each GeneChip rather than two as in the case of cdna microarrays.
29 Affymetrix Probe Sets A probe set is used to measure mrna levels of a single gene. Each probe set consists of multiple probe cells. Each probe cell contains millions of copies of one oligo. Each oligo is intended to be 25 nucleotides in length. Probe cells in a probe set are arranged in probe pairs. Each probe pair contains a perfect match (PM) probe cell and a mismatch (MM) probe cell. A PM oligo perfectly matches part of a gene sequence. A MM oligo is identical to a PM oligo except that the middle nucleotide (13 th of 25) is intentionally replaced by its complementary nucleotide.
30 A Probe Set for Measuring Expression Level of a Particular Gene...TGCAATGGGTCAGAAGGACTCCTATGTGCCT... AATGGGTCAGAAGGACTCCTATGTG AATGGGTCAGAACGACTCCTATGTG gene sequence perfect match sequence mismatch sequence probe pair probe cell probe set
31 Different Probe Pairs Represent Different Parts of the Same Gene gene sequence Probes are selected to be specific to the target gene and have good hybridization characterictics.
32 Affymetrix s Photolithographic Approach mask mask mask mask mask mask mask mask A C T C T T T A G T C A A C A G GeneChip
33 Source:
34 Source:
35 Source:
36 Obtaining Labeled Target 1. RNA single strand cdna 2. single strand cdna double strand cdna 3. double strand cdna labeled single strand crna complementary to coding sequence Number of copies of each sequence gets amplified in conversion to crna.
37 Image from Hybridized GeneChip Source:
38 Affymetrix Microarrays Raw image 1.28cm 50um ~10 7 oligonucleotides, half Perfectly Match mrna (PM), half have one Mismatch (MM) Raw gene expression is intensity difference: PM - MM
39 Hybridization Process
40 Tumor Cell Analysis
41 Sources of Error Systematic Random log signal intensity log RNA abundance
42 Heatmap Visualization of Selected Fields Heatmap visualization is done by normalizing each gene to mean 0, std. 1 to get a picture like this. AML-related ALL AML Good correlation overall Possible outliers ALL-related
43 Microarray Data Processing quality & intensity filtering background correction normalization expression ratios (treated / control)
44 Analysis Tasks Identify up- and down-regulated genes. Find groups of genes with similar expression profiles (++ / --, fold change). Find groups of experiments (tissues) with similar expression profiles (++ / -- genes). Find genes that explain observed differences among tissues (feature selection), and new pathways.
45 Gene Expression Cells are different because of differential gene expression. About 40% of human genes are expressed at any one time. Gene is expressed by transcribing DNA exons into single-stranded mrna mrna is later translated into a protein Microarrays measure the level of mrna expression by analyzing cdna binding
46 Analysis of Gene Expression Examine expression during development or in different tissues Compare genes expressed in normal vs. diseased states Analyze response of cells exposed to drugs or different physiological conditions
47 Monitoring Changes in Genomic DNA Identify mutations Examine genomic instability such as in certain cancers and tumors (gene amplifications, translocations, deletions) Identify polymorphisms (SNPs) Diagnosis: chips have been designed to detect mutations in p53, HIV, and the breast cancer gene BRCA-1
48 Applications in Medicine Gene expression studies Gene function for cell state change in various conditions (clustering, classification) Disease diagnosis (classification) Inferring regulatory networks Pathogen analysis (rapid genotyping)
49 Microarrays: An Example Leukemia: Acute Lymphoblastic (ALL) vs Acute Myeloid (AML), Golub et al, Science, v.286, examples (38 train, 34 test), about 7,000 genes well-studied (CAMDA-2000), good test example ALL AML Visually similar, but genetically very different
50 Applications in Drug Discovery Drug Discovery Identify appropriate molecular targets for therapeutic intervention (small molecule / proteins) Monitor changes in gene expression in response to drug treatments (up / down regulation) Analyze patient populations (SNPs) and response Targeted Drug Treatment Pharmacogenomics: individualized treatments Choosing drugs with the least probable side effects
Microarray Technology
Microarrays And Functional Genomics CPSC265 Matt Hudson Microarray Technology Relatively young technology Usually used like a Northern blot can determine the amount of mrna for a particular gene Except
How many of you have checked out the web site on protein-dna interactions?
How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss
Analysis of gene expression data. Ulf Leser and Philippe Thomas
Analysis of gene expression data Ulf Leser and Philippe Thomas This Lecture Protein synthesis Microarray Idea Technologies Applications Problems Quality control Normalization Analysis next week! Ulf Leser:
Molecular Genetics: Challenges for Statistical Practice. J.K. Lindsey
Molecular Genetics: Challenges for Statistical Practice J.K. Lindsey 1. What is a Microarray? 2. Design Questions 3. Modelling Questions 4. Longitudinal Data 5. Conclusions 1. What is a microarray? A microarray
Recombinant DNA and Biotechnology
Recombinant DNA and Biotechnology Chapter 18 Lecture Objectives What Is Recombinant DNA? How Are New Genes Inserted into Cells? What Sources of DNA Are Used in Cloning? What Other Tools Are Used to Study
Basic Analysis of Microarray Data
Basic Analysis of Microarray Data A User Guide and Tutorial Scott A. Ness, Ph.D. Co-Director, Keck-UNM Genomics Resource and Dept. of Molecular Genetics and Microbiology University of New Mexico HSC Tel.
Measuring gene expression (Microarrays) Ulf Leser
Measuring gene expression (Microarrays) Ulf Leser This Lecture Gene expression Microarrays Idea Technologies Problems Quality control Normalization Analysis next week! 2 http://learn.genetics.utah.edu/content/molecules/transcribe/
Introduction To Real Time Quantitative PCR (qpcr)
Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors
Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
HiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
Technical Note. Roche Applied Science. No. LC 18/2004. Assay Formats for Use in Real-Time PCR
Roche Applied Science Technical Note No. LC 18/2004 Purpose of this Note Assay Formats for Use in Real-Time PCR The LightCycler Instrument uses several detection channels to monitor the amplification of
Real-Time PCR Vs. Traditional PCR
Real-Time PCR Vs. Traditional PCR Description This tutorial will discuss the evolution of traditional PCR methods towards the use of Real-Time chemistry and instrumentation for accurate quantitation. Objectives
Data Acquisition. DNA microarrays. The functional genomics pipeline. Experimental design affects outcome data analysis
Data Acquisition DNA microarrays The functional genomics pipeline Experimental design affects outcome data analysis Data acquisition microarray processing Data preprocessing scaling/normalization/filtering
Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources
Appendix 2 Molecular Biology Core Curriculum Websites and Other Resources Chapter 1 - The Molecular Basis of Cancer 1. Inside Cancer http://www.insidecancer.org/ From the Dolan DNA Learning Center Cold
RNA & Protein Synthesis
RNA & Protein Synthesis Genes send messages to cellular machinery RNA Plays a major role in process Process has three phases (Genetic) Transcription (Genetic) Translation Protein Synthesis RNA Synthesis
Essentials of Real Time PCR. About Sequence Detection Chemistries
Essentials of Real Time PCR About Real-Time PCR Assays Real-time Polymerase Chain Reaction (PCR) is the ability to monitor the progress of the PCR as it occurs (i.e., in real time). Data is therefore collected
Single Nucleotide Polymorphisms (SNPs)
Single Nucleotide Polymorphisms (SNPs) Additional Markers 13 core STR loci Obtain further information from additional markers: Y STRs Separating male samples Mitochondrial DNA Working with extremely degraded
Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS)
Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) A typical RNA Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,
Structure and Function of DNA
Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four
Core Facility Genomics
Core Facility Genomics versatile genome or transcriptome analyses based on quantifiable highthroughput data ascertainment 1 Topics Collaboration with Harald Binder and Clemens Kreutz Project: Microarray
Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis
Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype
Gene Expression Assays
APPLICATION NOTE TaqMan Gene Expression Assays A mpl i fic ationef ficienc yof TaqMan Gene Expression Assays Assays tested extensively for qpcr efficiency Key factors that affect efficiency Efficiency
Genetics Lecture Notes 7.03 2005. Lectures 1 2
Genetics Lecture Notes 7.03 2005 Lectures 1 2 Lecture 1 We will begin this course with the question: What is a gene? This question will take us four lectures to answer because there are actually several
REAL TIME PCR USING SYBR GREEN
REAL TIME PCR USING SYBR GREEN 1 THE PROBLEM NEED TO QUANTITATE DIFFERENCES IN mrna EXPRESSION SMALL AMOUNTS OF mrna LASER CAPTURE SMALL AMOUNTS OF TISSUE PRIMARY CELLS PRECIOUS REAGENTS 2 THE PROBLEM
Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals
Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals Xiaohui Xie 1, Jun Lu 1, E. J. Kulbokas 1, Todd R. Golub 1, Vamsi Mootha 1, Kerstin Lindblad-Toh
DNA Microarrays (Gene Chips) and Cancer
Cancer Education Project DNA Microarrays (Gene Chips) and Cancer Overview: This series of activities explores the use of DNA Microarray (Gene Chips) technology in investigations to understand the role
Materials and Methods. Blocking of Globin Reverse Transcription to Enhance Human Whole Blood Gene Expression Profiling
Application Note Blocking of Globin Reverse Transcription to Enhance Human Whole Blood Gene Expression Profi ling Yasmin Beazer-Barclay, Doug Sinon, Christopher Morehouse, Mark Porter, and Mike Kuziora
Translation Study Guide
Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to
Transcription and Translation of DNA
Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes
Illumina Sequencing Technology
Illumina Sequencing Technology Highest data accuracy, simple workflow, and a broad range of applications. Introduction Figure 1: Illumina Flow Cell Illumina sequencing technology leverages clonal array
Human Genome Organization: An Update. Genome Organization: An Update
Human Genome Organization: An Update Genome Organization: An Update Highlights of Human Genome Project Timetable Proposed in 1990 as 3 billion dollar joint venture between DOE and NIH with 15 year completion
Gene Mapping Techniques
Gene Mapping Techniques OBJECTIVES By the end of this session the student should be able to: Define genetic linkage and recombinant frequency State how genetic distance may be estimated State how restriction
SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE
AP Biology Date SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE LEARNING OBJECTIVES Students will gain an appreciation of the physical effects of sickle cell anemia, its prevalence in the population,
Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology
Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,
Real-time quantitative RT -PCR (Taqman)
Real-time quantitative RT -PCR (Taqman) Author: SC, Patti Lab, 3/03 This is performed as a 2-step reaction: 1. cdna synthesis from DNase 1-treated total RNA 2. PCR 1. cdna synthesis (Advantage RT-for-PCR
Biotechnology: DNA Technology & Genomics
Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 The BIG Questions How can we use our knowledge of DNA to: diagnose disease or defect? cure disease or defect? change/improve organisms? What
Exercises for the UCSC Genome Browser Introduction
Exercises for the UCSC Genome Browser Introduction 1) Find out if the mouse Brca1 gene has non-synonymous SNPs, color them blue, and get external data about a codon-changing SNP. Skills: basic text search;
Genotyping by sequencing and data analysis. Ross Whetten North Carolina State University
Genotyping by sequencing and data analysis Ross Whetten North Carolina State University Stein (2010) Genome Biology 11:207 More New Technology on the Horizon Genotyping By Sequencing Timeline 2007 Complexity
Genetics Module B, Anchor 3
Genetics Module B, Anchor 3 Key Concepts: - An individual s characteristics are determines by factors that are passed from one parental generation to the next. - During gamete formation, the alleles for
Biological Sciences Initiative. Human Genome
Biological Sciences Initiative HHMI Human Genome Introduction In 2000, researchers from around the world published a draft sequence of the entire genome. 20 labs from 6 countries worked on the sequence.
MUTATION, DNA REPAIR AND CANCER
MUTATION, DNA REPAIR AND CANCER 1 Mutation A heritable change in the genetic material Essential to the continuity of life Source of variation for natural selection New mutations are more likely to be harmful
Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College
Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology
Lecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides
Lecture Series 7 From DNA to Protein: Genotype to Phenotype Reading Assignments Read Chapter 7 From DNA to Protein A. Genes and the Synthesis of Polypeptides Genes are made up of DNA and are expressed
Comparative genomic hybridization Because arrays are more than just a tool for expression analysis
Microarray Data Analysis Workshop MedVetNet Workshop, DTU 2008 Comparative genomic hybridization Because arrays are more than just a tool for expression analysis Carsten Friis ( with several slides from
PreciseTM Whitepaper
Precise TM Whitepaper Introduction LIMITATIONS OF EXISTING RNA-SEQ METHODS Correctly designed gene expression studies require large numbers of samples, accurate results and low analysis costs. Analysis
Protein Synthesis How Genes Become Constituent Molecules
Protein Synthesis Protein Synthesis How Genes Become Constituent Molecules Mendel and The Idea of Gene What is a Chromosome? A chromosome is a molecule of DNA 50% 50% 1. True 2. False True False Protein
Algorithms in Computational Biology (236522) spring 2007 Lecture #1
Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office
Control of Gene Expression
Control of Gene Expression What is Gene Expression? Gene expression is the process by which informa9on from a gene is used in the synthesis of a func9onal gene product. What is Gene Expression? Figure
A Primer of Genome Science THIRD
A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:
Molecular Genetics. RNA, Transcription, & Protein Synthesis
Molecular Genetics RNA, Transcription, & Protein Synthesis Section 1 RNA AND TRANSCRIPTION Objectives Describe the primary functions of RNA Identify how RNA differs from DNA Describe the structure and
First Strand cdna Synthesis
380PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name First Strand cdna Synthesis (Cat. # 786 812) think proteins! think G-Biosciences
March 19, 2014. Dear Dr. Duvall, Dr. Hambrick, and Ms. Smith,
Dr. Daniel Duvall, Medical Officer Center for Medicare, Hospital and Ambulatory Policy Group Centers for Medicare and Medicaid Services 7500 Security Boulevard Baltimore, Maryland 21244 Dr. Edith Hambrick,
DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!
DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other
2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three
Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,
Next Generation Sequencing
Next Generation Sequencing Technology and applications 10/1/2015 Jeroen Van Houdt - Genomics Core - KU Leuven - UZ Leuven 1 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977
TECHNOLOGIES, PRODUCTS & SERVICES for MOLECULAR DIAGNOSTICS, MDx ABA 298
DIAGNOSTICS BUSINESS ANALYSIS SERIES: TECHNOLOGIES, PRODUCTS & SERVICES for MOLECULAR DIAGNOSTICS, MDx ABA 298 By ADAMS BUSINESS ASSOCIATES MAY 2014. May 2014 ABA 298 1 Technologies, Products & Services
Forensic DNA Testing Terminology
Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.
How is genome sequencing done?
How is genome sequencing done? Using 454 Sequencing on the Genome Sequencer FLX System, DNA from a genome is converted into sequence data through four primary steps: Step One DNA sample preparation; Step
OriGene Technologies, Inc. MicroRNA analysis: Detection, Perturbation, and Target Validation
OriGene Technologies, Inc. MicroRNA analysis: Detection, Perturbation, and Target Validation -Optimal strategies to a successful mirna research project Optimal strategies to a successful mirna research
CCR Biology - Chapter 9 Practice Test - Summer 2012
Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible
Next Generation Sequencing: Technology, Mapping, and Analysis
Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University gbenson@bu.edu http://tandem.bu.edu/ The Human Genome Project took
Gene mutation and molecular medicine Chapter 15
Gene mutation and molecular medicine Chapter 15 Lecture Objectives What Are Mutations? How Are DNA Molecules and Mutations Analyzed? How Do Defective Proteins Lead to Diseases? What DNA Changes Lead to
DNA Sequence Analysis
DNA Sequence Analysis Two general kinds of analysis Screen for one of a set of known sequences Determine the sequence even if it is novel Screening for a known sequence usually involves an oligonucleotide
Overview of Genetic Testing and Screening
Integrating Genetics into Your Practice Webinar Series Overview of Genetic Testing and Screening Genetic testing is an important tool in the screening and diagnosis of many conditions. New technology is
Description: Molecular Biology Services and DNA Sequencing
Description: Molecular Biology s and DNA Sequencing DNA Sequencing s Single Pass Sequencing Sequence data only, for plasmids or PCR products Plasmid DNA or PCR products Plasmid DNA: 20 100 ng/μl PCR Product:
Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )
Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins
DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA
DNA Fingerprinting Unless they are identical twins, individuals have unique DNA DNA fingerprinting The name used for the unambiguous identifying technique that takes advantage of differences in DNA sequence
Gene Models & Bed format: What they represent.
GeneModels&Bedformat:Whattheyrepresent. Gene models are hypotheses about the structure of transcripts produced by a gene. Like all models, they may be correct, partly correct, or entirely wrong. Typically,
Molecular diagnostics is now used for a wide range of applications, including:
Molecular Diagnostics: A Dynamic and Rapidly Broadening Market Molecular diagnostics is now used for a wide range of applications, including: Human clinical molecular diagnostic testing Veterinary molecular
Real-time PCR: Understanding C t
APPLICATION NOTE Real-Time PCR Real-time PCR: Understanding C t Real-time PCR, also called quantitative PCR or qpcr, can provide a simple and elegant method for determining the amount of a target sequence
Sanger Sequencing and Quality Assurance. Zbigniew Rudzki Department of Pathology University of Melbourne
Sanger Sequencing and Quality Assurance Zbigniew Rudzki Department of Pathology University of Melbourne Sanger DNA sequencing The era of DNA sequencing essentially started with the publication of the enzymatic
2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.
1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence
To be able to describe polypeptide synthesis including transcription and splicing
Thursday 8th March COPY LO: To be able to describe polypeptide synthesis including transcription and splicing Starter Explain the difference between transcription and translation BATS Describe and explain
Real-time qpcr Assay Design Software www.qpcrdesign.com
Real-time qpcr Assay Design Software www.qpcrdesign.com Your Blueprint For Success Informational Guide 2199 South McDowell Blvd Petaluma, CA 94954-6904 USA 1.800.GENOME.1(436.6631) 1.415.883.8400 1.415.883.8488
From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains
Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes
Data Analysis for Ion Torrent Sequencing
IFU022 v140202 Research Use Only Instructions For Use Part III Data Analysis for Ion Torrent Sequencing MANUFACTURER: Multiplicom N.V. Galileilaan 18 2845 Niel Belgium Revision date: August 21, 2014 Page
TruSeq Custom Amplicon v1.5
Data Sheet: Targeted Resequencing TruSeq Custom Amplicon v1.5 A new and improved amplicon sequencing solution for interrogating custom regions of interest. Highlights Figure 1: TruSeq Custom Amplicon Workflow
Validating Microarray Data Using RT 2 Real-Time PCR Products
Validating Microarray Data Using RT 2 Real-Time PCR Products Introduction: Real-time PCR monitors the amount of amplicon as the reaction occurs. Usually, the amount of product is directly related to the
Co Extra (GM and non GM supply chains: Their CO EXistence and TRAceability) Outcomes of Co Extra
GM and non GM supply chains: Their CO EXistence and TRAceability Outcomes of Co Extra Comparison of different real time PCR chemistries and their suitability for detection and quantification of genetically
MiSeq: Imaging and Base Calling
MiSeq: Imaging and Page Welcome Navigation Presenter Introduction MiSeq Sequencing Workflow Narration Welcome to MiSeq: Imaging and. This course takes 35 minutes to complete. Click Next to continue. Please
New Technologies for Sensitive, Low-Input RNA-Seq. Clontech Laboratories, Inc.
New Technologies for Sensitive, Low-Input RNA-Seq Clontech Laboratories, Inc. Outline Introduction Single-Cell-Capable mrna-seq Using SMART Technology SMARTer Ultra Low RNA Kit for the Fluidigm C 1 System
Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation
Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna
Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in
DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results
Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION. Professor Bharat Patel Office: Science 2, 2.36 Email: b.patel@griffith.edu.
Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION Professor Bharat Patel Office: Science 2, 2.36 Email: b.patel@griffith.edu.au What is Gene Expression & Gene Regulation? 1. Gene Expression
User Manual/Hand book. qpcr mirna Arrays ABM catalog # MA003 (human) and MA004 (mouse)
User Manual/Hand book qpcr mirna Arrays ABM catalog # MA003 (human) and MA004 (mouse) Kit Components Cat. No. MA003...Human Whole Genome mirna qpcr Profiling Kit (-20 C) The following components are sufficient
a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled
Biology 101 Chapter 14 Name: Fill-in-the-Blanks Which base follows the next in a strand of DNA is referred to. as the base (1) Sequence. The region of DNA that calls for the assembly of specific amino
1. Molecular computation uses molecules to represent information and molecular processes to implement information processing.
Chapter IV Molecular Computation These lecture notes are exclusively for the use of students in Prof. MacLennan s Unconventional Computation course. c 2013, B. J. MacLennan, EECS, University of Tennessee,
G E N OM I C S S E RV I C ES
GENOMICS SERVICES THE NEW YORK GENOME CENTER NYGC is an independent non-profit implementing advanced genomic research to improve diagnosis and treatment of serious diseases. capabilities. N E X T- G E
Frequently Asked Questions Next Generation Sequencing
Frequently Asked Questions Next Generation Sequencing Import These Frequently Asked Questions for Next Generation Sequencing are some of the more common questions our customers ask. Questions are divided
All-in-One First-Strand cdna Synthesis Kit
All-in-One First-Strand cdna Synthesis Kit For reliable first-strand cdna synthesis from all RNA sources Cat. No. AORT-0020 (20 synthesis reactions) Cat. No. AORT-0050 (50 synthesis reactions) User Manual
Replication Study Guide
Replication Study Guide This study guide is a written version of the material you have seen presented in the replication unit. Self-reproduction is a function of life that human-engineered systems have
SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications
Product Bulletin Sequencing Software SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications Comprehensive reference sequence handling Helps interpret the role of each
The world of non-coding RNA. Espen Enerly
The world of non-coding RNA Espen Enerly ncrna in general Different groups Small RNAs Outline mirnas and sirnas Speculations Common for all ncrna Per def.: never translated Not spurious transcripts Always/often
Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.
13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both
Thymine = orange Adenine = dark green Guanine = purple Cytosine = yellow Uracil = brown
1 DNA Coloring - Transcription & Translation Transcription RNA, Ribonucleic Acid is very similar to DNA. RNA normally exists as a single strand (and not the double stranded double helix of DNA). It contains
Lab # 12: DNA and RNA
115 116 Concepts to be explored: Structure of DNA Nucleotides Amino Acids Proteins Genetic Code Mutation RNA Transcription to RNA Translation to a Protein Figure 12. 1: DNA double helix Introduction Long
Application Guide... 2
Protocol for GenomePlex Whole Genome Amplification from Formalin-Fixed Parrafin-Embedded (FFPE) tissue Application Guide... 2 I. Description... 2 II. Product Components... 2 III. Materials to be Supplied
13.4 Gene Regulation and Expression
13.4 Gene Regulation and Expression Lesson Objectives Describe gene regulation in prokaryotes. Explain how most eukaryotic genes are regulated. Relate gene regulation to development in multicellular organisms.
Application Note. Single Cell PCR Preparation
Application Note Single Cell PCR Preparation From Automated Screening to the Molecular Analysis of Single Cells The AmpliGrid system is a highly sensitive tool for the analysis of single cells. In combination
Microarray Data Mining: Puce a ADN
Microarray Data Mining: Puce a ADN Recent Developments Gregory Piatetsky-Shapiro KDnuggets EGC 2005, Paris 2005 KDnuggets EGC 2005 Role of Gene Expression Cell Nucleus Chromosome Gene expression Protein