5. In what order do these stages of cell division progress? (write in the form of: 1, 2, 3, 4)

Size: px
Start display at page:

Download "5. In what order do these stages of cell division progress? (write in the form of: 1, 2, 3, 4)"

Transcription

1 Station 1 1. Name the stage of cell division shown in panel Name the stage of cell division shown in panel Name the stage of cell division shown in panel Name the stage of cell division shown in panel In what order do these stages of cell division progress? (write in the form of: 1, 2, 3, 4) 6. This structure emanates from the centromere and contacts the spindle fibers during mitosis: a. microsatellite b. telomere c. euchromatin d. kinetochore e. histone

2 Station 2 True or False: 7. One complete DNA molecule consists of a single helix. 8. In eukaryotic cells, DNA replication starts at many sites along the chromosome. 9. The backbone" of DNA is composed of repeating sugars and bases. 10. During replication, DNA Helicase builds the new DNA strand. 11. All genetic mutations change the sequence of amino acids in a protein. 12. Cytosine and Thymine are both pyrimidines. 13. Each Okazaki fragment produced on the lagging strand during DNA replication is primed with an RNA primer.

3 Station The gametes of a plant of genotype SsYy should have the genotypes: a. Ss and Yy b. SY and sy c. SY, Sy, sy, and sy d. Ss, Yy, SY and sy e. SS, ss, YY, and yy 15. Which of the following genetic crosses would be predicted to give a phenotypic ratio of 9:3:3:1? a. SSYY x ssyy b. SsYY x SSYy c. SSyy x ssyy d. ssyy x ssyy e. SsYy x SsYy 16. What is the expected phenotypic ratio of the progeny of a SsYy x ssyy cross? (Write in the form of #:#:#:#) 17. In a dihybrid cross, AaBb x AaBb, what fraction of the offspring will be homozygous for both recessive traits? 18. Following a SsYy x SsYy cross, what fraction of the offspring are predicted to have a genotype that is heterozygous for both characteristics?

4 Station Karyotype A shows an individual that is (write in the form of 46, XY): 20. What is the common name for the disease indicated by Karyotype A (write "none" if no disease is indicated)? 21. Would the person with karyotype A be phenotypically male or female? 22. Karyotype B shows an individual that is (write in the form of 46, XY): 23. What is the common name for the disease indicated by Karyotype B (write "none" if no disease is indicated)? 24. Would the person with karyotype B be phenotypically male or female?

5 Station What is the mode of inheritance in pedigree 1? 26. What is the mode of inheritance in pedigree 2? 27. What is the mode of inheritance in pedigree 3? 28. Which of the following list of conditions could be inherited as shown in pedigree 1 (Choose all that apply)? 29. Which of the following list of conditions could be inherited as shown in pedigree 2 (Choose all that apply)? List of conditions for above two questions: A. Cystic fibrosis B. Down syndrome C. Hemophilia D. Lyme disease E. Sickle cell anemia F. Tay-sachs G. Huntington disease H. Red-green color blindness

6 Station 6 During G1 of interphase, a cell has 16 chromosomes. How many chromosomes will be found per cell after the following stages of cell division? 30. Metaphase of mitosis 31. Telophase of mitosis 32. Anaphase II of meiosis 33. About 90% of trisomy 21 Down conceptions are due to nondisjunction during a. meiosis I in the female. b. meiosis II in the female. c. meiosis I in the male. d. meiosis II in the male 34. Nondisjunction in which parent leads to the sex chromosome aneuploidy XYY? a. Mother b. Father c. Either parent d. Both parents 35. Nondisjunction of chromosome 13 during meiosis II in human females can result in all of the following chromosome complements in a zygote except (assume the oocyte is fertilized by a sperm with a normal chromosome set) e. monosomic for chromosome 13 f. euploid for chromosome 13 g. trisomic for chromosome 13 h. no chromosome 13

7 Station 7 Dragons are diploid organisms with inheritance patterns similar to humans. 36. In this dragon pedigree, the "wings" trait is best described as: a. Autosomal dominant b. Autosomal recessive c. Sex-linked dominant d. Sex-linked recessive e. Codominant f. Incompletely dominant 37. In this dragon pedigree, the color trait is best described as: a. Autosomal dominant b. Autosomal recessive c. Sex-linked dominant d. Sex-linked recessive e. Codominant f. Incompletely dominant 38. In this dragon pedigree, the "breathing fire" trait is best described as: a. Autosomal dominant b. Autosomal recessive c. Sex-linked dominant d. Sex-linked recessive e. Codominant f. Incompletely dominant 39. In this dragon pedigree, the legs trait (dragons can have 0, 2 or 4 legs) is best described as: a. Autosomal dominant b. Autosomal recessive c. Sex-linked dominant d. Sex-linked recessive e. Codominant f. Incompletely dominant

8 Station Process A is called: 41. The process shown in B (the cytoplasm) is called: 42. C is called: 43. D is called: 44. E is called: 45. F is composed of:

9 Station The first amino acid in a protein is always a. adenine b. lysine c. threonine d. serine e. none of these 47. If the bases in a chromosome are 30% adenine, what percentages of the bases is cytosine? a. 10% b. 20% c. 40% d. 60% e. 80% 48. Which of these does NOT true of an autosomal dominant trait? a. usually appears in both sexes with equal frequency b. both sexes transmit the trait to their offspring c. tends to skip generations d. when one parent is unaffected and the other is affected, approximately half of the offspring will be affected 49. A couple seeks testing and counseling after they have a child with cystic fibrosis. Testing reveals that the mother is a carrier, but the father is not. How can these results be explained? a. The man tested is not the father b. A mutation altered the child s normal allele c. Uniparental disomy d. All of the above are possible 50. In pepper plants, the allele for hot flavor is dominant to the allele for mild flavor. A farmer crosses a homozygous hot plant with a mild plant. What percentage of the offspring from this cross will have hot flavor? a. 25% b. 50% c. 75% d. 100%

10 Station 10 Ms. Smith, Ms. Smithie, and Ms. Smythe all entered the same hospital and gave birth to baby girls on the same day, and all three babies were taken to the nursery to receive care. Someone later claimed that the hospital mixed up the babies. It is your job to make sure that each pair of parents has the correct baby, so you order blood typing to be done on all the parents and all the babies. Here are the results: Parent Blood Type Baby Blood Type Ms. Smith A Baby A O+ Mr. Smith B Baby B A Ms. Smithie B Baby C A+ Mr. Smithie O+ Ms. Smythe A+ Mr. Smythe B 51. Which parents gave birth to Baby A? a. Smith b. Smithie c. Smythe d. None of these 52. Which parents gave birth to Baby B? a. Smith b. Smithie c. Smythe d. None of these 53. Which mother is homozygous for her ABO blood group genotype? a. Ms. Smith b. Ms. Smithie c. Ms. Smythe d. All of these are equally likely 54. The ABO blood group is a trait which is: a. autosomal recessive b. autosomal dominant c. incompletely dominant d. incompletely penetrant e. codominant

11 Station 11 Name the following: 55. Diagram used to predict the outcome of a genetic cross 56. The study of heredity 57. Observable characteristics of an organism 58. An individual with two different alleles for a trait 59. The first two individuals that mate in a genetic cross 60. Characteristic of an organism that is influenced by several genes 61. Cross involving one pair of contrasting traits 62. Condition in which a trait in an individual is intermediate between the phenotype of its two parents

12 Station 12 Translate the following DNA sequences into protein. Write answers in the form of Asp-Met-Tyr-STOP AATGAAATGCCGATCGTAG ATGCATCCGTACTAACATCC AGTATGTACCTAGACGTTATT

13 Answer KEY for Heredity B 2013 Tiebreakers: Number of total correct answers in station 1, 2, etc. Station 1 1. telophase 2. metaphase 3. anaphase 4. prophase 5. 4, 2, 3, 1 6. D Station , XXY 20. Klinefelter Syndrome 21. male , XY 23. Patau Syndrome or Trisomy male Station 2 7. F 8. T 9. F 10. F 11. F 12. T 13. T Station Autosomal recessive 26. X-linked recessive 27. Autosomal dominant 28. A, E, F (must have all) 29. C, H (must have all) Station D 15. E 16. 1:1:1: / /4 or 4/16 Station A 34. B 35. D Station B 37. E 38. D 39. F Station C 52. A 53. C 54. E Station Transcription 41. Translation 42. mrna 43. Ribosome 44. trna 45. amino acids Station Punnett Square 56. Genetics 57. Phenotype 58. Heterozygous 59. P generation 60. Polygenic trait 61. Monohybrid cross or monohybrid 62. Incomplete dominance Station E 47. B 48. C 49. D 50. C Station Met-Lys-Cys-Arg-Ser- STOP 64. Met-His-Pro-Tyr-STOP 65. Met-Asp-Leu-Gln-STOP

14 Response Sheet Please write clearly!! Illegible answers will not be graded. Note: The back of the answer sheet may be used as a scratch paper. Station Station Station 2 (circle one) 7. TRUE or FALSE 8. TRUE or FALSE 9. TRUE or FALSE 10. TRUE or FALSE 11. TRUE or FALSE 12. TRUE or FALSE 13. TRUE or FALSE Station Station Station Station Station Station Station Station Station

Bio EOC Topics for Cell Reproduction: Bio EOC Questions for Cell Reproduction:

Bio EOC Topics for Cell Reproduction: Bio EOC Questions for Cell Reproduction: Bio EOC Topics for Cell Reproduction: Asexual vs. sexual reproduction Mitosis steps, diagrams, purpose o Interphase, Prophase, Metaphase, Anaphase, Telophase, Cytokinesis Meiosis steps, diagrams, purpose

More information

Heredity - Patterns of Inheritance

Heredity - Patterns of Inheritance Heredity - Patterns of Inheritance Genes and Alleles A. Genes 1. A sequence of nucleotides that codes for a special functional product a. Transfer RNA b. Enzyme c. Structural protein d. Pigments 2. Genes

More information

The correct answer is c A. Answer a is incorrect. The white-eye gene must be recessive since heterozygous females have red eyes.

The correct answer is c A. Answer a is incorrect. The white-eye gene must be recessive since heterozygous females have red eyes. 1. Why is the white-eye phenotype always observed in males carrying the white-eye allele? a. Because the trait is dominant b. Because the trait is recessive c. Because the allele is located on the X chromosome

More information

Genetics Module B, Anchor 3

Genetics Module B, Anchor 3 Genetics Module B, Anchor 3 Key Concepts: - An individual s characteristics are determines by factors that are passed from one parental generation to the next. - During gamete formation, the alleles for

More information

Biology 1406 Exam 4 Notes Cell Division and Genetics Ch. 8, 9

Biology 1406 Exam 4 Notes Cell Division and Genetics Ch. 8, 9 Biology 1406 Exam 4 Notes Cell Division and Genetics Ch. 8, 9 Ch. 8 Cell Division Cells divide to produce new cells must pass genetic information to new cells - What process of DNA allows this? Two types

More information

Name: 4. A typical phenotypic ratio for a dihybrid cross is a) 9:1 b) 3:4 c) 9:3:3:1 d) 1:2:1:2:1 e) 6:3:3:6

Name: 4. A typical phenotypic ratio for a dihybrid cross is a) 9:1 b) 3:4 c) 9:3:3:1 d) 1:2:1:2:1 e) 6:3:3:6 Name: Multiple-choice section Choose the answer which best completes each of the following statements or answers the following questions and so make your tutor happy! 1. Which of the following conclusions

More information

Biology Final Exam Study Guide: Semester 2

Biology Final Exam Study Guide: Semester 2 Biology Final Exam Study Guide: Semester 2 Questions 1. Scientific method: What does each of these entail? Investigation and Experimentation Problem Hypothesis Methods Results/Data Discussion/Conclusion

More information

12.1 The Role of DNA in Heredity

12.1 The Role of DNA in Heredity 12.1 The Role of DNA in Heredity Only in the last 50 years have scientists understood the role of DNA in heredity. That understanding began with the discovery of DNA s structure. In 1952, Rosalind Franklin

More information

Heredity. Sarah crosses a homozygous white flower and a homozygous purple flower. The cross results in all purple flowers.

Heredity. Sarah crosses a homozygous white flower and a homozygous purple flower. The cross results in all purple flowers. Heredity 1. Sarah is doing an experiment on pea plants. She is studying the color of the pea plants. Sarah has noticed that many pea plants have purple flowers and many have white flowers. Sarah crosses

More information

CCR Biology - Chapter 7 Practice Test - Summer 2012

CCR Biology - Chapter 7 Practice Test - Summer 2012 Name: Class: Date: CCR Biology - Chapter 7 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. A person who has a disorder caused

More information

BioBoot Camp Genetics

BioBoot Camp Genetics BioBoot Camp Genetics BIO.B.1.2.1 Describe how the process of DNA replication results in the transmission and/or conservation of genetic information DNA Replication is the process of DNA being copied before

More information

Genetic Mutations. Indicator 4.8: Compare the consequences of mutations in body cells with those in gametes.

Genetic Mutations. Indicator 4.8: Compare the consequences of mutations in body cells with those in gametes. Genetic Mutations Indicator 4.8: Compare the consequences of mutations in body cells with those in gametes. Agenda Warm UP: What is a mutation? Body cell? Gamete? Notes on Mutations Karyotype Web Activity

More information

5. The cells of a multicellular organism, other than gametes and the germ cells from which it develops, are known as

5. The cells of a multicellular organism, other than gametes and the germ cells from which it develops, are known as 1. True or false? The chi square statistical test is used to determine how well the observed genetic data agree with the expectations derived from a hypothesis. True 2. True or false? Chromosomes in prokaryotic

More information

Test Two Study Guide

Test Two Study Guide Test Two Study Guide 1. Describe what is happening inside a cell during the following phases (pictures may help but try to use words): Interphase: : Consists of G1 / S / G2. Growing stage, cell doubles

More information

Chapter 13: Meiosis and Sexual Life Cycles

Chapter 13: Meiosis and Sexual Life Cycles Name Period Concept 13.1 Offspring acquire genes from parents by inheriting chromosomes 1. Let s begin with a review of several terms that you may already know. Define: gene locus gamete male gamete female

More information

Human Blood Types: Codominance and Multiple Alleles. Codominance: both alleles in the heterozygous genotype express themselves fully

Human Blood Types: Codominance and Multiple Alleles. Codominance: both alleles in the heterozygous genotype express themselves fully Human Blood Types: Codominance and Multiple Alleles Codominance: both alleles in the heterozygous genotype express themselves fully Multiple alleles: three or more alleles for a trait are found in the

More information

CHROMOSOMES AND INHERITANCE

CHROMOSOMES AND INHERITANCE SECTION 12-1 REVIEW CHROMOSOMES AND INHERITANCE VOCABULARY REVIEW Distinguish between the terms in each of the following pairs of terms. 1. sex chromosome, autosome 2. germ-cell mutation, somatic-cell

More information

Academic Nucleic Acids and Protein Synthesis Test

Academic Nucleic Acids and Protein Synthesis Test Academic Nucleic Acids and Protein Synthesis Test Multiple Choice Identify the letter of the choice that best completes the statement or answers the question. 1. Each organism has a unique combination

More information

Chapter 9 Patterns of Inheritance

Chapter 9 Patterns of Inheritance Bio 100 Patterns of Inheritance 1 Chapter 9 Patterns of Inheritance Modern genetics began with Gregor Mendel s quantitative experiments with pea plants History of Heredity Blending theory of heredity -

More information

Name: Class: Date: ID: A

Name: Class: Date: ID: A Name: Class: _ Date: _ Meiosis Quiz 1. (1 point) A kidney cell is an example of which type of cell? a. sex cell b. germ cell c. somatic cell d. haploid cell 2. (1 point) How many chromosomes are in a human

More information

This fact sheet describes how genes affect our health when they follow a well understood pattern of genetic inheritance known as autosomal recessive.

This fact sheet describes how genes affect our health when they follow a well understood pattern of genetic inheritance known as autosomal recessive. 11111 This fact sheet describes how genes affect our health when they follow a well understood pattern of genetic inheritance known as autosomal recessive. In summary Genes contain the instructions for

More information

somatic cell egg genotype gamete polar body phenotype homologous chromosome trait dominant autosome genetics recessive

somatic cell egg genotype gamete polar body phenotype homologous chromosome trait dominant autosome genetics recessive CHAPTER 6 MEIOSIS AND MENDEL Vocabulary Practice somatic cell egg genotype gamete polar body phenotype homologous chromosome trait dominant autosome genetics recessive CHAPTER 6 Meiosis and Mendel sex

More information

Lecture 2: Mitosis and meiosis

Lecture 2: Mitosis and meiosis Lecture 2: Mitosis and meiosis 1. Chromosomes 2. Diploid life cycle 3. Cell cycle 4. Mitosis 5. Meiosis 6. Parallel behavior of genes and chromosomes Basic morphology of chromosomes telomere short arm

More information

Terms: The following terms are presented in this lesson (shown in bold italics and on PowerPoint Slides 2 and 3):

Terms: The following terms are presented in this lesson (shown in bold italics and on PowerPoint Slides 2 and 3): Unit B: Understanding Animal Reproduction Lesson 4: Understanding Genetics Student Learning Objectives: Instruction in this lesson should result in students achieving the following objectives: 1. Explain

More information

Chapter 13: Meiosis and Sexual Life Cycles

Chapter 13: Meiosis and Sexual Life Cycles Name Period Chapter 13: Meiosis and Sexual Life Cycles Concept 13.1 Offspring acquire genes from parents by inheriting chromosomes 1. Let s begin with a review of several terms that you may already know.

More information

Genetics Part 1: Inheritance of Traits

Genetics Part 1: Inheritance of Traits Genetics Part 1: Inheritance of Traits Genetics is the study of how traits are passed from parents to offspring. Offspring usually show some traits of each parent. For a long time, scientists did not understand

More information

7A The Origin of Modern Genetics

7A The Origin of Modern Genetics Life Science Chapter 7 Genetics of Organisms 7A The Origin of Modern Genetics Genetics the study of inheritance (the study of how traits are inherited through the interactions of alleles) Heredity: the

More information

Practice Problems 4. (a) 19. (b) 36. (c) 17

Practice Problems 4. (a) 19. (b) 36. (c) 17 Chapter 10 Practice Problems Practice Problems 4 1. The diploid chromosome number in a variety of chrysanthemum is 18. What would you call varieties with the following chromosome numbers? (a) 19 (b) 36

More information

Mendelian and Non-Mendelian Heredity Grade Ten

Mendelian and Non-Mendelian Heredity Grade Ten Ohio Standards Connection: Life Sciences Benchmark C Explain the genetic mechanisms and molecular basis of inheritance. Indicator 6 Explain that a unit of hereditary information is called a gene, and genes

More information

List, describe, diagram, and identify the stages of meiosis.

List, describe, diagram, and identify the stages of meiosis. Meiosis and Sexual Life Cycles In this topic we will examine a second type of cell division used by eukaryotic cells: meiosis. In addition, we will see how the 2 types of eukaryotic cell division, mitosis

More information

Mendelian inheritance and the

Mendelian inheritance and the Mendelian inheritance and the most common genetic diseases Cornelia Schubert, MD, University of Goettingen, Dept. Human Genetics EUPRIM-Net course Genetics, Immunology and Breeding Mangement German Primate

More information

MCB41: Second Midterm Spring 2009

MCB41: Second Midterm Spring 2009 MCB41: Second Midterm Spring 2009 Before you start, print your name and student identification number (S.I.D) at the top of each page. There are 7 pages including this page. You will have 50 minutes for

More information

Meiosis is a special form of cell division.

Meiosis is a special form of cell division. Page 1 of 6 KEY CONCEPT Meiosis is a special form of cell division. BEFORE, you learned Mitosis produces two genetically identical cells In sexual reproduction, offspring inherit traits from both parents

More information

www.njctl.org PSI Biology Mitosis & Meiosis

www.njctl.org PSI Biology Mitosis & Meiosis Mitosis and Meiosis Mitosis Classwork 1. Identify two differences between meiosis and mitosis. 2. Provide an example of a type of cell in the human body that would undergo mitosis. 3. Does cell division

More information

A trait is a variation of a particular character (e.g. color, height). Traits are passed from parents to offspring through genes.

A trait is a variation of a particular character (e.g. color, height). Traits are passed from parents to offspring through genes. 1 Biology Chapter 10 Study Guide Trait A trait is a variation of a particular character (e.g. color, height). Traits are passed from parents to offspring through genes. Genes Genes are located on chromosomes

More information

BioSci 2200 General Genetics Problem Set 1 Answer Key Introduction and Mitosis/ Meiosis

BioSci 2200 General Genetics Problem Set 1 Answer Key Introduction and Mitosis/ Meiosis BioSci 2200 General Genetics Problem Set 1 Answer Key Introduction and Mitosis/ Meiosis Introduction - Fields of Genetics To answer the following question, review the three traditional subdivisions of

More information

Genetics 1. Defective enzyme that does not make melanin. Very pale skin and hair color (albino)

Genetics 1. Defective enzyme that does not make melanin. Very pale skin and hair color (albino) Genetics 1 We all know that children tend to resemble their parents. Parents and their children tend to have similar appearance because children inherit genes from their parents and these genes influence

More information

Genetics Test Biology I

Genetics Test Biology I Genetics Test Biology I Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Avery s experiments showed that bacteria are transformed by a. RNA. c. proteins.

More information

GENETIC CROSSES. Monohybrid Crosses

GENETIC CROSSES. Monohybrid Crosses GENETIC CROSSES Monohybrid Crosses Objectives Explain the difference between genotype and phenotype Explain the difference between homozygous and heterozygous Explain how probability is used to predict

More information

Chapter 3. Chapter Outline. Chapter Outline 9/11/10. Heredity and Evolu4on

Chapter 3. Chapter Outline. Chapter Outline 9/11/10. Heredity and Evolu4on Chapter 3 Heredity and Evolu4on Chapter Outline The Cell DNA Structure and Function Cell Division: Mitosis and Meiosis The Genetic Principles Discovered by Mendel Mendelian Inheritance in Humans Misconceptions

More information

Chromosomes, Mapping, and the Meiosis Inheritance Connection

Chromosomes, Mapping, and the Meiosis Inheritance Connection Chromosomes, Mapping, and the Meiosis Inheritance Connection Carl Correns 1900 Chapter 13 First suggests central role for chromosomes Rediscovery of Mendel s work Walter Sutton 1902 Chromosomal theory

More information

Cell Growth and Reproduction Module B, Anchor 1

Cell Growth and Reproduction Module B, Anchor 1 Cell Growth and Reproduction Module B, Anchor 1 Key Concepts: - The larger a cell becomes, the more demands the cell places on its DNA. In addition, a larger cell is less efficient in moving nutrients

More information

1 Mutation and Genetic Change

1 Mutation and Genetic Change CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds

More information

ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes

ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes Page 1 of 22 Introduction Indiana students enrolled in Biology I participated in the ISTEP+: Biology I Graduation Examination

More information

CHROMOSOME STRUCTURE CHROMOSOME NUMBERS

CHROMOSOME STRUCTURE CHROMOSOME NUMBERS CHROMOSOME STRUCTURE 1. During nuclear division, the DNA (as chromatin) in a Eukaryotic cell's nucleus is coiled into very tight compact structures called chromosomes. These are rod-shaped structures made

More information

Sexual Reproduction. The specialized cells that are required for sexual reproduction are known as. And come from the process of: GAMETES

Sexual Reproduction. The specialized cells that are required for sexual reproduction are known as. And come from the process of: GAMETES Sexual Reproduction Sexual Reproduction We know all about asexual reproduction 1. Only one parent required. 2. Offspring are identical to parents. 3. The cells that produce the offspring are not usually

More information

Appendix C DNA Replication & Mitosis

Appendix C DNA Replication & Mitosis K.Muma Bio 6 Appendix C DNA Replication & Mitosis Study Objectives: Appendix C: DNA replication and Mitosis 1. Describe the structure of DNA and where it is found. 2. Explain complimentary base pairing:

More information

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results

More information

Problems 1-6: In tomato fruit, red flesh color is dominant over yellow flesh color, Use R for the Red allele and r for the yellow allele.

Problems 1-6: In tomato fruit, red flesh color is dominant over yellow flesh color, Use R for the Red allele and r for the yellow allele. Genetics Problems Name ANSWER KEY Problems 1-6: In tomato fruit, red flesh color is dominant over yellow flesh color, Use R for the Red allele and r for the yellow allele. 1. What would be the genotype

More information

4.2 Meiosis. Meiosis is a reduction division. Assessment statements. The process of meiosis

4.2 Meiosis. Meiosis is a reduction division. Assessment statements. The process of meiosis 4.2 Meiosis Assessment statements State that meiosis is a reduction division of a diploid nucleus to form haploid nuclei. Define homologous chromosomes. Outline the process of meiosis, including pairing

More information

Chapter 4 Pedigree Analysis in Human Genetics. Chapter 4 Human Heredity by Michael Cummings 2006 Brooks/Cole-Thomson Learning

Chapter 4 Pedigree Analysis in Human Genetics. Chapter 4 Human Heredity by Michael Cummings 2006 Brooks/Cole-Thomson Learning Chapter 4 Pedigree Analysis in Human Genetics Mendelian Inheritance in Humans Pigmentation Gene and Albinism Fig. 3.14 Two Genes Fig. 3.15 The Inheritance of Human Traits Difficulties Long generation time

More information

Sample Questions for Exam 3

Sample Questions for Exam 3 Sample Questions for Exam 3 1. All of the following occur during prometaphase of mitosis in animal cells except a. the centrioles move toward opposite poles. b. the nucleolus can no longer be seen. c.

More information

Cell Division CELL DIVISION. Mitosis. Designation of Number of Chromosomes. Homologous Chromosomes. Meiosis

Cell Division CELL DIVISION. Mitosis. Designation of Number of Chromosomes. Homologous Chromosomes. Meiosis Cell Division CELL DIVISION Anatomy and Physiology Text and Laboratory Workbook, Stephen G. Davenport, Copyright 2006, All Rights Reserved, no part of this publication can be used for any commercial purpose.

More information

From DNA to Protein

From DNA to Protein Nucleus Control center of the cell contains the genetic library encoded in the sequences of nucleotides in molecules of DNA code for the amino acid sequences of all proteins determines which specific proteins

More information

DNA. Discovery of the DNA double helix

DNA. Discovery of the DNA double helix DNA Replication DNA Discovery of the DNA double helix A. 1950 s B. Rosalind Franklin - X-ray photo of DNA. C. Watson and Crick - described the DNA molecule from Franklin s X-ray. What is DNA? Question:

More information

Protein Synthesis. Page 41 Page 44 Page 47 Page 42 Page 45 Page 48 Page 43 Page 46 Page 49. Page 41. DNA RNA Protein. Vocabulary

Protein Synthesis. Page 41 Page 44 Page 47 Page 42 Page 45 Page 48 Page 43 Page 46 Page 49. Page 41. DNA RNA Protein. Vocabulary Protein Synthesis Vocabulary Transcription Translation Translocation Chromosomal mutation Deoxyribonucleic acid Frame shift mutation Gene expression Mutation Point mutation Page 41 Page 41 Page 44 Page

More information

Genetics Lecture Notes 7.03 2005. Lectures 1 2

Genetics Lecture Notes 7.03 2005. Lectures 1 2 Genetics Lecture Notes 7.03 2005 Lectures 1 2 Lecture 1 We will begin this course with the question: What is a gene? This question will take us four lectures to answer because there are actually several

More information

Chromosomes, Karyotyping, and Abnormalities (Learning Objectives) Learn the components and parts of a metaphase chromosome.

Chromosomes, Karyotyping, and Abnormalities (Learning Objectives) Learn the components and parts of a metaphase chromosome. Chromosomes, Karyotyping, and Abnormalities (Learning Objectives) Learn the components and parts of a metaphase chromosome. Define the terms karyotype, autosomal and sex chromosomes. Explain how many of

More information

1. Why is mitosis alone insufficient for the life cycle of sexually reproducing eukaryotes?

1. Why is mitosis alone insufficient for the life cycle of sexually reproducing eukaryotes? Chapter 13: Meiosis and Sexual Life Cycles 1. Why is mitosis alone insufficient for the life cycle of sexually reproducing eukaryotes? 2. Define: gamete zygote meiosis homologous chromosomes diploid haploid

More information

UNIT 13 (OPTION) Genetic Abnormalities

UNIT 13 (OPTION) Genetic Abnormalities Unit 13 Genetic Abnormailities 1 UNIT 13 (OPTION) Genetic Abnormalities Originally developed by: Hildur Helgedottir RN, MN Revised (2000) by: Marlene Reimer RN, PhD, CCN (C) Associate Professor Faculty

More information

Bio 102 Practice Problems Genetic Code and Mutation

Bio 102 Practice Problems Genetic Code and Mutation Bio 102 Practice Problems Genetic Code and Mutation Multiple choice: Unless otherwise directed, circle the one best answer: 1. Beadle and Tatum mutagenized Neurospora to find strains that required arginine

More information

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!! DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other

More information

MCAS Biology. Review Packet

MCAS Biology. Review Packet MCAS Biology Review Packet 1 Name Class Date 1. Define organic. THE CHEMISTRY OF LIFE 2. All living things are made up of 6 essential elements: SPONCH. Name the six elements of life. S N P C O H 3. Elements

More information

The Developing Person Through the Life Span 8e by Kathleen Stassen Berger

The Developing Person Through the Life Span 8e by Kathleen Stassen Berger The Developing Person Through the Life Span 8e by Kathleen Stassen Berger Chapter 3 Heredity and Environment PowerPoint Slides developed by Martin Wolfger and Michael James Ivy Tech Community College-Bloomington

More information

Lecture 7 Mitosis & Meiosis

Lecture 7 Mitosis & Meiosis Lecture 7 Mitosis & Meiosis Cell Division Essential for body growth and tissue repair Interphase G 1 phase Primary cell growth phase S phase DNA replication G 2 phase Microtubule synthesis Mitosis Nuclear

More information

Cell Division and Mitosis DNA. Sexual Reproduction and Meiosis. 2. Meiosis occurs in the reproductive organs, producing four haploid sex cells.

Cell Division and Mitosis DNA. Sexual Reproduction and Meiosis. 2. Meiosis occurs in the reproductive organs, producing four haploid sex cells. ell Division and Mitosis 1. he life cycle of a cell has two parts growth and development, and cell division. 2. In mitosis, the nucleus divides to form two identical nuclei. Mitosis occurs in four continuous

More information

PRACTICE PROBLEMS - PEDIGREES AND PROBABILITIES

PRACTICE PROBLEMS - PEDIGREES AND PROBABILITIES PRACTICE PROBLEMS - PEDIGREES AND PROBABILITIES 1. Margaret has just learned that she has adult polycystic kidney disease. Her mother also has the disease, as did her maternal grandfather and his younger

More information

LAB : PAPER PET GENETICS. male (hat) female (hair bow) Skin color green or orange Eyes round or square Nose triangle or oval Teeth pointed or square

LAB : PAPER PET GENETICS. male (hat) female (hair bow) Skin color green or orange Eyes round or square Nose triangle or oval Teeth pointed or square Period Date LAB : PAPER PET GENETICS 1. Given the list of characteristics below, you will create an imaginary pet and then breed it to review the concepts of genetics. Your pet will have the following

More information

Chapter 8: Variation in Chromosome Structure and Number

Chapter 8: Variation in Chromosome Structure and Number Chapter 8: Variation in Chromosome Structure and Number Student Learning Objectives Upon completion of this chapter you should be able to: 1. Know the principles and terminology associated with variations

More information

1. When new cells are formed through the process of mitosis, the number of chromosomes in the new cells

1. When new cells are formed through the process of mitosis, the number of chromosomes in the new cells Cell Growth and Reproduction 1. When new cells are formed through the process of mitosis, the number of chromosomes in the new cells A. is half of that of the parent cell. B. remains the same as in the

More information

DNA, RNA, Protein synthesis, and Mutations. Chapters 12-13.3

DNA, RNA, Protein synthesis, and Mutations. Chapters 12-13.3 DNA, RNA, Protein synthesis, and Mutations Chapters 12-13.3 1A)Identify the components of DNA and explain its role in heredity. DNA s Role in heredity: Contains the genetic information of a cell that can

More information

LAB 8 EUKARYOTIC CELL DIVISION: MITOSIS AND MEIOSIS

LAB 8 EUKARYOTIC CELL DIVISION: MITOSIS AND MEIOSIS LAB 8 EUKARYOTIC CELL DIVISION: MITOSIS AND MEIOSIS Los Angeles Mission College Biology 3 Name: Date: INTRODUCTION BINARY FISSION: Prokaryotic cells (bacteria) reproduce asexually by binary fission. Bacterial

More information

The Making of the Fittest: Natural Selection in Humans

The Making of the Fittest: Natural Selection in Humans OVERVIEW MENDELIN GENETIC, PROBBILITY, PEDIGREE, ND CHI-QURE TTITIC This classroom lesson uses the information presented in the short film The Making of the Fittest: Natural election in Humans (http://www.hhmi.org/biointeractive/making-fittest-natural-selection-humans)

More information

Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA

Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA Page 1 of 5 Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA Genetics Exercise: Understanding how meiosis affects genetic inheritance and DNA patterns

More information

2 18. If a boy s father has haemophilia and his mother has one gene for haemophilia. What is the chance that the boy will inherit the disease? 1. 0% 2

2 18. If a boy s father has haemophilia and his mother has one gene for haemophilia. What is the chance that the boy will inherit the disease? 1. 0% 2 1 GENETICS 1. Mendel is considered to be lucky to discover the laws of inheritance because 1. He meticulously analyzed his data statistically 2. He maintained pedigree records of various generations he

More information

BIO 184 Page 1 Spring 2013 NAME VERSION 1 EXAM 3: KEY. Instructions: PRINT your Name and Exam version Number on your Scantron

BIO 184 Page 1 Spring 2013 NAME VERSION 1 EXAM 3: KEY. Instructions: PRINT your Name and Exam version Number on your Scantron BIO 184 Page 1 Spring 2013 EXAM 3: KEY Instructions: PRINT your Name and Exam version Number on your Scantron Example: PAULA SMITH, EXAM 2 VERSION 1 Write your name CLEARLY at the top of every page of

More information

Forensic DNA Testing Terminology

Forensic DNA Testing Terminology Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.

More information

Mitosis, Meiosis and Fertilization 1

Mitosis, Meiosis and Fertilization 1 Mitosis, Meiosis and Fertilization 1 I. Introduction When you fall and scrape the skin off your hands or knees, how does your body make new skin cells to replace the skin cells that were scraped off? How

More information

The following chapter is called "Preimplantation Genetic Diagnosis (PGD)".

The following chapter is called Preimplantation Genetic Diagnosis (PGD). Slide 1 Welcome to chapter 9. The following chapter is called "Preimplantation Genetic Diagnosis (PGD)". The author is Dr. Maria Lalioti. Slide 2 The learning objectives of this chapter are: To learn the

More information

B2 5 Inheritrance Genetic Crosses

B2 5 Inheritrance Genetic Crosses B2 5 Inheritrance Genetic Crosses 65 minutes 65 marks Page of 55 Q. A woman gives birth to triplets. Two of the triplets are boys and the third is a girl. The triplets developed from two egg cells released

More information

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,

More information

Chapter 3. Cell Division. Laboratory Activities Activity 3.1: Mock Mitosis Activity 3.2: Mitosis in Onion Cells Activity 3.

Chapter 3. Cell Division. Laboratory Activities Activity 3.1: Mock Mitosis Activity 3.2: Mitosis in Onion Cells Activity 3. Chapter 3 Cell Division Laboratory Activities Activity 3.1: Mock Mitosis Activity 3.2: Mitosis in Onion Cells Activity 3.3: Mock Meiosis Goals Following this exercise students should be able to Recognize

More information

Bio 101 Section 001: Practice Questions for First Exam

Bio 101 Section 001: Practice Questions for First Exam Do the Practice Exam under exam conditions. Time yourself! MULTIPLE CHOICE: 1. The substrate fits in the of an enzyme: (A) allosteric site (B) active site (C) reaction groove (D) Golgi body (E) inhibitor

More information

Influence of Sex on Genetics. Chapter Six

Influence of Sex on Genetics. Chapter Six Influence of Sex on Genetics Chapter Six Humans 23 Autosomes Chromosomal abnormalities very severe Often fatal All have at least one X Deletion of X chromosome is fatal Males = heterogametic sex XY Females

More information

CHAPTER 15 THE CHROMOSOMAL BASIS OF INHERITANCE. Section B: Sex Chromosomes

CHAPTER 15 THE CHROMOSOMAL BASIS OF INHERITANCE. Section B: Sex Chromosomes CHAPTER 15 THE CHROMOSOMAL BASIS OF INHERITANCE Section B: Sex Chromosomes 1. The chromosomal basis of sex varies with the organism 2. Sex-linked genes have unique patterns of inheritance 1. The chromosomal

More information

A and B are not absolutely linked. They could be far enough apart on the chromosome that they assort independently.

A and B are not absolutely linked. They could be far enough apart on the chromosome that they assort independently. Name Section 7.014 Problem Set 5 Please print out this problem set and record your answers on the printed copy. Answers to this problem set are to be turned in to the box outside 68-120 by 5:00pm on Friday

More information

CHROMOSOMES Dr. Fern Tsien, Dept. of Genetics, LSUHSC, NO, LA

CHROMOSOMES Dr. Fern Tsien, Dept. of Genetics, LSUHSC, NO, LA CHROMOSOMES Dr. Fern Tsien, Dept. of Genetics, LSUHSC, NO, LA Cytogenetics is the study of chromosomes and their structure, inheritance, and abnormalities. Chromosome abnormalities occur in approximately:

More information

Saffiyah Y. Manboard Biology Instructor Seagull Alternative High School Saffiyah.manboard@browardschools.com

Saffiyah Y. Manboard Biology Instructor Seagull Alternative High School Saffiyah.manboard@browardschools.com The Effect of Discovery Learning through Biotechnology on the Knowledge and Perception of Sickle Cell Anemia and It s Genetics on Lower Income Students Saffiyah Y. Manboard Biology Instructor Seagull Alternative

More information

14.3 Studying the Human Genome

14.3 Studying the Human Genome 14.3 Studying the Human Genome Lesson Objectives Summarize the methods of DNA analysis. State the goals of the Human Genome Project and explain what we have learned so far. Lesson Summary Manipulating

More information

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d. 13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both

More information

NATIONAL SENIOR CERTIFICATE GRADE 12

NATIONAL SENIOR CERTIFICATE GRADE 12 NATIONAL SENIOR CERTIFICATE GRADE 12 LIFE SCIENCES P2 FEBRUARY/MARCH 2015 MEMORANDUM MARKS: 150 This memorandum consists of 12 pages. Life Sciences/P2 2 DBE/Feb. Mar. 2015 PRINCIPLES RELATED TO MARKING

More information

Actual Quiz 1 (closed book) will be given Monday10/4 at 10:00 am

Actual Quiz 1 (closed book) will be given Monday10/4 at 10:00 am MIT Biology Department 7.012: Introductory Biology Fall 2004 Instructors: Professor Eric Lander, Professor Robert A. Weinberg, Dr. laudette Gardel 7.012 Practice Quiz 1 Actual Quiz 1 (closed book) will

More information

Answer: 2. Uracil. Answer: 2. hydrogen bonds. Adenine, Cytosine and Guanine are found in both RNA and DNA.

Answer: 2. Uracil. Answer: 2. hydrogen bonds. Adenine, Cytosine and Guanine are found in both RNA and DNA. Answer: 2. Uracil Adenine, Cytosine and Guanine are found in both RNA and DNA. Thymine is found only in DNA; Uracil takes its (Thymine) place in RNA molecules. Answer: 2. hydrogen bonds The complementary

More information

Can receive blood from: * I A I A and I A i o Type A Yes No A or AB A or O I B I B and I B i o Type B No Yes B or AB B or O

Can receive blood from: * I A I A and I A i o Type A Yes No A or AB A or O I B I B and I B i o Type B No Yes B or AB B or O Genetics of the ABO Blood Groups written by J. D. Hendrix Learning Objectives Upon completing the exercise, each student should be able: to explain the concept of blood group antigens; to list the genotypes

More information

I. Genes found on the same chromosome = linked genes

I. Genes found on the same chromosome = linked genes Genetic recombination in Eukaryotes: crossing over, part 1 I. Genes found on the same chromosome = linked genes II. III. Linkage and crossing over Crossing over & chromosome mapping I. Genes found on the

More information

DNA Determines Your Appearance!

DNA Determines Your Appearance! DNA Determines Your Appearance! Summary DNA contains all the information needed to build your body. Did you know that your DNA determines things such as your eye color, hair color, height, and even the

More information

About The Causes of Hearing Loss

About The Causes of Hearing Loss About 1 in 500 infants is born with or develops hearing loss during early childhood. Hearing loss has many causes: some are genetic (that is, caused by a baby s genes) or non-genetic (such as certain infections

More information

Fact Sheet 14 EPIGENETICS

Fact Sheet 14 EPIGENETICS This fact sheet describes epigenetics which refers to factors that can influence the way our genes are expressed in the cells of our body. In summary Epigenetics is a phenomenon that affects the way cells

More information

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins

More information

13.2 Ribosomes & Protein Synthesis

13.2 Ribosomes & Protein Synthesis 13.2 Ribosomes & Protein Synthesis Introduction: *A specific sequence of bases in DNA carries the directions for forming a polypeptide, a chain of amino acids (there are 20 different types of amino acid).

More information