Dal proge*o genoma umano ad oggi: evoluzione delle tecniche di sequenziamento, analisi genomica e proteomica e prospe9ve future!

Size: px
Start display at page:

Download "Dal proge*o genoma umano ad oggi: evoluzione delle tecniche di sequenziamento, analisi genomica e proteomica e prospe9ve future!"

Transcription

1 Dal proge*o genoma umano ad oggi: evoluzione delle tecniche di sequenziamento, analisi genomica e proteomica e prospe9ve future! David Horner Dipar.mento di Bioscienze Università degli Studi di Milano

2 Come va sequenziato il DNA? Sequenziamento Sanger (1978 oggi): Cos. rela.vamente al. Richiede molto tempo per preparazione di campioni Produce poche leluri LUNGHI (1000 nt) Pochi errori di sequenziamento

3 Sequenziamento Sanger (1978)

4 Sequenziamento Sanger (1978)

5 1) Frammentare in modo casuale, clonare fammen. in plasmidi Genome 3) Individuare un clone sovraposto. Sequenziarlo e costruire un frammento piu lungo 2) Sequenziare un fragmento (a caso) 4) Andare al passaggio 2 (fino alla fine!)

6 Genomi, quanto sono grandi? plasmids viruses bacteria fungi plants algae insects mollusks bony fish amphibians rep.les birds mammals

7

8 Sequenziamento Sanger (anni 1990) 96 reazioni in parallelo 1000 nt x reazione

9 Robot!

10 Sinclair ZX

11 Computer

12 Whole Genome Shotgun Approach

13 Assembly by overlap

14 Sequenze Ripetute Sequenze ripetute Sequenze uniche Se le sequenze ripetute sono meno lunghe del lelure di sequenziamento, non c è problema A B C

15 Sequenze Ripetute Se sono piu lunghi, NON POSSIAMO ASSEMBLARE! A B C A B c? A C B?

16 Steps to Assemble a Genome Some Terminology read 1. Find a overlapping long word reads that comes out of sequencer mate pair a pair of reads from two ends 2. of Merge the same some insert good fragment pairs of reads into longer contigs con-g a con.guous sequence formed by several overlapping reads with no gaps 3. Link contigs to form supercontigs supercon-g an ordered and oriented set (scaffold) of con.gs, usually by mate pairs 4. Derive consensus sequence..acgattacaataggtt.. consensus sequence derived from the sequene mul.ple alignment of reads in a con.g

17 Con.gs and scaffolds

18 Shot Gun Sequencing 2. Library 1. Genome fragmentation 3. Sequences 4. Genome assembly by overlap

19 Timeline

20 The Human Genome Meet Your Genome (The Wheat genome (16.9 Gbp) is more than 5.mes bigger than the human genome and 80% of its genome consists of repe..ve sequences)

21 Quanto è COMPLESSO il genoma? Il genoma Umano c. 3Gb (Il Genoma di FRUMENTO (16.9 Gbp) è piu di 5 VOLTE piu grande di quello umano. 80% consiste di elemen. ripetu.)

22 Physical Mapping

23 Top down sequencing Genome fragmentation Physical map Subclone library Sequence clones by walking or by SHOTGUN strategy

24 Human Genome Project 16/02/2001

25 OK, abbiamo sequenziato il genoma. Ora che cosa fare? Dove sono I geni? Sequenziare ed allineare cdna (mrna) al genoma

26 Ma quali gene/allele sono responsabile per feno.pi di interesse? Dobbiamo paragonare genomi di tan. individui diversi e fare sta.s.ca per capire feno.pi complessi. Cioè, dobbiamo sequenziare TANTI individui della stessa specie ed associare feno.pi con geno.pi. Genome Wide Associa.on Studies (GWAS)

27 GWAS + Human nella leleratura Prima di 2004 (60 ar.coli) Da 2004 in poi (>14000 ar.coli) Sono sta. sequenzia. > genomi umani da 2004 in poi, Come è stato falo?

28 Revolu.onary techniques in molecular gene.cs Molecular cloning Sanger sequencing PCR Gel Electrophoresis Bloung (Southern/Northern/Western etc) Expression cloning (microarrays) Next Genera.on Sequencing

29 Next Genera.on Sequencing (Massively Parallel /Second Genera.on) HIGH throughput (lots of data) Rela.vely low cost Transversal in terms of applica.on

30 Read Length is Not As Important For Resequencing % of Paired K-mers with Uniquely Assignable Location 100% 90% 80% 70% 60% 50% 40% 30% 20% 10% 0% E.COLI HUMAN Length of K-mer Reads (bp)

31 Cost per megabase of DNA sequence

32 Next-Generation Sequencing A number of platforms using different strategies and chemistries, and with different throughput are entering the market. Ion Proton PacBio Roche / 454 Genome Sequencer FLX.tanium (800 bp, 800 Mb / run) Illumina / Solexa Gene.c Analyzer HiSeq 2000 (150x2 bp, 600 Gb / run) Applied Biosystems SOLiD 4 System TM (100x2 bp, 400 Gb / run)

33 When has a genome been fully sequenced? Fold coverage % sequenced

34 Illumina Bridge PCR Sequencing by synthesis using fluorescent reversible terminators

35 Technology Overview: Solexa/Illumina Sequencing

36 Immobilize DNA to Surface Source:

37 Technology Overview: Solexa Sequencing

38 Bridge PCR DNA fragments are flanked with adaptors. A flat surface coated with two types of primers, corresponding to the adaptors. Amplifica.on proceeds in cycles, with one end of each bridge tethered to the surface. Used by Solexa.

39 Sequence Colonies The bases are reversible terminators, only one base can be added. Then they are modified so that the next round of extension can occur.

40

41 Sequence Colonies Each base has a different Fluor (color). Excited by laser, and color is read.

42 Illumina sequencers sequencing-by-synthesis coupled with bridge amplification Available versions: HiSeq 2000 (up to 600 Gb, 250x2 bp reads) HiSeq 1000 (up to 300 Gb, 250x2 bp reads) Genome Analyzer (up to 95 Gb, 150x2 bp reads) MiSeq pla=orm (up to 6 Gb, 250x2 bp reads)

43 Da 2008

44

45 SNP calling The basic principle is simple! ACTTTTGCCCTGTGTCTAAAATGCGTCGTAGCATGT - reference! ACTTTTGCCCTGTGACTAAAATG!!!read1! TTGCCCTGTGACTAAAATGCGT!!!read2! TGCCCTGTGACTAAAATGCGTA!!read3! GCCCTGTGACTAAAATGCGTAG!!read4! GCCCTGTGACTAAAATGCGTAG!!read5! CCTGTGACTAAAATGCGTAGTAG!!read6! This looks like a homozygous SNP

46 SNP calling And this one looks heterozygous ACTTTTGCCCTGTGTCTAAAATGCGTCGTAGCATGT - reference! ACTTTTGCCCTGTGACTAAAATG!!!read1! TTGCCCTGTGTCTAAAATGCGT!!!read2! TGCCCTGTGACTAAAATGCGTA!!read3! GCCCTGTGTCTAAAATGCGTAG!!read4! GCCCTGTGACTAAAATGCGTAG!!read5! CCTGTGTCTAAAATGCGTAGTAG!!read6!

47 On average, we think that we will find a SNP (Single Nucleo.de Polymorphism) between 2 Human individuals about every 2000 bases. 99.5% iden.ty maybe 1,500,000 differences!

48 Structural Variation (SV) l Any DNA sequence altera.on other than a single nucleo.de subs.tu.on l l l l l l l copy number variations (CNV), transposon movement Expansion of trinucleotide and other simple repeats insertions-deletions (indels) translocations inversions the vast majority of SV events are small indels Human genomes differ more as a consequence of structural varia.on than of single- base- pair differences* Causal events in hereditary diseases somatic SV markers for GWAS / mapping studies

49 Copy Number Varia.on (CNVs) so... how representative is the reference genome? 49

50

51

52 Applica.ons of NGS playorms DNA sequencing - genome resequencing (SNPs, CNV, GWAS) - de novo sequencing - identification of genome structural variants (cancer genome) - 3D chromatin interactions - Epigenomics (chromatin state and genome methylation) - Metagenomics (taxonomic analysis of environmental samples) RNA sequencing - Qualitative and quantitative analysis of the Transcriptome - Identification and characterization of mirnas and other ncrnas - RNA editing - Metatrancriptomics (functional analysis of envronmental samples)

Next generation DNA sequencing technologies. theory & prac-ce

Next generation DNA sequencing technologies. theory & prac-ce Next generation DNA sequencing technologies theory & prac-ce Outline Next- Genera-on sequencing (NGS) technologies overview NGS applica-ons NGS workflow: data collec-on and processing the exome sequencing

More information

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing Technology and applications 10/1/2015 Jeroen Van Houdt - Genomics Core - KU Leuven - UZ Leuven 1 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977

More information

Next Generation Sequencing: Technology, Mapping, and Analysis

Next Generation Sequencing: Technology, Mapping, and Analysis Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University gbenson@bu.edu http://tandem.bu.edu/ The Human Genome Project took

More information

New generation sequencing: current limits and future perspectives. Giorgio Valle CRIBI - Università di Padova

New generation sequencing: current limits and future perspectives. Giorgio Valle CRIBI - Università di Padova New generation sequencing: current limits and future perspectives Giorgio Valle CRIBI Università di Padova Around 2004 the Race for the 1000$ Genome started A few questions... When? How? Why? Standard

More information

Introduction to next-generation sequencing data

Introduction to next-generation sequencing data Introduction to next-generation sequencing data David Simpson Centre for Experimental Medicine Queens University Belfast http://www.qub.ac.uk/research-centres/cem/ Outline History of DNA sequencing NGS

More information

NGS data analysis. Bernardo J. Clavijo

NGS data analysis. Bernardo J. Clavijo NGS data analysis Bernardo J. Clavijo 1 A brief history of DNA sequencing 1953 double helix structure, Watson & Crick! 1977 rapid DNA sequencing, Sanger! 1977 first full (5k) genome bacteriophage Phi X!

More information

Bioinformatica. Dr. Marco Fondi Lezione # 6. Corso di Laurea in Scienze Biologiche, AA 2012-2013

Bioinformatica. Dr. Marco Fondi Lezione # 6. Corso di Laurea in Scienze Biologiche, AA 2012-2013 Bioinformatica Dr. Marco Fondi Lezione # 6 Corso di Laurea in Scienze Biologiche, AA 2012-2013 martedì 30 ottobre 2012 1 Sequenziamento ed analisi di genomi: la genomica 2 martedì 30 ottobre 2012 martedì

More information

Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis

Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype

More information

PLNT2530 Unit 6e DNA Sequencing

PLNT2530 Unit 6e DNA Sequencing PLNT2530 Unit 6e DNA Sequencing Unless otherwise cited or referenced, all content of this presenataion is licensed under the Creative Commons License Attribution Share-Alike 2.5 Canada 1 High-throughput

More information

NEXT GENERATION SEQUENCING

NEXT GENERATION SEQUENCING NEXT GENERATION SEQUENCING Dr. R. Piazza SANGER SEQUENCING + DNA NEXT GENERATION SEQUENCING Flowcell NEXT GENERATION SEQUENCING Library di DNA Genomic DNA NEXT GENERATION SEQUENCING NEXT GENERATION SEQUENCING

More information

Overview of Next Generation Sequencing platform technologies

Overview of Next Generation Sequencing platform technologies Overview of Next Generation Sequencing platform technologies Dr. Bernd Timmermann Next Generation Sequencing Core Facility Max Planck Institute for Molecular Genetics Berlin, Germany Outline 1. Technologies

More information

An Overview of DNA Sequencing

An Overview of DNA Sequencing An Overview of DNA Sequencing Prokaryotic DNA Plasmid http://en.wikipedia.org/wiki/image:prokaryote_cell_diagram.svg Eukaryotic DNA http://en.wikipedia.org/wiki/image:plant_cell_structure_svg.svg DNA Structure

More information

Go where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe

Go where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe Go where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe Go where the biology takes you. To published results faster With proven scalability To the forefront of discovery To limitless applications

More information

Introduction to NGS data analysis

Introduction to NGS data analysis Introduction to NGS data analysis Jeroen F. J. Laros Leiden Genome Technology Center Department of Human Genetics Center for Human and Clinical Genetics Sequencing Illumina platforms Characteristics: High

More information

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing DNA sequence represents a single format onto which a broad range of biological phenomena can be projected for high-throughput data collection Over the past three years, massively

More information

DNA Sequencing & The Human Genome Project

DNA Sequencing & The Human Genome Project DNA Sequencing & The Human Genome Project An Endeavor Revolutionizing Modern Biology Jutta Marzillier, Ph.D Lehigh University Biological Sciences November 13 th, 2013 Guess, who turned 60 earlier this

More information

Computational Genomics. Next generation sequencing (NGS)

Computational Genomics. Next generation sequencing (NGS) Computational Genomics Next generation sequencing (NGS) Sequencing technology defies Moore s law Nature Methods 2011 Log 10 (price) Sequencing the Human Genome 2001: Human Genome Project 2.7G$, 11 years

More information

Data Analysis for Ion Torrent Sequencing

Data Analysis for Ion Torrent Sequencing IFU022 v140202 Research Use Only Instructions For Use Part III Data Analysis for Ion Torrent Sequencing MANUFACTURER: Multiplicom N.V. Galileilaan 18 2845 Niel Belgium Revision date: August 21, 2014 Page

More information

July 7th 2009 DNA sequencing

July 7th 2009 DNA sequencing July 7th 2009 DNA sequencing Overview Sequencing technologies Sequencing strategies Sample preparation Sequencing instruments at MPI EVA 2 x 5 x ABI 3730/3730xl 454 FLX Titanium Illumina Genome Analyzer

More information

Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS)

Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) A typical RNA Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,

More information

Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms

Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms Introduction Mate pair sequencing enables the generation of libraries with insert sizes in the range of several kilobases (Kb).

More information

restriction enzymes 350 Home R. Ward: Spring 2001

restriction enzymes 350 Home R. Ward: Spring 2001 restriction enzymes 350 Home Restriction Enzymes (endonucleases): molecular scissors that cut DNA Properties of widely used Type II restriction enzymes: recognize a single sequence of bases in dsdna, usually

More information

An example of bioinformatics application on plant breeding projects in Rijk Zwaan

An example of bioinformatics application on plant breeding projects in Rijk Zwaan An example of bioinformatics application on plant breeding projects in Rijk Zwaan Xiangyu Rao 17-08-2012 Introduction of RZ Rijk Zwaan is active worldwide as a vegetable breeding company that focuses on

More information

Core Facility Genomics

Core Facility Genomics Core Facility Genomics versatile genome or transcriptome analyses based on quantifiable highthroughput data ascertainment 1 Topics Collaboration with Harald Binder and Clemens Kreutz Project: Microarray

More information

Next Generation Sequencing for DUMMIES

Next Generation Sequencing for DUMMIES Next Generation Sequencing for DUMMIES Looking at a presentation without the explanation from the author is sometimes difficult to understand. This document contains extra information for some slides that

More information

G E N OM I C S S E RV I C ES

G E N OM I C S S E RV I C ES GENOMICS SERVICES THE NEW YORK GENOME CENTER NYGC is an independent non-profit implementing advanced genomic research to improve diagnosis and treatment of serious diseases. capabilities. N E X T- G E

More information

Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center

Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center Computational Challenges in Storage, Analysis and Interpretation of Next-Generation Sequencing Data Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center Next Generation Sequencing

More information

Description: Molecular Biology Services and DNA Sequencing

Description: Molecular Biology Services and DNA Sequencing Description: Molecular Biology s and DNA Sequencing DNA Sequencing s Single Pass Sequencing Sequence data only, for plasmids or PCR products Plasmid DNA or PCR products Plasmid DNA: 20 100 ng/μl PCR Product:

More information

SEQUENCING. From Sample to Sequence-Ready

SEQUENCING. From Sample to Sequence-Ready SEQUENCING From Sample to Sequence-Ready ACCESS ARRAY SYSTEM HIGH-QUALITY LIBRARIES, NOT ONCE, BUT EVERY TIME The highest-quality amplicons more sensitive, accurate, and specific Full support for all major

More information

School of Nursing. Presented by Yvette Conley, PhD

School of Nursing. Presented by Yvette Conley, PhD Presented by Yvette Conley, PhD What we will cover during this webcast: Briefly discuss the approaches introduced in the paper: Genome Sequencing Genome Wide Association Studies Epigenomics Gene Expression

More information

Biotechnology: DNA Technology & Genomics

Biotechnology: DNA Technology & Genomics Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 The BIG Questions How can we use our knowledge of DNA to: diagnose disease or defect? cure disease or defect? change/improve organisms? What

More information

The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics

The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics The GS Junior System The Power of Next-Generation Sequencing on Your Benchtop Proven technology: Uses the same long

More information

NGS Technologies for Genomics and Transcriptomics

NGS Technologies for Genomics and Transcriptomics NGS Technologies for Genomics and Transcriptomics Massimo Delledonne Department of Biotechnologies - University of Verona http://profs.sci.univr.it/delledonne 13 years and $3 billion required for the Human

More information

How many of you have checked out the web site on protein-dna interactions?

How many of you have checked out the web site on protein-dna interactions? How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss

More information

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Genetic engineering: humans Gene replacement therapy or gene therapy Many technical and ethical issues implications for gene pool for germ-line gene therapy what traits constitute disease rather than just

More information

Analysis of DNA methylation: bisulfite libraries and SOLiD sequencing

Analysis of DNA methylation: bisulfite libraries and SOLiD sequencing Analysis of DNA methylation: bisulfite libraries and SOLiD sequencing An easy view of the bisulfite approach CH3 genome TAGTACGTTGAT TAGTACGTTGAT read TAGTACGTTGAT TAGTATGTTGAT Three main problems 1.

More information

Genotyping by sequencing and data analysis. Ross Whetten North Carolina State University

Genotyping by sequencing and data analysis. Ross Whetten North Carolina State University Genotyping by sequencing and data analysis Ross Whetten North Carolina State University Stein (2010) Genome Biology 11:207 More New Technology on the Horizon Genotyping By Sequencing Timeline 2007 Complexity

More information

Chapter 20: Biotechnology: DNA Technology & Genomics

Chapter 20: Biotechnology: DNA Technology & Genomics Biotechnology Chapter 20: Biotechnology: DNA Technology & Genomics The BIG Questions How can we use our knowledge of DNA to: o Diagnose disease or defect? o Cure disease or defect? o Change/improve organisms?

More information

A Primer of Genome Science THIRD

A Primer of Genome Science THIRD A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:

More information

Next Generation Sequencing data Analysis at Genoscope. Jean-Marc Aury

Next Generation Sequencing data Analysis at Genoscope. Jean-Marc Aury Next Generation Sequencing data Analysis at Genoscope Jean-Marc Aury Introduction Presentation of Genoscope and NGS activities Overview of sequencing technologies Sequencing and assembly of prokaryotic

More information

Targeted. sequencing solutions. Accurate, scalable, fast TARGETED

Targeted. sequencing solutions. Accurate, scalable, fast TARGETED Targeted TARGETED Sequencing sequencing solutions Accurate, scalable, fast Sequencing for every lab, every budget, every application Ion Torrent semiconductor sequencing Ion Torrent technology has pioneered

More information

Sequencing and microarrays for genome analysis: complementary rather than competing?

Sequencing and microarrays for genome analysis: complementary rather than competing? Sequencing and microarrays for genome analysis: complementary rather than competing? Simon Hughes, Richard Capper, Sandra Lam and Nicole Sparkes Introduction The human genome is comprised of more than

More information

CCR Biology - Chapter 9 Practice Test - Summer 2012

CCR Biology - Chapter 9 Practice Test - Summer 2012 Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible

More information

Single-Cell DNA Sequencing with the C 1. Single-Cell Auto Prep System. Reveal hidden populations and genetic diversity within complex samples

Single-Cell DNA Sequencing with the C 1. Single-Cell Auto Prep System. Reveal hidden populations and genetic diversity within complex samples DATA Sheet Single-Cell DNA Sequencing with the C 1 Single-Cell Auto Prep System Reveal hidden populations and genetic diversity within complex samples Single-cell sensitivity Discover and detect SNPs,

More information

Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research. March 17, 2011 Rendez-Vous Séquençage

Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research. March 17, 2011 Rendez-Vous Séquençage Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research March 17, 2011 Rendez-Vous Séquençage Presentation Overview Core Technology Review Sequence Enrichment Application

More information

Automated DNA sequencing 20/12/2009. Next Generation Sequencing

Automated DNA sequencing 20/12/2009. Next Generation Sequencing DNA sequencing the beginnings Ghent University (Fiers et al) pioneers sequencing first complete gene (1972) first complete genome (1976) Next Generation Sequencing Fred Sanger develops dideoxy sequencing

More information

INTRODUCTION TO NGS VARIANT CALLING ANALYSIS

INTRODUCTION TO NGS VARIANT CALLING ANALYSIS Hospital Universitari Vall d Hebron Institut de Recerca - VHIR Institut d Investigació Sanitària de l Instituto de Salud Carlos III (ISCIII) INTRODUCTION TO NGS VARIANT CALLING ANALYSIS Bioinformàtica

More information

De Novo Assembly Using Illumina Reads

De Novo Assembly Using Illumina Reads De Novo Assembly Using Illumina Reads High quality de novo sequence assembly using Illumina Genome Analyzer reads is possible today using publicly available short-read assemblers. Here we summarize the

More information

First generation" sequencing technologies and genome assembly. Roger Bumgarner Associate Professor, Microbiology, UW Rogerb@u.washington.

First generation sequencing technologies and genome assembly. Roger Bumgarner Associate Professor, Microbiology, UW Rogerb@u.washington. First generation" sequencing technologies and genome assembly Roger Bumgarner ssociate Professor, Microbiology, UW Rogerb@u.washington.edu Why discuss a technology that appears to be being replaced? Next

More information

An Introduction to Next-Generation Sequencing Technology

An Introduction to Next-Generation Sequencing Technology n Introduction to Next-eneration Sequencing echnology Part II: n overview of DN Sequencing pplications Diverse pplications Next-generation sequencing (NS) platforms enable a wide variety of applications,

More information

Illumina Sequencing Technology

Illumina Sequencing Technology Illumina Sequencing Technology Highest data accuracy, simple workflow, and a broad range of applications. Introduction Figure 1: Illumina Flow Cell Illumina sequencing technology leverages clonal array

More information

Nazneen Aziz, PhD. Director, Molecular Medicine Transformation Program Office

Nazneen Aziz, PhD. Director, Molecular Medicine Transformation Program Office 2013 Laboratory Accreditation Program Audioconferences and Webinars Implementing Next Generation Sequencing (NGS) as a Clinical Tool in the Laboratory Nazneen Aziz, PhD Director, Molecular Medicine Transformation

More information

Assuring the Quality of Next-Generation Sequencing in Clinical Laboratory Practice. Supplementary Guidelines

Assuring the Quality of Next-Generation Sequencing in Clinical Laboratory Practice. Supplementary Guidelines Assuring the Quality of Next-Generation Sequencing in Clinical Laboratory Practice Next-generation Sequencing: Standardization of Clinical Testing (Nex-StoCT) Workgroup Principles and Guidelines Supplementary

More information

Chapter 9. Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA

Chapter 9. Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA Chapter 9 Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA Q&A Interferons are species specific, so that interferons to be used in humans must be produced in human cells. Can you think

More information

Bioruptor NGS: Unbiased DNA shearing for Next-Generation Sequencing

Bioruptor NGS: Unbiased DNA shearing for Next-Generation Sequencing STGAAC STGAACT GTGCACT GTGAACT STGAAC STGAACT GTGCACT GTGAACT STGAAC STGAAC GTGCAC GTGAAC Wouter Coppieters Head of the genomics core facility GIGA center, University of Liège Bioruptor NGS: Unbiased DNA

More information

CHALLENGES IN NEXT-GENERATION SEQUENCING

CHALLENGES IN NEXT-GENERATION SEQUENCING CHALLENGES IN NEXT-GENERATION SEQUENCING BASIC TENETS OF DATA AND HPC Gray s Laws of data engineering 1 : Scientific computing is very dataintensive, with no real limits. The solution is scale-out architecture

More information

BRCA1 / 2 testing by massive sequencing highlights, shadows or pitfalls?

BRCA1 / 2 testing by massive sequencing highlights, shadows or pitfalls? BRCA1 / 2 testing by massive sequencing highlights, shadows or pitfalls? Giovanni Luca Scaglione, PhD ------------------------ Laboratory of Clinical Molecular Diagnostics and Personalized Medicine, Institute

More information

Genome Sequence Quality. When looking at sequence: Caveat emptor

Genome Sequence Quality. When looking at sequence: Caveat emptor When looking at sequence: Caveat emptor Caveat emptor A phrase in Latin. It is a commonly cited axiom or principle in commerce that the buyer alone is responsible for assessing the quality of a purchase

More information

Difficult DNA Templates Sequencing. Primer Walking Service

Difficult DNA Templates Sequencing. Primer Walking Service Difficult DNA Templates Sequencing Primer Walking Service Result 16/18s (ITS 5.8s) rrna Sequencing Phylogenetic tree 16s rrna Region ITS rrna Region ITS and 26s rrna Region Order and Result Cloning Service

More information

SNP genotyping. Gene expression. And now Solexa sequencing.

SNP genotyping. Gene expression. And now Solexa sequencing. SNP genotyping. Gene expression. And now Solexa sequencing. Let s find the answers together. It s your research. You question. You test. You want answers quickly, accurately, and at a good value. Illumina

More information

Next generation sequencing (NGS)

Next generation sequencing (NGS) Next generation sequencing (NGS) Vijayachitra Modhukur BIIT modhukur@ut.ee 1 Bioinformatics course 11/13/12 Sequencing 2 Bioinformatics course 11/13/12 Microarrays vs NGS Sequences do not need to be known

More information

RNAseq / ChipSeq / Methylseq and personalized genomics

RNAseq / ChipSeq / Methylseq and personalized genomics RNAseq / ChipSeq / Methylseq and personalized genomics 7711 Lecture Subhajyo) De, PhD Division of Biomedical Informa)cs and Personalized Biomedicine, Department of Medicine University of Colorado School

More information

Introduction to Bioinformatics 3. DNA editing and contig assembly

Introduction to Bioinformatics 3. DNA editing and contig assembly Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 matthewb@ba.ars.usda.gov

More information

An Introduction to Next-Generation Sequencing Technology

An Introduction to Next-Generation Sequencing Technology n Introduction to Next-eneration Sequencing echnology Deciphering DN sequences is essential for virtually all branches of biological research. With the advent of capillary electrophoresis (E)-based Sanger

More information

MiSeq: Imaging and Base Calling

MiSeq: Imaging and Base Calling MiSeq: Imaging and Page Welcome Navigation Presenter Introduction MiSeq Sequencing Workflow Narration Welcome to MiSeq: Imaging and. This course takes 35 minutes to complete. Click Next to continue. Please

More information

Introduction To Real Time Quantitative PCR (qpcr)

Introduction To Real Time Quantitative PCR (qpcr) Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors

More information

Focusing on results not data comprehensive data analysis for targeted next generation sequencing

Focusing on results not data comprehensive data analysis for targeted next generation sequencing Focusing on results not data comprehensive data analysis for targeted next generation sequencing Daniel Swan, Jolyon Holdstock, Angela Matchan, Richard Stark, John Shovelton, Duarte Mohla and Simon Hughes

More information

Techniques in Molecular Biology (to study the function of genes)

Techniques in Molecular Biology (to study the function of genes) Techniques in Molecular Biology (to study the function of genes) Analysis of nucleic acids: Polymerase chain reaction (PCR) Gel electrophoresis Blotting techniques (Northern, Southern) Gene expression

More information

Tutorial for Windows and Macintosh. Preparing Your Data for NGS Alignment

Tutorial for Windows and Macintosh. Preparing Your Data for NGS Alignment Tutorial for Windows and Macintosh Preparing Your Data for NGS Alignment 2015 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) 1.734.769.7249

More information

PreciseTM Whitepaper

PreciseTM Whitepaper Precise TM Whitepaper Introduction LIMITATIONS OF EXISTING RNA-SEQ METHODS Correctly designed gene expression studies require large numbers of samples, accurate results and low analysis costs. Analysis

More information

Bioinformatics and its applications

Bioinformatics and its applications Bioinformatics and its applications Alla L Lapidus, Ph.D. SPbAU, SPbSU, St. Petersburg Term Bioinformatics Term Bioinformatics was invented by Paulien Hogeweg (Полина Хогевег) and Ben Hesper in 1970 as

More information

GenomeStudio Data Analysis Software

GenomeStudio Data Analysis Software GenomeStudio Data Analysis Software Illumina has created a comprehensive suite of data analysis tools to support a wide range of genetic analysis assays. This single software package provides data visualization

More information

Quando si parla di PCR quantitativa si intende:

Quando si parla di PCR quantitativa si intende: Quando si parla di PCR quantitativa si intende: A. Una PCR che produce grandi quantità di DNA B. Una PCR che emette quanti di luce C. Una PCR che quantifica il numero di molecole stampo presenti all inizio

More information

Genomics Services @ GENterprise

Genomics Services @ GENterprise Genomics Services @ GENterprise since 1998 Mainz University spin-off privately financed 6-10 employees since 2006 Genomics Services @ GENterprise Sequencing Service (Sanger/3730, 454) Genome Projects (Bacteria,

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources 1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools

More information

GenomeStudio Data Analysis Software

GenomeStudio Data Analysis Software GenomeStudio Analysis Software Illumina has created a comprehensive suite of data analysis tools to support a wide range of genetic analysis assays. This single software package provides data visualization

More information

Error Correction in Next Generation DNA Sequencing Data

Error Correction in Next Generation DNA Sequencing Data Western University Scholarship@Western Electronic Thesis and Dissertation Repository December 2012 Error Correction in Next Generation DNA Sequencing Data Michael Z. Molnar The University of Western Ontario

More information

The NGS IT notes. George Magklaras PhD RHCE

The NGS IT notes. George Magklaras PhD RHCE The NGS IT notes George Magklaras PhD RHCE Biotechnology Center of Oslo & The Norwegian Center of Molecular Medicine University of Oslo, Norway http://www.biotek.uio.no http://www.ncmm.uio.no http://www.no.embnet.org

More information

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,

More information

Introduction Bioo Scientific

Introduction Bioo Scientific Next Generation Sequencing Catalog 2014-2015 Introduction Bioo Scientific Bioo Scientific is a global life science company headquartered in Austin, TX, committed to providing innovative products and superior

More information

Concepts and methods in sequencing and genome assembly

Concepts and methods in sequencing and genome assembly BCM-2004 Concepts and methods in sequencing and genome assembly B. Franz LANG, Département de Biochimie Bureau: H307-15 Courrier électronique: Franz.Lang@Umontreal.ca Outline 1. Concepts in DNA and RNA

More information

Analysis of NGS Data

Analysis of NGS Data Analysis of NGS Data Introduction and Basics Folie: 1 Overview of Analysis Workflow Images Basecalling Sequences denovo - Sequencing Assembly Annotation Resequencing Alignments Comparison to reference

More information

Lawrence Berkeley National Laboratory Lawrence Berkeley National Laboratory

Lawrence Berkeley National Laboratory Lawrence Berkeley National Laboratory Lawrence Berkeley National Laboratory Lawrence Berkeley National Laboratory Title: Outline of the Assembly process: JAZZ, the JGI In-House Assembler Author: Shapiro, Harris Publication Date: 07-08-2005

More information

LifeScope Genomic Analysis Software 2.5

LifeScope Genomic Analysis Software 2.5 USER GUIDE LifeScope Genomic Analysis Software 2.5 Graphical User Interface DATA ANALYSIS METHODS AND INTERPRETATION Publication Part Number 4471877 Rev. A Revision Date November 2011 For Research Use

More information

Genomics for Dummies. Bio informatics and Comparative Genomes Analysis: Jean Michel Claverie 6 18 mai 2013

Genomics for Dummies. Bio informatics and Comparative Genomes Analysis: Jean Michel Claverie 6 18 mai 2013 Genomics for Dummies Bio informatics and Comparative Genomes Analysis: Jean Michel Claverie 6 18 mai 2013 Do I need to know more than just this telephone number? Introduction Try to learn/understand things

More information

Becker Muscular Dystrophy

Becker Muscular Dystrophy Muscular Dystrophy A Case Study of Positional Cloning Described by Benjamin Duchenne (1868) X-linked recessive disease causing severe muscular degeneration. 100 % penetrance X d Y affected male Frequency

More information

Welcome to Pacific Biosciences' Introduction to SMRTbell Template Preparation.

Welcome to Pacific Biosciences' Introduction to SMRTbell Template Preparation. Introduction to SMRTbell Template Preparation 100 338 500 01 1. SMRTbell Template Preparation 1.1 Introduction to SMRTbell Template Preparation Welcome to Pacific Biosciences' Introduction to SMRTbell

More information

The Economic Outlook Il quadro economico INTELLIGENCE ON THE WORLD, EUROPE, AND ITALY LO SCENARIO DI OGGI E DI DOMANI PER LE STRATEGIE COMPETITIVE

The Economic Outlook Il quadro economico INTELLIGENCE ON THE WORLD, EUROPE, AND ITALY LO SCENARIO DI OGGI E DI DOMANI PER LE STRATEGIE COMPETITIVE Session/Sessione The Economic Outlook Il quadro economico ELECTRONIC POLL RESULTS RISULTATI DEL TELEVOTO INTELLIGENCE ON THE WORLD, EUROPE, AND ITALY LO SCENARIO DI OGGI E DI DOMANI PER LE STRATEGIE COMPETITIVE

More information

Genomics 92 (2008) 255 264. Contents lists available at ScienceDirect. Genomics. journal homepage: www.elsevier.com/locate/ygeno

Genomics 92 (2008) 255 264. Contents lists available at ScienceDirect. Genomics. journal homepage: www.elsevier.com/locate/ygeno Genomics 92 (2008) 255 264 Contents lists available at ScienceDirect Genomics journal homepage: www.elsevier.com/locate/ygeno Review Applications of next-generation sequencing technologies in functional

More information

Biotechnology and Recombinant DNA

Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA Recombinant DNA procedures - an overview Biotechnology: The use of microorganisms, cells, or cell components to make a product. Foods, antibiotics, vitamins, enzymes Recombinant

More information

Personal Genome Sequencing with Complete Genomics Technology. Maido Remm

Personal Genome Sequencing with Complete Genomics Technology. Maido Remm Personal Genome Sequencing with Complete Genomics Technology Maido Remm 11 th Oct 2010 Three related papers 1. Describing the Complete Genomics technology Drmanac et al., Science 1 January 2010: Vol. 327.

More information

4.2.1. What is a contig? 4.2.2. What are the contig assembly programs?

4.2.1. What is a contig? 4.2.2. What are the contig assembly programs? Table of Contents 4.1. DNA Sequencing 4.1.1. Trace Viewer in GCG SeqLab Table. Box. Select the editor mode in the SeqLab main window. Import sequencer trace files from the File menu. Select the trace files

More information

Fishing for variants in the deep end of the gene pool: OGT s custom bait designs

Fishing for variants in the deep end of the gene pool: OGT s custom bait designs Fishing for variants in the deep end of the gene pool: OGT s custom bait designs Jolyon Holdstock, Simon Hughes and Daniel Swan Abstract Oxford Gene Technology (OGT) has extensive expertise in probe design

More information

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology

More information

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99. 1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence

More information

bitter is de pil Linos Vandekerckhove, MD, PhD

bitter is de pil Linos Vandekerckhove, MD, PhD 4//24 Current HIV care HIV copies/ ml plasma Viral load Welcome to the Digital droplet PCR age! bitter is de pil Linos Vandekerckhove, MD, PhD Latent HIV reservoir Time at Ghent University Hospital 2 HIV

More information

Bacterial Next Generation Sequencing - nur mehr Daten oder auch mehr Wissen? Dag Harmsen Univ. Münster, Germany dharmsen@uni-muenster.

Bacterial Next Generation Sequencing - nur mehr Daten oder auch mehr Wissen? Dag Harmsen Univ. Münster, Germany dharmsen@uni-muenster. Bacterial Next Generation Sequencing - nur mehr Daten oder auch mehr Wissen? Dag Harmsen Univ. Münster, Germany dharmsen@uni-muenster.de Commercial Disclosure Dag Harmsen is co-founder and partial owner

More information

Microbial Oceanomics using High-Throughput DNA Sequencing

Microbial Oceanomics using High-Throughput DNA Sequencing Microbial Oceanomics using High-Throughput DNA Sequencing Ramiro Logares Institute of Marine Sciences, CSIC, Barcelona 9th RES Users'Conference 23 September 2015 Importance of microbes in the sunlit ocean

More information

An Introduction to Next-Generation Sequencing Technology

An Introduction to Next-Generation Sequencing Technology An Introduction to Next-eneration Sequencing Technology Deciphering DNA sequences is essential for virtually all branches of biological research. With the advent of capillary electrophoresis (CE)-based

More information