E. coli plasmid and gene profiling using Next Generation Sequencing
|
|
|
- Jemima McKinney
- 9 years ago
- Views:
Transcription
1 E. coli plasmid and gene profiling using Next Generation Sequencing Jeroen F. J. Laros Leiden Genome Technology Center Department of Human Genetics Center for Human and Clinical Genetics
2 Introduction General overview Figure: Escherichia coli. Introduction NGS Data Analysis 1/22 Thursday, May 22, 2014
3 Introduction Genome published in Genome size basepairs. 4,288 genes in the assembly. 86 trna genes. 2,584 operons in the assembly. 7 rrna operons. Introduction NGS Data Analysis 2/22 Thursday, May 22, 2014
4 Introduction Genome published in Genome size basepairs. 4,288 genes in the assembly. 86 trna genes. 2,584 operons in the assembly. 7 rrna operons. However, per individual strain: Between 4,000 and 5,500 genes. 16,000 genes in total (pangenome). Introduction NGS Data Analysis 2/22 Thursday, May 22, 2014
5 Introduction Genome published in Genome size basepairs. 4,288 genes in the assembly. 86 trna genes. 2,584 operons in the assembly. 7 rrna operons. However, per individual strain: Between 4,000 and 5,500 genes. 16,000 genes in total (pangenome). Very diverse, only 20% of the genome is shared between all strains. Introduction NGS Data Analysis 2/22 Thursday, May 22, 2014
6 Plasmids Introduction Bacterial DNA Plasmids Figure: Schematic overview of a cell containing plasmids. Introduction NGS Data Analysis 3/22 Thursday, May 22, 2014
7 Plasmids Introduction Bacterial DNA Plasmids Figure: Schematic overview of a cell containing plasmids. Plasmids are small DNA molecules. Separate and independent from the chromosome. Can be transferred to other species. Size between and basepairs. Copy number between 1 and 1,000. Variable between strains and individuals. Introduction NGS Data Analysis 3/22 Thursday, May 22, 2014
8 Introduction Profiling Plasmids: May carry antibiotic resistance genes. Not all of them are known. May be highly similar to other plasmids. Introduction NGS Data Analysis 4/22 Thursday, May 22, 2014
9 Introduction Profiling Plasmids: May carry antibiotic resistance genes. Not all of them are known. May be highly similar to other plasmids. Genes: Multi Locus Sequence Typing (MLST). Uses household genes. Fragments of 450 to 500 basepairs. Introduction NGS Data Analysis 4/22 Thursday, May 22, 2014
10 Introduction Profiling Plasmids: May carry antibiotic resistance genes. Not all of them are known. May be highly similar to other plasmids. Genes: Multi Locus Sequence Typing (MLST). Uses household genes. Fragments of 450 to 500 basepairs. Antibiotic resistance. The gene may be known, the plasmid may not be. Introduction NGS Data Analysis 4/22 Thursday, May 22, 2014
11 Introduction Profiling Plasmids: May carry antibiotic resistance genes. Not all of them are known. May be highly similar to other plasmids. Genes: Multi Locus Sequence Typing (MLST). Uses household genes. Fragments of 450 to 500 basepairs. Antibiotic resistance. The gene may be known, the plasmid may not be. Efflux pumps.... Introduction NGS Data Analysis 4/22 Thursday, May 22, 2014
12 Introduction Antibiotic resistance testing Figure: Classical antibiotic resistance test. Introduction NGS Data Analysis 5/22 Thursday, May 22, 2014
13 Introduction Goals Clinical: Strain identification (MLST). Antibiotic resistance testing. Identifying efflux pumps. Find other important genes. Introduction NGS Data Analysis 6/22 Thursday, May 22, 2014
14 Introduction Goals Clinical: Strain identification (MLST). Antibiotic resistance testing. Identifying efflux pumps. Find other important genes. Technical limitations: The result must be delivered fast. Introduction NGS Data Analysis 6/22 Thursday, May 22, 2014
15 Introduction Goals Clinical: Strain identification (MLST). Antibiotic resistance testing. Identifying efflux pumps. Find other important genes. Technical limitations: The result must be delivered fast. Next Generation Sequencing. Introduction NGS Data Analysis 6/22 Thursday, May 22, 2014
16 Next Generation Sequencing Why Next Generation Sequencing? We analyse everything in one go. The genome, all plasmids are sequenced. Known but also unknown DNA is sequenced. Data can be re-analysed. Is gene X also in there? Introduction NGS Data Analysis 7/22 Thursday, May 22, 2014
17 Next Generation Sequencing Why Next Generation Sequencing? We analyse everything in one go. The genome, all plasmids are sequenced. Known but also unknown DNA is sequenced. Data can be re-analysed. Is gene X also in there? We did a pilot on the HiSeq Successful. A bit slow (it takes two weeks for a HiSeq to finish). Way too much data per sample. Over 200 times more data per sample than needed. Found a contamination (Streptococcus). Introduction NGS Data Analysis 7/22 Thursday, May 22, 2014
18 Next Generation Sequencing Sequencers: Ion Torrent Characteristics: 3 hours per run. 1 day sampleprep, 1 day emulsion PCR reads. Read length ±300bp. 2 E. coli per run. Figure: Ion torrent. Introduction NGS Data Analysis 8/22 Thursday, May 22, 2014
19 Next Generation Sequencing Sequencers: Ion Torrent Characteristics: 3 hours per run. 1 day sampleprep, 1 day emulsion PCR reads. Read length ±300bp. 2 E. coli per run. Figure: Ion torrent. Fast and inexpensive. Introduction NGS Data Analysis 8/22 Thursday, May 22, 2014
20 Data analysis General overview We screen for 130 known plasmids and 400 genes. Introduction NGS Data Analysis 9/22 Thursday, May 22, 2014
21 Data analysis General overview We screen for 130 known plasmids and 400 genes. Output: MLST. List of plasmids. Otherwise, similar plasmids. List of genes of interest. Introduction NGS Data Analysis 9/22 Thursday, May 22, 2014
22 Data analysis General overview We screen for 130 known plasmids and 400 genes. Output: MLST. List of plasmids. Otherwise, similar plasmids. List of genes of interest. For the MLST, we need a consensus sequence. As opposed to a list of variants, which we normally use. Introduction NGS Data Analysis 9/22 Thursday, May 22, 2014
23 Data analysis General overview We screen for 130 known plasmids and 400 genes. Output: MLST. List of plasmids. Otherwise, similar plasmids. List of genes of interest. For the MLST, we need a consensus sequence. As opposed to a list of variants, which we normally use. Forthelistof plasmidsandgenes, wewantalistwecanopen in Excel. Introduction NGS Data Analysis 9/22 Thursday, May 22, 2014
24 Alignment Data analysis Figure: Variant calling. Introduction NGS Data Analysis 10/22 Thursday, May 22, 2014
25 Data analysis MLST Pipeline: Map all reads to the genome. Make a consensus sequence. Select genes. Introduction NGS Data Analysis 11/22 Thursday, May 22, 2014
26 Data analysis MLST Pipeline: Map all reads to the genome. Make a consensus sequence. Select genes. Tools: tmap for alignment. samtools/bcftools for builing a consensus sequence. In house program to select a region. Introduction NGS Data Analysis 11/22 Thursday, May 22, 2014
27 Data analysis Plasmid detection Pipeline: Select all reads that do not map to the genome. Map these reads to each plasmid individually. Calculate the horizontal coverage. Introduction NGS Data Analysis 12/22 Thursday, May 22, 2014
28 Data analysis Plasmid detection Pipeline: Select all reads that do not map to the genome. Map these reads to each plasmid individually. Calculate the horizontal coverage. Tools: samtools to extract unmapped reads. tmap for alignment. In house program to make a wiggletrack. In house program to find covered regions. Introduction NGS Data Analysis 12/22 Thursday, May 22, 2014
29 Coverage Data analysis Figure: Coverage/ depth histogram. Introduction NGS Data Analysis 13/22 Thursday, May 22, 2014
30 Coverage Data analysis Figure: Coverage/ depth histogram. Introduction NGS Data Analysis 13/22 Thursday, May 22, 2014
31 Coverage Data analysis Figure: Coverage/ depth histogram. Figure: Coverage summary. Introduction NGS Data Analysis 13/22 Thursday, May 22, 2014
32 Data analysis Antibiotic resistance genes detection Pipeline: Select genes from the genome or plasmids. Calculate the non-n content of the consensus sequence. Introduction NGS Data Analysis 14/22 Thursday, May 22, 2014
33 Data analysis Antibiotic resistance genes detection Pipeline: Select genes from the genome or plasmids. Calculate the non-n content of the consensus sequence. Tools: In house program to select a region. In house program to calculate the non-n percentage. Introduction NGS Data Analysis 14/22 Thursday, May 22, 2014
34 Challenges Technical issues Between 66% and 80% of the reads map to the genome. Introduction NGS Data Analysis 15/22 Thursday, May 22, 2014
35 Challenges Technical issues Between 66% and 80% of the reads map to the genome. The other needs to be mapped to the 130 plasmids and 278 additional genes. Alignment is not much faster for small reference sequences. Introduction NGS Data Analysis 15/22 Thursday, May 22, 2014
36 Challenges Technical issues Between 66% and 80% of the reads map to the genome. The other needs to be mapped to the 130 plasmids and 278 additional genes. Alignment is not much faster for small reference sequences. In total, the analysis would take around = 136 times longer than the initial alignment. Introduction NGS Data Analysis 15/22 Thursday, May 22, 2014
37 Clusters Challenges Figure: Dell M610 blade server Introduction NGS Data Analysis 16/22 Thursday, May 22, 2014
38 Challenges Automatic scheduling on a cluster 1 %.bam: %.sam 2 $(SAMTOOLS) view bt $( call MAKEREF, $@) o $@ $< 3 4 %.flagstat : %.bam 5 $(SAMTOOLS) flagstat $< > $@ Listing 1: Makefile snippet. Introduction NGS Data Analysis 17/22 Thursday, May 22, 2014
39 Challenges Automatic scheduling on a cluster 1 %.bam: %.sam 2 $(SAMTOOLS) view bt $( call MAKEREF, $@) o $@ $< 3 4 %.flagstat : %.bam 5 $(SAMTOOLS) flagstat $< > $@ Listing 1: Makefile snippet. To fully exploit a cluster, we use the Make language. Only describe dependencies. Implicit workflow. Error control. Introduction NGS Data Analysis 17/22 Thursday, May 22, 2014
40 Challenges Automatic scheduling on a cluster 1 %.bam: %.sam 2 $(SAMTOOLS) view bt $( call MAKEREF, $@) o $@ $< 3 4 %.flagstat : %.bam 5 $(SAMTOOLS) flagstat $< > $@ Listing 1: Makefile snippet. To fully exploit a cluster, we use the Make language. Only describe dependencies. Implicit workflow. Error control. The pipeline we made is only 122 lines long. Introduction NGS Data Analysis 17/22 Thursday, May 22, 2014
41 MLST Results 1 CAATGATGATCGACAGTATGGCTGTGCTCGATATCTTCATTCTTGCGGCT 2 AAAGCGGCGGCGAACCACCACAAAGAATACCGGAACGAAGAAGATTGCCA 3 GTACCGTTGCGGTCACCATCCCGCCCATTACACCGGTACCTACTGCGTTC 4 TGCGCGCCGGAACCAGCACCAGTACTGATAACCAGCGGCATAACGCCGAG 5 GATAAACGCCAGCGAGGTCATCAGGATCGGACGTAAACGCATCCGCACCG 6 CATCAAGCGTCGCTTCAATCAGACCTTTACCTTCTTTATCCATCAAGTCT 7 TTGGCGAATTCGACGATAAGGATCGCGTTCTTCGCCGACAACCCAATGGT 8 TGTGAGCAGGCCTACCTGGAAGTAAACGTCATTGGTCAGGCCACGGAAGG Listing 2: Part of the consensus sequence of acrb. Introduction NGS Data Analysis 18/22 Thursday, May 22, 2014
42 MLST Results 1 CAATGATGATCGACAGTATGGCTGTGCTCGATATCTTCATTCTTGCGGCT 2 AAAGCGGCGGCGAACCACCACAAAGAATACCGGAACGAAGAAGATTGCCA 3 GTACCGTTGCGGTCACCATCCCGCCCATTACACCGGTACCTACTGCGTTC 4 TGCGCGCCGGAACCAGCACCAGTACTGATAACCAGCGGCATAACGCCGAG 5 GATAAACGCCAGCGAGGTCATCAGGATCGGACGTAAACGCATCCGCACCG 6 CATCAAGCGTCGCTTCAATCAGACCTTTACCTTCTTTATCCATCAAGTCT 7 TTGGCGAATTCGACGATAAGGATCGCGTTCTTCGCCGACAACCCAATGGT 8 TGTGAGCAGGCCTACCTGGAAGTAAACGTCATTGGTCAGGCCACGGAAGG Listing 2: Part of the consensus sequence of acrb. These sequences can be analysed directly by existing MLST classification software. Introduction NGS Data Analysis 18/22 Thursday, May 22, 2014
43 Results Plasmid detection Plasmid Size Reads #3/#2 Cov #5/#2 NC NC NC NC NC NC NC NC NC Table: Part of the plasmids Excel file. Introduction NGS Data Analysis 19/22 Thursday, May 22, 2014
44 Results Gene detection Reference Gene Length Cov #4/#3 AB CMY AB IMP AB ACT AB IMP AB IMP AB IMP AC accd AC acra AC acrb Table: Part of the genes Excel file. Introduction NGS Data Analysis 20/22 Thursday, May 22, 2014
45 Results Reusability Plasmids and genes can be added easily. Introduction NGS Data Analysis 21/22 Thursday, May 22, 2014
46 Results Reusability Plasmids and genes can be added easily. Plasmids. Download a reference sequence. Index the reference sequence. Put the files in the right folder. Introduction NGS Data Analysis 21/22 Thursday, May 22, 2014
47 Results Reusability Plasmids and genes can be added easily. Plasmids. Download a reference sequence. Index the reference sequence. Put the files in the right folder. Genes: Download a reference sequence. Find the gene in this reference sequence. Write down the coordinates of the gene. This part is automated. Introduction NGS Data Analysis 21/22 Thursday, May 22, 2014
48 Questions? Acknowledgements: Sunita Paltansing Henk Buermans Sandra Bernards Johan den Dunnen Introduction NGS Data Analysis 22/22 Thursday, May 22, 2014
Introduction to NGS data analysis
Introduction to NGS data analysis Jeroen F. J. Laros Leiden Genome Technology Center Department of Human Genetics Center for Human and Clinical Genetics Sequencing Illumina platforms Characteristics: High
Molecular typing of VTEC: from PFGE to NGS-based phylogeny
Molecular typing of VTEC: from PFGE to NGS-based phylogeny Valeria Michelacci 10th Annual Workshop of the National Reference Laboratories for E. coli in the EU Rome, November 5 th 2015 Molecular typing
restriction enzymes 350 Home R. Ward: Spring 2001
restriction enzymes 350 Home Restriction Enzymes (endonucleases): molecular scissors that cut DNA Properties of widely used Type II restriction enzymes: recognize a single sequence of bases in dsdna, usually
Next Generation Sequencing; Technologies, applications and data analysis
; Technologies, applications and data analysis Course 2542 Dr. Martie C.M. Verschuren Research group Analysis techniques in Life Science, Breda Prof. dr. Johan T. den Dunnen Leiden Genome Technology Center,
Next Generation Sequencing; Technologies, applications and data analysis
; Technologies, applications and data analysis Course 2542 Dr. Martie C.M. Verschuren Avans Hogeschool Research group Analysis techniques in Life Science, Breda Prof. dr. Johan T. den Dunnen Leiden Genome
2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three
Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,
Writing & Running Pipelines on the Open Grid Engine using QMake. Wibowo Arindrarto DTLS Focus Meeting 15.04.2014
Writing & Running Pipelines on the Open Grid Engine using QMake Wibowo Arindrarto DTLS Focus Meeting 15.04.2014 Makefile (re)introduction Atomic recipes / rules that define full pipelines Initially written
Next Generation Sequencing; Technologies, applications and data analysis
; Technologies, applications and data analysis Course 2542 Dr. Martie C.M. Verschuren Research group Analysis techniques in Life Science, Breda Prof. dr. Johan T. den Dunnen Leiden Genome Technology Center,
Introduction to next-generation sequencing data
Introduction to next-generation sequencing data David Simpson Centre for Experimental Medicine Queens University Belfast http://www.qub.ac.uk/research-centres/cem/ Outline History of DNA sequencing NGS
Bacterial Next Generation Sequencing - nur mehr Daten oder auch mehr Wissen? Dag Harmsen Univ. Münster, Germany dharmsen@uni-muenster.
Bacterial Next Generation Sequencing - nur mehr Daten oder auch mehr Wissen? Dag Harmsen Univ. Münster, Germany [email protected] Commercial Disclosure Dag Harmsen is co-founder and partial owner
Typing in the NGS era: The way forward!
Typing in the NGS era: The way forward! Valeria Michelacci NGS course, June 2015 Typing from sequence data NGS-derived conventional Multi Locus Sequence Typing (University of Warwick, 7 housekeeping genes)
Data Analysis for Ion Torrent Sequencing
IFU022 v140202 Research Use Only Instructions For Use Part III Data Analysis for Ion Torrent Sequencing MANUFACTURER: Multiplicom N.V. Galileilaan 18 2845 Niel Belgium Revision date: August 21, 2014 Page
Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology
Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,
The E. coli Insulin Factory
The E. coli Insulin Factory BACKGROUND Bacteria have not only their normal DNA, they also have pieces of circular DNA called plasmids. Plasmids are a wonderfully ally for biologists who desire to get bacteria
Bioruptor NGS: Unbiased DNA shearing for Next-Generation Sequencing
STGAAC STGAACT GTGCACT GTGAACT STGAAC STGAACT GTGCACT GTGAACT STGAAC STGAAC GTGCAC GTGAAC Wouter Coppieters Head of the genomics core facility GIGA center, University of Liège Bioruptor NGS: Unbiased DNA
Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center
Computational Challenges in Storage, Analysis and Interpretation of Next-Generation Sequencing Data Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center Next Generation Sequencing
An example of bioinformatics application on plant breeding projects in Rijk Zwaan
An example of bioinformatics application on plant breeding projects in Rijk Zwaan Xiangyu Rao 17-08-2012 Introduction of RZ Rijk Zwaan is active worldwide as a vegetable breeding company that focuses on
Next Generation Sequencing; Technologies, applications and data analysis
; Technologies, applications and data analysis Course 2542 Dr. Martie C.M. Verschuren Avans Hogeschool Research group Analysis techniques in Life Science, Breda Prof. dr. Johan T. den Dunnen Leiden Genome
Automated DNA sequencing 20/12/2009. Next Generation Sequencing
DNA sequencing the beginnings Ghent University (Fiers et al) pioneers sequencing first complete gene (1972) first complete genome (1976) Next Generation Sequencing Fred Sanger develops dideoxy sequencing
Using Illumina BaseSpace Apps to Analyze RNA Sequencing Data
Using Illumina BaseSpace Apps to Analyze RNA Sequencing Data The Illumina TopHat Alignment and Cufflinks Assembly and Differential Expression apps make RNA data analysis accessible to any user, regardless
Genetic diagnostics the gateway to personalized medicine
Micronova 20.11.2012 Genetic diagnostics the gateway to personalized medicine Kristiina Assoc. professor, Director of Genetic Department HUSLAB, Helsinki University Central Hospital The Human Genome Packed
Next Generation Sequencing
Next Generation Sequencing Technology and applications 10/1/2015 Jeroen Van Houdt - Genomics Core - KU Leuven - UZ Leuven 1 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977
Genetic Technology. Name: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question.
Name: Class: Date: Genetic Technology Multiple Choice Identify the choice that best completes the statement or answers the question. 1. An application of using DNA technology to help environmental scientists
NGS Data Analysis: An Intro to RNA-Seq
NGS Data Analysis: An Intro to RNA-Seq March 25th, 2014 GST Colloquim: March 25th, 2014 1 / 1 Workshop Design Basics of NGS Sample Prep RNA-Seq Analysis GST Colloquim: March 25th, 2014 2 / 1 Experimental
DNA Mapping/Alignment. Team: I Thought You GNU? Lars Olsen, Venkata Aditya Kovuri, Nick Merowsky
DNA Mapping/Alignment Team: I Thought You GNU? Lars Olsen, Venkata Aditya Kovuri, Nick Merowsky Overview Summary Research Paper 1 Research Paper 2 Research Paper 3 Current Progress Software Designs to
New Technologies for Sensitive, Low-Input RNA-Seq. Clontech Laboratories, Inc.
New Technologies for Sensitive, Low-Input RNA-Seq Clontech Laboratories, Inc. Outline Introduction Single-Cell-Capable mrna-seq Using SMART Technology SMARTer Ultra Low RNA Kit for the Fluidigm C 1 System
RAST Automated Analysis. What is RAST for?
RAST Automated Analysis Gordon D. Pusch Fellowship for Interpretation of Genomes What is RAST for? RAST is designed to rapidly call and annotate the genes of a complete or essentially complete prokaryotic
Twincore - Zentrum für Experimentelle und Klinische Infektionsforschung Institut für Molekulare Bakteriologie
Twincore - Zentrum für Experimentelle und Klinische Infektionsforschung Institut für Molekulare Bakteriologie 0 HELMHOLTZ I ZENTRUM FÜR INFEKTIONSFORSCHUNG Technische Universität Braunschweig Institut
An Overview of DNA Sequencing
An Overview of DNA Sequencing Prokaryotic DNA Plasmid http://en.wikipedia.org/wiki/image:prokaryote_cell_diagram.svg Eukaryotic DNA http://en.wikipedia.org/wiki/image:plant_cell_structure_svg.svg DNA Structure
Bioinformatics Resources at a Glance
Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences
CCR Biology - Chapter 9 Practice Test - Summer 2012
Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible
Next generation DNA sequencing technologies. theory & prac-ce
Next generation DNA sequencing technologies theory & prac-ce Outline Next- Genera-on sequencing (NGS) technologies overview NGS applica-ons NGS workflow: data collec-on and processing the exome sequencing
Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.
13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both
Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation
Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna
RNA Structure and folding
RNA Structure and folding Overview: The main functional biomolecules in cells are polymers DNA, RNA and proteins For RNA and Proteins, the specific sequence of the polymer dictates its final structure
Bacterial Transformation and Plasmid Purification. Chapter 5: Background
Bacterial Transformation and Plasmid Purification Chapter 5: Background History of Transformation and Plasmids Bacterial methods of DNA transfer Transformation: when bacteria take up DNA from their environment
AmphoraNet: Taxonomic Composition Analysis of Metagenomic Shotgun Sequencing Data
Csaba Kerepesi, Dániel Bánky, Vince Grolmusz: AmphoraNet: Taxonomic Composition Analysis of Metagenomic Shotgun Sequencing Data http://pitgroup.org/amphoranet/ PIT Bioinformatics Group, Department of Computer
G E N OM I C S S E RV I C ES
GENOMICS SERVICES THE NEW YORK GENOME CENTER NYGC is an independent non-profit implementing advanced genomic research to improve diagnosis and treatment of serious diseases. capabilities. N E X T- G E
Copy Number Variation: available tools
Copy Number Variation: available tools Jeroen F. J. Laros Leiden Genome Technology Center Department of Human Genetics Center for Human and Clinical Genetics Introduction A literature review of available
Bioinformatics and its applications
Bioinformatics and its applications Alla L Lapidus, Ph.D. SPbAU, SPbSU, St. Petersburg Term Bioinformatics Term Bioinformatics was invented by Paulien Hogeweg (Полина Хогевег) and Ben Hesper in 1970 as
CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA
CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA INTRODUCTION DNA : DNA is deoxyribose nucleic acid. It is made up of a base consisting of sugar, phosphate and one nitrogen base.the
Module 3 Questions. 7. Chemotaxis is an example of signal transduction. Explain, with the use of diagrams.
Module 3 Questions Section 1. Essay and Short Answers. Use diagrams wherever possible 1. With the use of a diagram, provide an overview of the general regulation strategies available to a bacterial cell.
AP BIOLOGY 2007 SCORING GUIDELINES
AP BIOLOGY 2007 SCORING GUIDELINES Question 4 A bacterial plasmid is 100 kb in length. The plasmid DNA was digested to completion with two restriction enzymes in three separate treatments: EcoRI, HaeIII,
Introduction. Preparation of Template DNA
Procedures and Recommendations for DNA Sequencing at the Plant-Microbe Genomics Facility Ohio State University Biological Sciences Building Room 420, 484 W. 12th Ave., Columbus OH 43210 Telephone: 614/247-6204;
Biotechnology: DNA Technology & Genomics
Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 The BIG Questions How can we use our knowledge of DNA to: diagnose disease or defect? cure disease or defect? change/improve organisms? What
SAP HANA Enabling Genome Analysis
SAP HANA Enabling Genome Analysis Joanna L. Kelley, PhD Postdoctoral Scholar, Stanford University Enakshi Singh, MSc HANA Product Management, SAP Labs LLC Outline Use cases Genomics review Challenges in
1 Mutation and Genetic Change
CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds
Creating Standard Curves with Genomic DNA or Plasmid DNA Templates for Use in Quantitative PCR
Creating Standard Curves with Genomic DNA or Plasmid DNA Templates for Use in Quantitative PCR Overview Genomic DNA (gdna) and plasmids containing cloned target sequences are commonly used as standards
Transmission of genetic variation: conjugation. Transmission of genetic variation: conjugation
Transmission of genetic variation: conjugation Transmission of genetic variation: conjugation Bacterial Conjugation is genetic recombination in which there is a transfer of DNA from a living donor bacterium
SEQUENCING. From Sample to Sequence-Ready
SEQUENCING From Sample to Sequence-Ready ACCESS ARRAY SYSTEM HIGH-QUALITY LIBRARIES, NOT ONCE, BUT EVERY TIME The highest-quality amplicons more sensitive, accurate, and specific Full support for all major
A Tutorial in Genetic Sequence Classification Tools and Techniques
A Tutorial in Genetic Sequence Classification Tools and Techniques Jake Drew Data Mining CSE 8331 Southern Methodist University [email protected] www.jakemdrew.com Sequence Characters IUPAC nucleotide
Transfection-Transfer of non-viral genetic material into eukaryotic cells. Infection/ Transduction- Transfer of viral genetic material into cells.
Transfection Key words: Transient transfection, Stable transfection, transfection methods, vector, plasmid, origin of replication, reporter gene/ protein, cloning site, promoter and enhancer, signal peptide,
Overview of Next Generation Sequencing platform technologies
Overview of Next Generation Sequencing platform technologies Dr. Bernd Timmermann Next Generation Sequencing Core Facility Max Planck Institute for Molecular Genetics Berlin, Germany Outline 1. Technologies
Procedures For DNA Sequencing
Procedures For DNA Sequencing Plant-Microbe Genomics Facility (PMGF) Ohio State University 420 Biological Sciences Building 484 W. 12th Ave., Columbus OH 43210 Telephone: 614/247-6204 FAX: 614/292-6337
Illumina Sequencing Technology
Illumina Sequencing Technology Highest data accuracy, simple workflow, and a broad range of applications. Introduction Figure 1: Illumina Flow Cell Illumina sequencing technology leverages clonal array
Vector NTI Advance 11 Quick Start Guide
Vector NTI Advance 11 Quick Start Guide Catalog no. 12605050, 12605099, 12605103 Version 11.0 December 15, 2008 12605022 Published by: Invitrogen Corporation 5791 Van Allen Way Carlsbad, CA 92008 U.S.A.
Milestones of bacterial genetic research:
Milestones of bacterial genetic research: 1944 Avery's pneumococcal transformation experiment shows that DNA is the hereditary material 1946 Lederberg & Tatum describes bacterial conjugation using biochemical
Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms
Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms Introduction Mate pair sequencing enables the generation of libraries with insert sizes in the range of several kilobases (Kb).
Removing Sequential Bottlenecks in Analysis of Next-Generation Sequencing Data
Removing Sequential Bottlenecks in Analysis of Next-Generation Sequencing Data Yi Wang, Gagan Agrawal, Gulcin Ozer and Kun Huang The Ohio State University HiCOMB 2014 May 19 th, Phoenix, Arizona 1 Outline
Difficult DNA Templates Sequencing. Primer Walking Service
Difficult DNA Templates Sequencing Primer Walking Service Result 16/18s (ITS 5.8s) rrna Sequencing Phylogenetic tree 16s rrna Region ITS rrna Region ITS and 26s rrna Region Order and Result Cloning Service
DNA Scissors: Introduction to Restriction Enzymes
DNA Scissors: Introduction to Restriction Enzymes Objectives At the end of this activity, students should be able to 1. Describe a typical restriction site as a 4- or 6-base- pair palindrome; 2. Describe
www.biochemj.org/bj/330/0581/bj3300581.htm
Ribosomes as Antibiotic Targets www.biochemj.org/bj/330/0581/bj3300581.htm Ware, Bioscience in the 21 st Century, 2009 PERSPECTIVE Widespread use of antibiotics after WWII improved human health globally
Master's projects at ITMO University. Daniil Chivilikhin PhD Student @ ITMO University
Master's projects at ITMO University Daniil Chivilikhin PhD Student @ ITMO University General information Guidance from our lab's researchers Publishable results 2 Research areas Research at ITMO Evolutionary
Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources
Appendix 2 Molecular Biology Core Curriculum Websites and Other Resources Chapter 1 - The Molecular Basis of Cancer 1. Inside Cancer http://www.insidecancer.org/ From the Dolan DNA Learning Center Cold
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS
Integrated Rule-based Data Management System for Genome Sequencing Data
Integrated Rule-based Data Management System for Genome Sequencing Data A Research Data Management (RDM) Green Shoots Pilots Project Report by Michael Mueller, Simon Burbidge, Steven Lawlor and Jorge Ferrer
A and B are not absolutely linked. They could be far enough apart on the chromosome that they assort independently.
Name Section 7.014 Problem Set 5 Please print out this problem set and record your answers on the printed copy. Answers to this problem set are to be turned in to the box outside 68-120 by 5:00pm on Friday
Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College
Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology
Metagenomics revisits the one pathogen/one disease postulates and translate the One Health concept into action
Les Rencontres de L INRA Metagenomics revisits the one pathogen/one disease postulates and translate the One Health concept into action E Albina (CIRAD) / S Guyomard(Institut Pasteur) Guadeloupe The era
Tutorial for Windows and Macintosh. Preparing Your Data for NGS Alignment
Tutorial for Windows and Macintosh Preparing Your Data for NGS Alignment 2015 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) 1.734.769.7249
GENE CLONING AND RECOMBINANT DNA TECHNOLOGY
GENE CLONING AND RECOMBINANT DNA TECHNOLOGY What is recombinant DNA? DNA from 2 different sources (often from 2 different species) are combined together in vitro. Recombinant DNA forms the basis of cloning.
Overview sequence projects
Overview sequence projects Bioassist NGS meeting 15-01-2010 Barbera van Schaik KEBB - Bioinformatics Laboratory [email protected] NGS at the Academic Medical Center Sequence facility Laboratory
BacReady TM Multiplex PCR System
BacReady TM Multiplex PCR System Technical Manual No. 0191 Version 10112010 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI Detailed Experimental
From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains
Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes
Description: Molecular Biology Services and DNA Sequencing
Description: Molecular Biology s and DNA Sequencing DNA Sequencing s Single Pass Sequencing Sequence data only, for plasmids or PCR products Plasmid DNA or PCR products Plasmid DNA: 20 100 ng/μl PCR Product:
Hadoop-BAM and SeqPig
Hadoop-BAM and SeqPig Keijo Heljanko 1, André Schumacher 1,2, Ridvan Döngelci 1, Luca Pireddu 3, Matti Niemenmaa 1, Aleksi Kallio 4, Eija Korpelainen 4, and Gianluigi Zanetti 3 1 Department of Computer
Introductory Biotechnology for High School Teachers - UNC-Wilmington
Workshop Dates: June 20-24, 2011 Introductory Biotechnology for High School Teachers - UNC-Wilmington Participants will learn basic scientific concepts and techniques in biotechnology, as well as how to
BCH401G Lecture 39 Andres
BCH401G Lecture 39 Andres Lecture Summary: Ribosome: Understand its role in translation and differences between translation in prokaryotes and eukaryotes. Translation: Understand the chemistry of this
Introduction To Epigenetic Regulation: How Can The Epigenomics Core Services Help Your Research? Maria (Ken) Figueroa, M.D. Core Scientific Director
Introduction To Epigenetic Regulation: How Can The Epigenomics Core Services Help Your Research? Maria (Ken) Figueroa, M.D. Core Scientific Director Gene expression depends upon multiple factors Gene Transcription
Tribuna Académica. Overview of Metagenomics for Marine Biodiversity Research 1. Barton E. Slatko* Metagenomics defined
Tribuna Académica 117 Overview of Metagenomics for Marine Biodiversity Research 1 Barton E. Slatko* We are in the midst of the fastest growing revolution in molecular biology, perhaps in all of life science,
BIOL 3200 Spring 2015 DNA Subway and RNA-Seq Data Analysis
BIOL 3200 Spring 2015 DNA Subway and RNA-Seq Data Analysis By the end of this lab students should be able to: Describe the uses for each line of the DNA subway program (Red/Yellow/Blue/Green) Describe
Worksheet - COMPARATIVE MAPPING 1
Worksheet - COMPARATIVE MAPPING 1 The arrangement of genes and other DNA markers is compared between species in Comparative genome mapping. As early as 1915, the geneticist J.B.S Haldane reported that
Recombinant DNA and Biotechnology
Recombinant DNA and Biotechnology Chapter 18 Lecture Objectives What Is Recombinant DNA? How Are New Genes Inserted into Cells? What Sources of DNA Are Used in Cloning? What Other Tools Are Used to Study
NORTH PACIFIC RESEARCH BOARD SEMIANNUAL PROGRESS REPORT
1. PROJECT INFORMATION NPRB Project Number: 1303 Title: Assessing benthic meiofaunal community structure in the Alaskan Arctic: A high-throughput DNA sequencing approach Subaward period July 1, 2013 Jun
European Medicines Agency
European Medicines Agency July 1996 CPMP/ICH/139/95 ICH Topic Q 5 B Quality of Biotechnological Products: Analysis of the Expression Construct in Cell Lines Used for Production of r-dna Derived Protein
Delivering the power of the world s most successful genomics platform
Delivering the power of the world s most successful genomics platform NextCODE Health is bringing the full power of the world s largest and most successful genomics platform to everyday clinical care NextCODE
Accelerate genomic breakthroughs in microbiology. Gain deeper insights with powerful bioinformatic tools.
Accelerate genomic breakthroughs in microbiology. Gain deeper insights with powerful bioinformatic tools. Empowering microbial genomics. Extensive methods. Expansive possibilities. In microbiome studies
Genetics Lecture Notes 7.03 2005. Lectures 1 2
Genetics Lecture Notes 7.03 2005 Lectures 1 2 Lecture 1 We will begin this course with the question: What is a gene? This question will take us four lectures to answer because there are actually several
Nazneen Aziz, PhD. Director, Molecular Medicine Transformation Program Office
2013 Laboratory Accreditation Program Audioconferences and Webinars Implementing Next Generation Sequencing (NGS) as a Clinical Tool in the Laboratory Nazneen Aziz, PhD Director, Molecular Medicine Transformation
Genomics Services @ GENterprise
Genomics Services @ GENterprise since 1998 Mainz University spin-off privately financed 6-10 employees since 2006 Genomics Services @ GENterprise Sequencing Service (Sanger/3730, 454) Genome Projects (Bacteria,
Genetics Module B, Anchor 3
Genetics Module B, Anchor 3 Key Concepts: - An individual s characteristics are determines by factors that are passed from one parental generation to the next. - During gamete formation, the alleles for
Version 5.0 Release Notes
Version 5.0 Release Notes 2011 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) +1.734.769.7249 (elsewhere) +1.734.769.7074 (fax) www.genecodes.com
Sequence Formats and Sequence Database Searches. Gloria Rendon SC11 Education June, 2011
Sequence Formats and Sequence Database Searches Gloria Rendon SC11 Education June, 2011 Sequence A is the primary structure of a biological molecule. It is a chain of residues that form a precise linear
Genetics Test Biology I
Genetics Test Biology I Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Avery s experiments showed that bacteria are transformed by a. RNA. c. proteins.
