RAST Automated Analysis. What is RAST for?

Size: px
Start display at page:

Download "RAST Automated Analysis. What is RAST for?"

Transcription

1 RAST Automated Analysis Gordon D. Pusch Fellowship for Interpretation of Genomes What is RAST for? RAST is designed to rapidly call and annotate the genes of a complete or essentially complete prokaryotic genome RAST uses a "Highest Confidence First" assignment propagation strategy based on manually curated subsystems and subsystem-based protein families that automatically guarantees a high degree of assignment consistency. RAST returns an analysis of the genes and subsystems in your genome, as supported by comparative and other forms of evidence. 1

2 The RAST Strategy How does RAST work? RAST applies FIG's "Subsystem Approach" using a "Highest Reliability First" strategy based on FIG's collection of manually curated Subsystems and subsystem-derived Protein Families (FIGfams). RAST's subsystem approach automatically ensures a high degree of annotation consistency. RAST also computes various derived data (sims, BBHs, PCHs, Scenarios, etc.) to support high-throughput genome annotation projects. RAST Strategy - Calling Genes Find RNAs (rrnas, trnas) Find gene candidates for "Special Proteins (selenos, pyrros) Find gene candidates for membership in: "Universal" FIGfam Protein Families FIGfams already seen in the neighboring genomes. FIGfams other than those found in the neighboring genomes. Repair frameshift errors. Promote remaining non-figfam gene candidates: With similarity to genes in neighbors Without similarity to genes in neighbors Examine suspiciously long gaps for possible "missing" genes previously found in neighboring genomes (AKA "Backfilling"). Gene candidates found during all previous stages become the "training set" for the current stage. Gene candidates are only retained if they do not overlap too much. 2

3 I/O - What input formats does RAST Accept? Sequence data in FASTA format (.fna), and GenBank (.gbk) format, uploaded as plain text files with no special characters, etc. RAST does not yet support other upload formats, such as EMBL, GFF3, GTF, etc. (although it can generate output in these formats). RAST will reject any file format that is not plain text, e.g. it will not accept genomes encoded as HTML, PDF, RTF, Microsoft Word, etc. I/O - Genes reannotated or recalled? If you want to keep the original gene coordinates, then you must upload a GenBank file and select the "Keep existing gene calls" option. RAST will then assign functions and perform a subsystem analysis, without recalling the genes of your genome. RAST cannot preserve existing gene calls if FASTA contig data are uploaded, because the FASTA format cannot specify gene locations. 3

4 I/O - Viewing Results You can browse your results and graphically compare them to other genomes using the SEED Viewer You can also download the analysis of your genome in various formats: GenBank EMBL GFF3 GTF SEED genome directory (as tarfile) Input Data Quality What is the poorest quality of data that RAST can handle? We recommend mean contig length >2 kbp, with <1% ambiguity characters. If your assembly quality is worse than this, RAST will most likely fail. It is possible that the metagenomic version of RAST may be able to do something with extremely low quality assemblies; however, MG-RAST is not really designed for this job. 4

5 Input Data Quality RAST is designed for and performs best on complete or essentially complete genomes. Conversely, RAST's performance degrades substantially when presented with only a small fragment of a genome. Even if you are only interested in a few genes in a small region, it is recommend that you upload as much of your genome as possible, and at minimum 100 kbp of contig data. The probability that RAST will abort with errors increases rapidly below the 100 kbp threshold, and is well in excess of 50% below 40 kbp. Input Data Quality What is meant by "essentially complete" genome? We consider a genome to be "essentially complete" at about 99% coverage, since beyond that point, the expected number of missing genes due to sequencing gaps has become less than the expected number of "false negatives" from the genefinder. From Subsystem Analysis standpoint, >99% completeness point of diminishing returns. In terms of sequence redundancy: At least 5x coverage for Sanger Sequencing, or at least 10x coverage using 454. In terms of contig length: At least 70% of the assembled sequence data are in contigs longer than 20 kbp. 5

6 Input Sequence Types Will RAST handle just a plasmid? RAST is not designed to handle only plasmids or small fragments. We recommend that you upload the entire genome, even if you intend to only view your plasmid. (Extension of RAST to plasmids proposed) What about Eukaryotes? No not even small ones, and not even organelles! Currently, RAST requires you to specify whether your genome is a bacterium or archaeon. If you try to submit a eukaryote, RAST will most likely abort with errors. (Extension of RAST to [called!] eukaryotes proposed) Input Sequence Types What about ESTs? RAST is not designed to analyze ESTs, and will most likely abort with errors. You can try submitting EST data to the metagenomic version of RAST but again, it is not really designed for them. What about Metagenomes? As previously mentioned, there is a special metagenomic version of RAST designed specifically to analyze the sort of massive, low-quality datasets typically generated by metagenomics projects. 6

7 FAQs and Common Problems Who do I contact if I have questions about or problems using RAST? All questions or problems regarding RAST should be sent to rast@mcs.anl.gov All questions or problems regarding MG-RAST should be sent to mg-rast@mcs.anl.gov FAQs and Common Problems Will RAST assemble my reads into contigs? No. You will need to assemble your reads into contigs yourself, using some other tool. Why does RAST complain that it can't find the "phylogenetic neighborhood" of my submission? Usually, this is because the submitted sequence data are too small. Experience suggests that RAST needs at least 40 kbp of sequence data to reliably place a submission's phylogenetic neighborhood. (100 kbp is better.) 7

8 FAQs and Common Problems RAST is complaining about "Duplicate contig IDs," but all my contig IDs appear unique to me. What's going on? Your contig IDs may contain "whitespace" characters. The FASTA standard specifies no "whitespace" between the ">" symbol and the contig ID, and that everything after the first "whitespace" character is a "comment," and not part of the identifier. Thus, the first FASTA header below is invalid (no ID, just comment), while the following two will be interpreted as a pair of "duplicate IDs, that are both named "B.": > E. coli main chromosome >B. subtilis main chromosome >B. subtilis plasmid FAQs and Common Problems Why does RAST complain about "invalid characters" in my FASTA input file? Most likely one of two reasons: Your contig sequences contain characters other than the standard IUPAC ambiguity characters [ACGTUMRWSYKBDHVN] or the "vector masking" character "X. (E.g., because you uploaded protein, not DNA sequences.) Your contig file uses nonstandard line terminators, is missing line terminators before or after a record header, or is otherwise malformed in some way. 8

9 FAQs and Common Problems How do I get a more detailed explanation of why my job failed? If the RAST webpage describing the error is insufficient to help you diagnose the problem, please send to <rast@mcs.anl.gov>; we will consult the error-logs for your job, and recommend a solution. FAQs and Common Problems I selected Keep existing gene calls and uploaded a GenBank file, but RAST failed with the cryptic error Zero-size or non-existent FASTA file. What does this mean? Most likely your GenBank file either has: Gene entries but no CDS entries. CDS entries lacking a /translation= field. RAST s GenBank parser expects CDS entries with /translation= fields 9

10 Conclusion RAST is designed to automatically call and annotate complete or near-complete prokaryotic genomes. RAST uses a Highest Confidence First assignment propagation strategy. RAST assignments are based on manually curated subsystems and subsystem-based protein families. RAST s subsystem-based annotations automatically guarantee a high degree of assignment consistency. 10

Bioinformatics Resources at a Glance

Bioinformatics Resources at a Glance Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences

More information

When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want

When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want 1 When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want to search other databases as well. There are very

More information

Tutorial for Windows and Macintosh. Preparing Your Data for NGS Alignment

Tutorial for Windows and Macintosh. Preparing Your Data for NGS Alignment Tutorial for Windows and Macintosh Preparing Your Data for NGS Alignment 2015 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) 1.734.769.7249

More information

GenBank, Entrez, & FASTA

GenBank, Entrez, & FASTA GenBank, Entrez, & FASTA Nucleotide Sequence Databases First generation GenBank is a representative example started as sort of a museum to preserve knowledge of a sequence from first discovery great repositories,

More information

Searching Nucleotide Databases

Searching Nucleotide Databases Searching Nucleotide Databases 1 When we search a nucleic acid databases, Mascot always performs a 6 frame translation on the fly. That is, 3 reading frames from the forward strand and 3 reading frames

More information

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the

More information

The human gene encoding Glucose-6-phosphate dehydrogenase (G6PD) is located on chromosome X in cytogenetic band q28.

The human gene encoding Glucose-6-phosphate dehydrogenase (G6PD) is located on chromosome X in cytogenetic band q28. Tutorial Module 5 BioMart You will learn about BioMart, a joint project developed and maintained at EBI and OiCR www.biomart.org How to use BioMart to quickly obtain lists of gene information from Ensembl

More information

CD-HIT User s Guide. Last updated: April 5, 2010. http://cd-hit.org http://bioinformatics.org/cd-hit/

CD-HIT User s Guide. Last updated: April 5, 2010. http://cd-hit.org http://bioinformatics.org/cd-hit/ CD-HIT User s Guide Last updated: April 5, 2010 http://cd-hit.org http://bioinformatics.org/cd-hit/ Program developed by Weizhong Li s lab at UCSD http://weizhong-lab.ucsd.edu liwz@sdsc.edu 1. Introduction

More information

Introduction to Genome Annotation

Introduction to Genome Annotation Introduction to Genome Annotation AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT

More information

A Tutorial in Genetic Sequence Classification Tools and Techniques

A Tutorial in Genetic Sequence Classification Tools and Techniques A Tutorial in Genetic Sequence Classification Tools and Techniques Jake Drew Data Mining CSE 8331 Southern Methodist University jakemdrew@gmail.com www.jakemdrew.com Sequence Characters IUPAC nucleotide

More information

Chapter 2. imapper: A web server for the automated analysis and mapping of insertional mutagenesis sequence data against Ensembl genomes

Chapter 2. imapper: A web server for the automated analysis and mapping of insertional mutagenesis sequence data against Ensembl genomes Chapter 2. imapper: A web server for the automated analysis and mapping of insertional mutagenesis sequence data against Ensembl genomes 2.1 Introduction Large-scale insertional mutagenesis screening in

More information

Module 1. Sequence Formats and Retrieval. Charles Steward

Module 1. Sequence Formats and Retrieval. Charles Steward The Open Door Workshop Module 1 Sequence Formats and Retrieval Charles Steward 1 Aims Acquaint you with different file formats and associated annotations. Introduce different nucleotide and protein databases.

More information

Overview of Eukaryotic Gene Prediction

Overview of Eukaryotic Gene Prediction Overview of Eukaryotic Gene Prediction CBB 231 / COMPSCI 261 W.H. Majoros What is DNA? Nucleus Chromosome Telomere Centromere Cell Telomere base pairs histones DNA (double helix) DNA is a Double Helix

More information

Sequence Formats and Sequence Database Searches. Gloria Rendon SC11 Education June, 2011

Sequence Formats and Sequence Database Searches. Gloria Rendon SC11 Education June, 2011 Sequence Formats and Sequence Database Searches Gloria Rendon SC11 Education June, 2011 Sequence A is the primary structure of a biological molecule. It is a chain of residues that form a precise linear

More information

Version 5.0 Release Notes

Version 5.0 Release Notes Version 5.0 Release Notes 2011 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) +1.734.769.7249 (elsewhere) +1.734.769.7074 (fax) www.genecodes.com

More information

DNA Sequence formats

DNA Sequence formats DNA Sequence formats [Plain] [EMBL] [FASTA] [GCG] [GenBank] [IG] [IUPAC] [How Genomatix represents sequence annotation] Plain sequence format A sequence in plain format may contain only IUPAC characters

More information

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d. 13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both

More information

E. coli plasmid and gene profiling using Next Generation Sequencing

E. coli plasmid and gene profiling using Next Generation Sequencing E. coli plasmid and gene profiling using Next Generation Sequencing Jeroen F. J. Laros Leiden Genome Technology Center Department of Human Genetics Center for Human and Clinical Genetics Introduction General

More information

NCBI resources III: GEO and ftp site. Yanbin Yin Spring 2013

NCBI resources III: GEO and ftp site. Yanbin Yin Spring 2013 NCBI resources III: GEO and ftp site Yanbin Yin Spring 2013 1 Homework assignment 2 Search colon cancer at GEO and find a data Series and perform a GEO2R analysis Write a report (in word or ppt) to include

More information

A Multiple DNA Sequence Translation Tool Incorporating Web Robot and Intelligent Recommendation Techniques

A Multiple DNA Sequence Translation Tool Incorporating Web Robot and Intelligent Recommendation Techniques Proceedings of the 2007 WSEAS International Conference on Computer Engineering and Applications, Gold Coast, Australia, January 17-19, 2007 402 A Multiple DNA Sequence Translation Tool Incorporating Web

More information

Genome and DNA Sequence Databases. BME 110/BIOL 181 CompBio Tools Todd Lowe March 31, 2009

Genome and DNA Sequence Databases. BME 110/BIOL 181 CompBio Tools Todd Lowe March 31, 2009 Genome and DNA Sequence Databases BME 110/BIOL 181 CompBio Tools Todd Lowe March 31, 2009 Admin Reading: Chapters 1 & 2 Notes available in PDF format on-line (see class calendar page): http://www.soe.ucsc.edu/classes/bme110/spring09/bme110-calendar.html

More information

RESTRICTION DIGESTS Based on a handout originally available at

RESTRICTION DIGESTS Based on a handout originally available at RESTRICTION DIGESTS Based on a handout originally available at http://genome.wustl.edu/overview/rst_digest_handout_20050127/restrictiondigest_jan2005.html What is a restriction digests? Cloned DNA is cut

More information

Databases and mapping BWA. Samtools

Databases and mapping BWA. Samtools Databases and mapping BWA Samtools FASTQ, SFF, bax.h5 ACE, FASTG FASTA BAM/SAM GFF, BED GenBank/Embl/DDJB many more File formats FASTQ Output format from Illumina and IonTorrent sequencers. Quality scores:

More information

Multiple Sequence Alignment. Hot Topic 5/24/06 Kim Walker

Multiple Sequence Alignment. Hot Topic 5/24/06 Kim Walker Multiple Sequence Alignment Hot Topic 5/24/06 Kim Walker Outline Why are Multiple Sequence Alignments useful? What Tools are Available? Brief Introduction to ClustalX Tools to Edit and Add Features to

More information

When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want

When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want 1 When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want to search other databases as well. There are very

More information

ProSightPC 3.0 Quick Start Guide

ProSightPC 3.0 Quick Start Guide ProSightPC 3.0 Quick Start Guide The Thermo ProSightPC 3.0 application is the only proteomics software suite that effectively supports high-mass-accuracy MS/MS experiments performed on LTQ FT and LTQ Orbitrap

More information

A Primer of Genome Science THIRD

A Primer of Genome Science THIRD A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:

More information

Structure and Function of DNA

Structure and Function of DNA Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four

More information

An Overview of DNA Sequencing

An Overview of DNA Sequencing An Overview of DNA Sequencing Prokaryotic DNA Plasmid http://en.wikipedia.org/wiki/image:prokaryote_cell_diagram.svg Eukaryotic DNA http://en.wikipedia.org/wiki/image:plant_cell_structure_svg.svg DNA Structure

More information

LifeScope Genomic Analysis Software 2.5

LifeScope Genomic Analysis Software 2.5 USER GUIDE LifeScope Genomic Analysis Software 2.5 Graphical User Interface DATA ANALYSIS METHODS AND INTERPRETATION Publication Part Number 4471877 Rev. A Revision Date November 2011 For Research Use

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources 1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools

More information

CLC Sequence Viewer USER MANUAL

CLC Sequence Viewer USER MANUAL CLC Sequence Viewer USER MANUAL Manual for CLC Sequence Viewer 7.6.1 Windows, Mac OS X and Linux September 3, 2015 This software is for research purposes only. QIAGEN Aarhus A/S Silkeborgvej 2 Prismet

More information

ithenticate User Manual

ithenticate User Manual ithenticate User Manual Version: 2.0.8 Updated February 4, 2014 Contents Introduction 4 New Users 4 Logging In 4 Resetting Your Password 5 Changing Your Password or Username 6 The ithenticate Account Homepage

More information

1 Mutation and Genetic Change

1 Mutation and Genetic Change CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds

More information

2.3 Identify rrna sequences in DNA

2.3 Identify rrna sequences in DNA 2.3 Identify rrna sequences in DNA For identifying rrna sequences in DNA we will use rnammer, a program that implements an algorithm designed to find rrna sequences in DNA [5]. The program was made by

More information

Year 8 KS3 Computer Science Homework Booklet

Year 8 KS3 Computer Science Homework Booklet Year 8 KS3 Computer Science Homework Booklet Information for students and parents: Throughout the year your ICT/Computer Science Teacher will set a number of pieces of homework from this booklet. If you

More information

4.2.1. What is a contig? 4.2.2. What are the contig assembly programs?

4.2.1. What is a contig? 4.2.2. What are the contig assembly programs? Table of Contents 4.1. DNA Sequencing 4.1.1. Trace Viewer in GCG SeqLab Table. Box. Select the editor mode in the SeqLab main window. Import sequencer trace files from the File menu. Select the trace files

More information

Frequently Asked Questions Next Generation Sequencing

Frequently Asked Questions Next Generation Sequencing Frequently Asked Questions Next Generation Sequencing Import These Frequently Asked Questions for Next Generation Sequencing are some of the more common questions our customers ask. Questions are divided

More information

Lecture Outline. Introduction to Databases. Introduction. Data Formats Sample databases How to text search databases. Shifra Ben-Dor Irit Orr

Lecture Outline. Introduction to Databases. Introduction. Data Formats Sample databases How to text search databases. Shifra Ben-Dor Irit Orr Introduction to Databases Shifra Ben-Dor Irit Orr Lecture Outline Introduction Data and Database types Database components Data Formats Sample databases How to text search databases What units of information

More information

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes

More information

Fax via HTTP (POST) Traitel Telecommunications Pty Ltd 2012 Telephone: (61) (2) 9032 2700. Page 1

Fax via HTTP (POST) Traitel Telecommunications Pty Ltd 2012 Telephone: (61) (2) 9032 2700. Page 1 Fax via HTTP (POST) Page 1 Index: Introduction:...3 Usage:...3 Page 2 Introduction: TraiTel Telecommunications offers several delivery methods for its faxing service. This document will describe the HTTP/POST

More information

Data formats and file conversions

Data formats and file conversions Building Excellence in Genomics and Computational Bioscience s Richard Leggett (TGAC) John Walshaw (IFR) Common file formats FASTQ FASTA BAM SAM Raw sequence Alignments MSF EMBL UniProt BED WIG Databases

More information

The sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized:

The sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized: Module 3F Protein Synthesis So far in this unit, we have examined: How genes are transmitted from one generation to the next Where genes are located What genes are made of How genes are replicated How

More information

Introduction to Bioinformatics 3. DNA editing and contig assembly

Introduction to Bioinformatics 3. DNA editing and contig assembly Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 matthewb@ba.ars.usda.gov

More information

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,

More information

Usability in bioinformatics mobile applications

Usability in bioinformatics mobile applications Usability in bioinformatics mobile applications what we are working on Noura Chelbah, Sergio Díaz, Óscar Torreño, and myself Juan Falgueras App name Performs Advantajes Dissatvantajes Link The problem

More information

org.rn.eg.db December 16, 2015 org.rn.egaccnum is an R object that contains mappings between Entrez Gene identifiers and GenBank accession numbers.

org.rn.eg.db December 16, 2015 org.rn.egaccnum is an R object that contains mappings between Entrez Gene identifiers and GenBank accession numbers. org.rn.eg.db December 16, 2015 org.rn.egaccnum Map Entrez Gene identifiers to GenBank Accession Numbers org.rn.egaccnum is an R object that contains mappings between Entrez Gene identifiers and GenBank

More information

Module 3 Questions. 7. Chemotaxis is an example of signal transduction. Explain, with the use of diagrams.

Module 3 Questions. 7. Chemotaxis is an example of signal transduction. Explain, with the use of diagrams. Module 3 Questions Section 1. Essay and Short Answers. Use diagrams wherever possible 1. With the use of a diagram, provide an overview of the general regulation strategies available to a bacterial cell.

More information

Biological Sequence Data Formats

Biological Sequence Data Formats Biological Sequence Data Formats Here we present three standard formats in which biological sequence data (DNA, RNA and protein) can be stored and presented. Raw Sequence: Data without description. FASTA

More information

UGENE Quick Start Guide

UGENE Quick Start Guide Quick Start Guide This document contains a quick introduction to UGENE. For more detailed information, you can find the UGENE User Manual and other special manuals in project website: http://ugene.unipro.ru.

More information

MoBEDAC -- Integrated data and analysis for the indoor and built environment. Folker Meyer Argonne National Laboratory GSC 13 Shenzhen, China

MoBEDAC -- Integrated data and analysis for the indoor and built environment. Folker Meyer Argonne National Laboratory GSC 13 Shenzhen, China MoBEDAC -- Integrated data and analysis for the indoor and built environment Folker Meyer Argonne National Laboratory GSC 13 Shenzhen, China NGS is causing paradigm shift Environmental clone libraries

More information

Regular Expressions and Pattern Matching james.wasmuth@ed.ac.uk

Regular Expressions and Pattern Matching james.wasmuth@ed.ac.uk Regular Expressions and Pattern Matching james.wasmuth@ed.ac.uk Regular Expression (regex): a separate language, allowing the construction of patterns. used in most programming languages. very powerful

More information

The Galaxy workflow. George Magklaras PhD RHCE

The Galaxy workflow. George Magklaras PhD RHCE The Galaxy workflow George Magklaras PhD RHCE Biotechnology Center of Oslo & The Norwegian Center of Molecular Medicine University of Oslo, Norway http://www.biotek.uio.no http://www.ncmm.uio.no http://www.no.embnet.org

More information

4. DNA replication Pages: 979-984 Difficulty: 2 Ans: C Which one of the following statements about enzymes that interact with DNA is true?

4. DNA replication Pages: 979-984 Difficulty: 2 Ans: C Which one of the following statements about enzymes that interact with DNA is true? Chapter 25 DNA Metabolism Multiple Choice Questions 1. DNA replication Page: 977 Difficulty: 2 Ans: C The Meselson-Stahl experiment established that: A) DNA polymerase has a crucial role in DNA synthesis.

More information

Molecular Genetics. RNA, Transcription, & Protein Synthesis

Molecular Genetics. RNA, Transcription, & Protein Synthesis Molecular Genetics RNA, Transcription, & Protein Synthesis Section 1 RNA AND TRANSCRIPTION Objectives Describe the primary functions of RNA Identify how RNA differs from DNA Describe the structure and

More information

MORPHEUS. http://biodev.cea.fr/morpheus/ Prediction of Transcription Factors Binding Sites based on Position Weight Matrix.

MORPHEUS. http://biodev.cea.fr/morpheus/ Prediction of Transcription Factors Binding Sites based on Position Weight Matrix. MORPHEUS http://biodev.cea.fr/morpheus/ Prediction of Transcription Factors Binding Sites based on Position Weight Matrix. Reference: MORPHEUS, a Webtool for Transcripton Factor Binding Analysis Using

More information

Translation Study Guide

Translation Study Guide Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to

More information

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins

More information

SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications

SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications Product Bulletin Sequencing Software SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications Comprehensive reference sequence handling Helps interpret the role of each

More information

Vector NTI Advance 11 Quick Start Guide

Vector NTI Advance 11 Quick Start Guide Vector NTI Advance 11 Quick Start Guide Catalog no. 12605050, 12605099, 12605103 Version 11.0 December 15, 2008 12605022 Published by: Invitrogen Corporation 5791 Van Allen Way Carlsbad, CA 92008 U.S.A.

More information

Organelle Speed Dating Game Instructions and answers for teachers

Organelle Speed Dating Game Instructions and answers for teachers Organelle Speed Dating Game Instructions and answers for teachers These instructions should accompany the OCR resources GCSE (9 1) Combined Science 21 st Century Science B Organelle Speed Dating Game learner

More information

Hidden Markov Models in Bioinformatics. By Máthé Zoltán Kőrösi Zoltán 2006

Hidden Markov Models in Bioinformatics. By Máthé Zoltán Kőrösi Zoltán 2006 Hidden Markov Models in Bioinformatics By Máthé Zoltán Kőrösi Zoltán 2006 Outline Markov Chain HMM (Hidden Markov Model) Hidden Markov Models in Bioinformatics Gene Finding Gene Finding Model Viterbi algorithm

More information

Gene Models & Bed format: What they represent.

Gene Models & Bed format: What they represent. GeneModels&Bedformat:Whattheyrepresent. Gene models are hypotheses about the structure of transcripts produced by a gene. Like all models, they may be correct, partly correct, or entirely wrong. Typically,

More information

Anoto pendocuments. User s Guide

Anoto pendocuments. User s Guide Anoto pendocuments User s Guide Copyright 1997 2009 Anoto AB. All rights reserved. Anoto, Magic Box and the Anoto logotype are trademarks owned by Anoto AB. All other trademarks are the property of their

More information

Guide for Bioinformatics Project Module 3

Guide for Bioinformatics Project Module 3 Structure- Based Evidence and Multiple Sequence Alignment In this module we will revisit some topics we started to look at while performing our BLAST search and looking at the CDD database in the first

More information

ithenticate User Manual

ithenticate User Manual ithenticate User Manual Updated November 20, 2009 Contents Introduction 4 New Users 4 Logging In 4 Resetting Your Password 5 Changing Your Password or Username 6 The ithenticate Account Homepage 7 Main

More information

BactoGeNIE: a large-scale comparative genome visualization for big displays

BactoGeNIE: a large-scale comparative genome visualization for big displays RESEARCH Open Access BactoGeNIE: a large-scale comparative genome visualization for big displays Jillian Aurisano 1*, Khairi Reda 2,3, Andrew Johnson 1, Elisabeta G Marai 1, Jason Leigh 3 From 5th Symposium

More information

Package hoarder. June 30, 2015

Package hoarder. June 30, 2015 Type Package Title Information Retrieval for Genetic Datasets Version 0.1 Date 2015-06-29 Author [aut, cre], Anu Sironen [aut] Package hoarder June 30, 2015 Maintainer Depends

More information

STUDENT PORTAL - TURNITIN

STUDENT PORTAL - TURNITIN Online STUDENT PORTAL - TURNITIN Student Manual Ver. 5 London School of Commerce & School of Business and Law IT Department 2012 1 What is new in STUDENT PORTAL? www.lsclondon.co.uk/student/studentmanual.pdf

More information

CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA

CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA INTRODUCTION DNA : DNA is deoxyribose nucleic acid. It is made up of a base consisting of sugar, phosphate and one nitrogen base.the

More information

DNA Sequencing Overview

DNA Sequencing Overview DNA Sequencing Overview DNA sequencing involves the determination of the sequence of nucleotides in a sample of DNA. It is presently conducted using a modified PCR reaction where both normal and labeled

More information

17 July 2014 WEB-SERVER MANUAL. Contact: Michael Hackenberg (hackenberg@ugr.es)

17 July 2014 WEB-SERVER MANUAL. Contact: Michael Hackenberg (hackenberg@ugr.es) WEB-SERVER MANUAL Contact: Michael Hackenberg (hackenberg@ugr.es) 1 1 Introduction srnabench is a free web-server tool and standalone application for processing small- RNA data obtained from next generation

More information

BUDAPEST: Bioinformatics Utility for Data Analysis of Proteomics using ESTs

BUDAPEST: Bioinformatics Utility for Data Analysis of Proteomics using ESTs BUDAPEST: Bioinformatics Utility for Data Analysis of Proteomics using ESTs Richard J. Edwards 2008. Contents 1. Introduction... 2 1.1. Version...2 1.2. Using this Manual...2 1.3. Why use BUDAPEST?...2

More information

ithenticate User Manual

ithenticate User Manual ithenticate User Manual Version: 2.0.2 Updated March 16, 2012 Contents Introduction 4 New Users 4 Logging In 4 Resetting Your Password 5 Changing Your Password or Username 6 The ithenticate Account Homepage

More information

Protein Synthesis How Genes Become Constituent Molecules

Protein Synthesis How Genes Become Constituent Molecules Protein Synthesis Protein Synthesis How Genes Become Constituent Molecules Mendel and The Idea of Gene What is a Chromosome? A chromosome is a molecule of DNA 50% 50% 1. True 2. False True False Protein

More information

Working with AppleScript

Working with AppleScript Tutorial for Macintosh Working with AppleScript 2016 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) +1.734.769.7249 (elsewhere) +1.734.769.7074

More information

G E N OM I C S S E RV I C ES

G E N OM I C S S E RV I C ES GENOMICS SERVICES THE NEW YORK GENOME CENTER NYGC is an independent non-profit implementing advanced genomic research to improve diagnosis and treatment of serious diseases. capabilities. N E X T- G E

More information

Central Dogma. Lecture 10. Discussing DNA replication. DNA Replication. DNA mutation and repair. Transcription

Central Dogma. Lecture 10. Discussing DNA replication. DNA Replication. DNA mutation and repair. Transcription Central Dogma transcription translation DNA RNA Protein replication Discussing DNA replication (Nucleus of eukaryote, cytoplasm of prokaryote) Recall Replication is semi-conservative and bidirectional

More information

Configuring budget planning for Microsoft Dynamics AX 2012 R2

Configuring budget planning for Microsoft Dynamics AX 2012 R2 Microsoft Dynamics AX 2012 R2 Configuring budget planning for Microsoft Dynamics AX 2012 R2 White Paper This document describes configuration considerations for implementing budget planning. October 2012

More information

BIOL 3200 Spring 2015 DNA Subway and RNA-Seq Data Analysis

BIOL 3200 Spring 2015 DNA Subway and RNA-Seq Data Analysis BIOL 3200 Spring 2015 DNA Subway and RNA-Seq Data Analysis By the end of this lab students should be able to: Describe the uses for each line of the DNA subway program (Red/Yellow/Blue/Green) Describe

More information

Toledo Electronic learning environment Associatie K.U.Leuven. Electronic submission of masterpaper through Toledo Manual for students

Toledo Electronic learning environment Associatie K.U.Leuven. Electronic submission of masterpaper through Toledo Manual for students Toledo Electronic learning environment Associatie K.U.Leuven Electronic submission of masterpaper through Toledo Manual for students Creating a pdf-version of the masterpaper and attachments Intro Possible

More information

Biological Databases and Protein Sequence Analysis

Biological Databases and Protein Sequence Analysis Biological Databases and Protein Sequence Analysis Introduction M. Madan Babu, Center for Biotechnology, Anna University, Chennai 25, India Bioinformatics is the application of Information technology to

More information

XML in IDSS. This overview is divided broadly into two sections, each of which answers one of the following questions:

XML in IDSS. This overview is divided broadly into two sections, each of which answers one of the following questions: XML in IDSS With the release of IDSS for the 2007 reporting year, the Excel data (the original GSUB) format will no longer be used for the submission and storage of HEDIS data. In its place, NCQA will

More information

Nesstar Server Nesstar WebView Version 3.5

Nesstar Server Nesstar WebView Version 3.5 Unlocking data creating knowledge Version 3.5 Release Notes November 2006 Introduction These release notes contain general information about the latest version of the Nesstar products and the new features

More information

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!! DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other

More information

INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B

INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS

More information

Teacher Development Workshop ACCOUNTING GRADE 11

Teacher Development Workshop ACCOUNTING GRADE 11 Teacher Development Workshop ACCOUNTING GRADE 11 CONTENTS PAGE CONTENTS PAGE... 2 PROGRAMME OF ASSESSMENT FOR GRADE 11... 4 EXAMINATION REQUIREMENTS FOR GRADE 11... 5 TEACHING ACCOUNTING GRADE 11... 6

More information

Data search and visualization tools at the Comparative Evolutionary Genomics of Cotton Web resource

Data search and visualization tools at the Comparative Evolutionary Genomics of Cotton Web resource Data search and visualization tools at the Comparative Evolutionary Genomics of Cotton Web resource Alan R. Gingle Andrew H. Paterson Joshua A. Udall Jonathan F. Wendel 1 CEGC project goals set the context

More information

Module 10: Bioinformatics

Module 10: Bioinformatics Module 10: Bioinformatics 1.) Goal: To understand the general approaches for basic in silico (computer) analysis of DNA- and protein sequences. We are going to discuss sequence formatting required prior

More information

Name: Date: Period: DNA Unit: DNA Webquest

Name: Date: Period: DNA Unit: DNA Webquest Name: Date: Period: DNA Unit: DNA Webquest Part 1 History, DNA Structure, DNA Replication DNA History http://www.dnaftb.org/dnaftb/1/concept/index.html Read the text and answer the following questions.

More information

Scottish Qualifications Authority

Scottish Qualifications Authority National Unit specification: general information Unit code: FH2G 12 Superclass: RH Publication date: March 2011 Source: Scottish Qualifications Authority Version: 01 Summary This Unit is a mandatory Unit

More information

HP INTEGRATED ARCHIVE PLATFORM

HP INTEGRATED ARCHIVE PLATFORM You can read the recommendations in the user guide, the technical guide or the installation guide for HP INTEGRATED ARCHIVE PLATFORM. You'll find the answers to all your questions on the HP INTEGRATED

More information

Next Generation Sequencing Data Visualization

Next Generation Sequencing Data Visualization Next Generation Sequencing Data Visualization GBrowse2 from GMOD Andreas Gisel Institute for Biomedical Technologies CNR Bari - Italy GMOD is the Generic Model Organism Database project GMOD is a collection

More information

Syllabus of B.Sc. (Bioinformatics) Subject- Bioinformatics (as one subject) B.Sc. I Year Semester I Paper I: Basic of Bioinformatics 85 marks

Syllabus of B.Sc. (Bioinformatics) Subject- Bioinformatics (as one subject) B.Sc. I Year Semester I Paper I: Basic of Bioinformatics 85 marks Syllabus of B.Sc. (Bioinformatics) Subject- Bioinformatics (as one subject) B.Sc. I Year Semester I Paper I: Basic of Bioinformatics 85 marks Semester II Paper II: Mathematics I 85 marks B.Sc. II Year

More information

Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources

Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources Appendix 2 Molecular Biology Core Curriculum Websites and Other Resources Chapter 1 - The Molecular Basis of Cancer 1. Inside Cancer http://www.insidecancer.org/ From the Dolan DNA Learning Center Cold

More information

Genome Viewing. Module 2. Using Genome Browsers to View Annotation of the Human Genome

Genome Viewing. Module 2. Using Genome Browsers to View Annotation of the Human Genome Module 2 Genome Viewing Using Genome Browsers to View Annotation of the Human Genome Bert Overduin, Ph.D. PANDA Coordination & Outreach EMBL - European Bioinformatics Institute Wellcome Trust Genome Campus

More information

How Sequencing Experiments Fail

How Sequencing Experiments Fail How Sequencing Experiments Fail v1.0 Simon Andrews simon.andrews@babraham.ac.uk Classes of Failure Technical Tracking Library Contamination Biological Interpretation Something went wrong with a machine

More information

Bioinformatics Grid - Enabled Tools For Biologists.

Bioinformatics Grid - Enabled Tools For Biologists. Bioinformatics Grid - Enabled Tools For Biologists. What is Grid-Enabled Tools (GET)? As number of data from the genomics and proteomics experiment increases. Problems arise for the current sequence analysis

More information

Basic attributes of genetic processes (replication, transcription, translation)

Basic attributes of genetic processes (replication, transcription, translation) 411-3 2008 Lecture notes I. First general topic in the course will be mutation (in broadest sense, any change to an organismʼs genetic material). Intimately intertwined with this is the process of DNA

More information