RAST Automated Analysis. What is RAST for?
|
|
- Ariel Bishop
- 7 years ago
- Views:
Transcription
1 RAST Automated Analysis Gordon D. Pusch Fellowship for Interpretation of Genomes What is RAST for? RAST is designed to rapidly call and annotate the genes of a complete or essentially complete prokaryotic genome RAST uses a "Highest Confidence First" assignment propagation strategy based on manually curated subsystems and subsystem-based protein families that automatically guarantees a high degree of assignment consistency. RAST returns an analysis of the genes and subsystems in your genome, as supported by comparative and other forms of evidence. 1
2 The RAST Strategy How does RAST work? RAST applies FIG's "Subsystem Approach" using a "Highest Reliability First" strategy based on FIG's collection of manually curated Subsystems and subsystem-derived Protein Families (FIGfams). RAST's subsystem approach automatically ensures a high degree of annotation consistency. RAST also computes various derived data (sims, BBHs, PCHs, Scenarios, etc.) to support high-throughput genome annotation projects. RAST Strategy - Calling Genes Find RNAs (rrnas, trnas) Find gene candidates for "Special Proteins (selenos, pyrros) Find gene candidates for membership in: "Universal" FIGfam Protein Families FIGfams already seen in the neighboring genomes. FIGfams other than those found in the neighboring genomes. Repair frameshift errors. Promote remaining non-figfam gene candidates: With similarity to genes in neighbors Without similarity to genes in neighbors Examine suspiciously long gaps for possible "missing" genes previously found in neighboring genomes (AKA "Backfilling"). Gene candidates found during all previous stages become the "training set" for the current stage. Gene candidates are only retained if they do not overlap too much. 2
3 I/O - What input formats does RAST Accept? Sequence data in FASTA format (.fna), and GenBank (.gbk) format, uploaded as plain text files with no special characters, etc. RAST does not yet support other upload formats, such as EMBL, GFF3, GTF, etc. (although it can generate output in these formats). RAST will reject any file format that is not plain text, e.g. it will not accept genomes encoded as HTML, PDF, RTF, Microsoft Word, etc. I/O - Genes reannotated or recalled? If you want to keep the original gene coordinates, then you must upload a GenBank file and select the "Keep existing gene calls" option. RAST will then assign functions and perform a subsystem analysis, without recalling the genes of your genome. RAST cannot preserve existing gene calls if FASTA contig data are uploaded, because the FASTA format cannot specify gene locations. 3
4 I/O - Viewing Results You can browse your results and graphically compare them to other genomes using the SEED Viewer You can also download the analysis of your genome in various formats: GenBank EMBL GFF3 GTF SEED genome directory (as tarfile) Input Data Quality What is the poorest quality of data that RAST can handle? We recommend mean contig length >2 kbp, with <1% ambiguity characters. If your assembly quality is worse than this, RAST will most likely fail. It is possible that the metagenomic version of RAST may be able to do something with extremely low quality assemblies; however, MG-RAST is not really designed for this job. 4
5 Input Data Quality RAST is designed for and performs best on complete or essentially complete genomes. Conversely, RAST's performance degrades substantially when presented with only a small fragment of a genome. Even if you are only interested in a few genes in a small region, it is recommend that you upload as much of your genome as possible, and at minimum 100 kbp of contig data. The probability that RAST will abort with errors increases rapidly below the 100 kbp threshold, and is well in excess of 50% below 40 kbp. Input Data Quality What is meant by "essentially complete" genome? We consider a genome to be "essentially complete" at about 99% coverage, since beyond that point, the expected number of missing genes due to sequencing gaps has become less than the expected number of "false negatives" from the genefinder. From Subsystem Analysis standpoint, >99% completeness point of diminishing returns. In terms of sequence redundancy: At least 5x coverage for Sanger Sequencing, or at least 10x coverage using 454. In terms of contig length: At least 70% of the assembled sequence data are in contigs longer than 20 kbp. 5
6 Input Sequence Types Will RAST handle just a plasmid? RAST is not designed to handle only plasmids or small fragments. We recommend that you upload the entire genome, even if you intend to only view your plasmid. (Extension of RAST to plasmids proposed) What about Eukaryotes? No not even small ones, and not even organelles! Currently, RAST requires you to specify whether your genome is a bacterium or archaeon. If you try to submit a eukaryote, RAST will most likely abort with errors. (Extension of RAST to [called!] eukaryotes proposed) Input Sequence Types What about ESTs? RAST is not designed to analyze ESTs, and will most likely abort with errors. You can try submitting EST data to the metagenomic version of RAST but again, it is not really designed for them. What about Metagenomes? As previously mentioned, there is a special metagenomic version of RAST designed specifically to analyze the sort of massive, low-quality datasets typically generated by metagenomics projects. 6
7 FAQs and Common Problems Who do I contact if I have questions about or problems using RAST? All questions or problems regarding RAST should be sent to rast@mcs.anl.gov All questions or problems regarding MG-RAST should be sent to mg-rast@mcs.anl.gov FAQs and Common Problems Will RAST assemble my reads into contigs? No. You will need to assemble your reads into contigs yourself, using some other tool. Why does RAST complain that it can't find the "phylogenetic neighborhood" of my submission? Usually, this is because the submitted sequence data are too small. Experience suggests that RAST needs at least 40 kbp of sequence data to reliably place a submission's phylogenetic neighborhood. (100 kbp is better.) 7
8 FAQs and Common Problems RAST is complaining about "Duplicate contig IDs," but all my contig IDs appear unique to me. What's going on? Your contig IDs may contain "whitespace" characters. The FASTA standard specifies no "whitespace" between the ">" symbol and the contig ID, and that everything after the first "whitespace" character is a "comment," and not part of the identifier. Thus, the first FASTA header below is invalid (no ID, just comment), while the following two will be interpreted as a pair of "duplicate IDs, that are both named "B.": > E. coli main chromosome >B. subtilis main chromosome >B. subtilis plasmid FAQs and Common Problems Why does RAST complain about "invalid characters" in my FASTA input file? Most likely one of two reasons: Your contig sequences contain characters other than the standard IUPAC ambiguity characters [ACGTUMRWSYKBDHVN] or the "vector masking" character "X. (E.g., because you uploaded protein, not DNA sequences.) Your contig file uses nonstandard line terminators, is missing line terminators before or after a record header, or is otherwise malformed in some way. 8
9 FAQs and Common Problems How do I get a more detailed explanation of why my job failed? If the RAST webpage describing the error is insufficient to help you diagnose the problem, please send to <rast@mcs.anl.gov>; we will consult the error-logs for your job, and recommend a solution. FAQs and Common Problems I selected Keep existing gene calls and uploaded a GenBank file, but RAST failed with the cryptic error Zero-size or non-existent FASTA file. What does this mean? Most likely your GenBank file either has: Gene entries but no CDS entries. CDS entries lacking a /translation= field. RAST s GenBank parser expects CDS entries with /translation= fields 9
10 Conclusion RAST is designed to automatically call and annotate complete or near-complete prokaryotic genomes. RAST uses a Highest Confidence First assignment propagation strategy. RAST assignments are based on manually curated subsystems and subsystem-based protein families. RAST s subsystem-based annotations automatically guarantee a high degree of assignment consistency. 10
Bioinformatics Resources at a Glance
Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences
More informationWhen you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want
1 When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want to search other databases as well. There are very
More informationTutorial for Windows and Macintosh. Preparing Your Data for NGS Alignment
Tutorial for Windows and Macintosh Preparing Your Data for NGS Alignment 2015 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) 1.734.769.7249
More informationGenBank, Entrez, & FASTA
GenBank, Entrez, & FASTA Nucleotide Sequence Databases First generation GenBank is a representative example started as sort of a museum to preserve knowledge of a sequence from first discovery great repositories,
More informationSearching Nucleotide Databases
Searching Nucleotide Databases 1 When we search a nucleic acid databases, Mascot always performs a 6 frame translation on the fly. That is, 3 reading frames from the forward strand and 3 reading frames
More informationRETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison
RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the
More informationThe human gene encoding Glucose-6-phosphate dehydrogenase (G6PD) is located on chromosome X in cytogenetic band q28.
Tutorial Module 5 BioMart You will learn about BioMart, a joint project developed and maintained at EBI and OiCR www.biomart.org How to use BioMart to quickly obtain lists of gene information from Ensembl
More informationCD-HIT User s Guide. Last updated: April 5, 2010. http://cd-hit.org http://bioinformatics.org/cd-hit/
CD-HIT User s Guide Last updated: April 5, 2010 http://cd-hit.org http://bioinformatics.org/cd-hit/ Program developed by Weizhong Li s lab at UCSD http://weizhong-lab.ucsd.edu liwz@sdsc.edu 1. Introduction
More informationIntroduction to Genome Annotation
Introduction to Genome Annotation AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT
More informationA Tutorial in Genetic Sequence Classification Tools and Techniques
A Tutorial in Genetic Sequence Classification Tools and Techniques Jake Drew Data Mining CSE 8331 Southern Methodist University jakemdrew@gmail.com www.jakemdrew.com Sequence Characters IUPAC nucleotide
More informationChapter 2. imapper: A web server for the automated analysis and mapping of insertional mutagenesis sequence data against Ensembl genomes
Chapter 2. imapper: A web server for the automated analysis and mapping of insertional mutagenesis sequence data against Ensembl genomes 2.1 Introduction Large-scale insertional mutagenesis screening in
More informationModule 1. Sequence Formats and Retrieval. Charles Steward
The Open Door Workshop Module 1 Sequence Formats and Retrieval Charles Steward 1 Aims Acquaint you with different file formats and associated annotations. Introduce different nucleotide and protein databases.
More informationOverview of Eukaryotic Gene Prediction
Overview of Eukaryotic Gene Prediction CBB 231 / COMPSCI 261 W.H. Majoros What is DNA? Nucleus Chromosome Telomere Centromere Cell Telomere base pairs histones DNA (double helix) DNA is a Double Helix
More informationSequence Formats and Sequence Database Searches. Gloria Rendon SC11 Education June, 2011
Sequence Formats and Sequence Database Searches Gloria Rendon SC11 Education June, 2011 Sequence A is the primary structure of a biological molecule. It is a chain of residues that form a precise linear
More informationVersion 5.0 Release Notes
Version 5.0 Release Notes 2011 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) +1.734.769.7249 (elsewhere) +1.734.769.7074 (fax) www.genecodes.com
More informationDNA Sequence formats
DNA Sequence formats [Plain] [EMBL] [FASTA] [GCG] [GenBank] [IG] [IUPAC] [How Genomatix represents sequence annotation] Plain sequence format A sequence in plain format may contain only IUPAC characters
More informationName Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.
13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both
More informationE. coli plasmid and gene profiling using Next Generation Sequencing
E. coli plasmid and gene profiling using Next Generation Sequencing Jeroen F. J. Laros Leiden Genome Technology Center Department of Human Genetics Center for Human and Clinical Genetics Introduction General
More informationNCBI resources III: GEO and ftp site. Yanbin Yin Spring 2013
NCBI resources III: GEO and ftp site Yanbin Yin Spring 2013 1 Homework assignment 2 Search colon cancer at GEO and find a data Series and perform a GEO2R analysis Write a report (in word or ppt) to include
More informationA Multiple DNA Sequence Translation Tool Incorporating Web Robot and Intelligent Recommendation Techniques
Proceedings of the 2007 WSEAS International Conference on Computer Engineering and Applications, Gold Coast, Australia, January 17-19, 2007 402 A Multiple DNA Sequence Translation Tool Incorporating Web
More informationGenome and DNA Sequence Databases. BME 110/BIOL 181 CompBio Tools Todd Lowe March 31, 2009
Genome and DNA Sequence Databases BME 110/BIOL 181 CompBio Tools Todd Lowe March 31, 2009 Admin Reading: Chapters 1 & 2 Notes available in PDF format on-line (see class calendar page): http://www.soe.ucsc.edu/classes/bme110/spring09/bme110-calendar.html
More informationRESTRICTION DIGESTS Based on a handout originally available at
RESTRICTION DIGESTS Based on a handout originally available at http://genome.wustl.edu/overview/rst_digest_handout_20050127/restrictiondigest_jan2005.html What is a restriction digests? Cloned DNA is cut
More informationDatabases and mapping BWA. Samtools
Databases and mapping BWA Samtools FASTQ, SFF, bax.h5 ACE, FASTG FASTA BAM/SAM GFF, BED GenBank/Embl/DDJB many more File formats FASTQ Output format from Illumina and IonTorrent sequencers. Quality scores:
More informationMultiple Sequence Alignment. Hot Topic 5/24/06 Kim Walker
Multiple Sequence Alignment Hot Topic 5/24/06 Kim Walker Outline Why are Multiple Sequence Alignments useful? What Tools are Available? Brief Introduction to ClustalX Tools to Edit and Add Features to
More informationWhen you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want
1 When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want to search other databases as well. There are very
More informationProSightPC 3.0 Quick Start Guide
ProSightPC 3.0 Quick Start Guide The Thermo ProSightPC 3.0 application is the only proteomics software suite that effectively supports high-mass-accuracy MS/MS experiments performed on LTQ FT and LTQ Orbitrap
More informationA Primer of Genome Science THIRD
A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:
More informationStructure and Function of DNA
Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four
More informationAn Overview of DNA Sequencing
An Overview of DNA Sequencing Prokaryotic DNA Plasmid http://en.wikipedia.org/wiki/image:prokaryote_cell_diagram.svg Eukaryotic DNA http://en.wikipedia.org/wiki/image:plant_cell_structure_svg.svg DNA Structure
More informationLifeScope Genomic Analysis Software 2.5
USER GUIDE LifeScope Genomic Analysis Software 2.5 Graphical User Interface DATA ANALYSIS METHODS AND INTERPRETATION Publication Part Number 4471877 Rev. A Revision Date November 2011 For Research Use
More informationJust the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
More informationCLC Sequence Viewer USER MANUAL
CLC Sequence Viewer USER MANUAL Manual for CLC Sequence Viewer 7.6.1 Windows, Mac OS X and Linux September 3, 2015 This software is for research purposes only. QIAGEN Aarhus A/S Silkeborgvej 2 Prismet
More informationithenticate User Manual
ithenticate User Manual Version: 2.0.8 Updated February 4, 2014 Contents Introduction 4 New Users 4 Logging In 4 Resetting Your Password 5 Changing Your Password or Username 6 The ithenticate Account Homepage
More information1 Mutation and Genetic Change
CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds
More information2.3 Identify rrna sequences in DNA
2.3 Identify rrna sequences in DNA For identifying rrna sequences in DNA we will use rnammer, a program that implements an algorithm designed to find rrna sequences in DNA [5]. The program was made by
More informationYear 8 KS3 Computer Science Homework Booklet
Year 8 KS3 Computer Science Homework Booklet Information for students and parents: Throughout the year your ICT/Computer Science Teacher will set a number of pieces of homework from this booklet. If you
More information4.2.1. What is a contig? 4.2.2. What are the contig assembly programs?
Table of Contents 4.1. DNA Sequencing 4.1.1. Trace Viewer in GCG SeqLab Table. Box. Select the editor mode in the SeqLab main window. Import sequencer trace files from the File menu. Select the trace files
More informationFrequently Asked Questions Next Generation Sequencing
Frequently Asked Questions Next Generation Sequencing Import These Frequently Asked Questions for Next Generation Sequencing are some of the more common questions our customers ask. Questions are divided
More informationLecture Outline. Introduction to Databases. Introduction. Data Formats Sample databases How to text search databases. Shifra Ben-Dor Irit Orr
Introduction to Databases Shifra Ben-Dor Irit Orr Lecture Outline Introduction Data and Database types Database components Data Formats Sample databases How to text search databases What units of information
More informationFrom DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains
Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes
More informationFax via HTTP (POST) Traitel Telecommunications Pty Ltd 2012 Telephone: (61) (2) 9032 2700. Page 1
Fax via HTTP (POST) Page 1 Index: Introduction:...3 Usage:...3 Page 2 Introduction: TraiTel Telecommunications offers several delivery methods for its faxing service. This document will describe the HTTP/POST
More informationData formats and file conversions
Building Excellence in Genomics and Computational Bioscience s Richard Leggett (TGAC) John Walshaw (IFR) Common file formats FASTQ FASTA BAM SAM Raw sequence Alignments MSF EMBL UniProt BED WIG Databases
More informationThe sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized:
Module 3F Protein Synthesis So far in this unit, we have examined: How genes are transmitted from one generation to the next Where genes are located What genes are made of How genes are replicated How
More informationIntroduction to Bioinformatics 3. DNA editing and contig assembly
Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 matthewb@ba.ars.usda.gov
More information2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three
Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,
More informationUsability in bioinformatics mobile applications
Usability in bioinformatics mobile applications what we are working on Noura Chelbah, Sergio Díaz, Óscar Torreño, and myself Juan Falgueras App name Performs Advantajes Dissatvantajes Link The problem
More informationorg.rn.eg.db December 16, 2015 org.rn.egaccnum is an R object that contains mappings between Entrez Gene identifiers and GenBank accession numbers.
org.rn.eg.db December 16, 2015 org.rn.egaccnum Map Entrez Gene identifiers to GenBank Accession Numbers org.rn.egaccnum is an R object that contains mappings between Entrez Gene identifiers and GenBank
More informationModule 3 Questions. 7. Chemotaxis is an example of signal transduction. Explain, with the use of diagrams.
Module 3 Questions Section 1. Essay and Short Answers. Use diagrams wherever possible 1. With the use of a diagram, provide an overview of the general regulation strategies available to a bacterial cell.
More informationBiological Sequence Data Formats
Biological Sequence Data Formats Here we present three standard formats in which biological sequence data (DNA, RNA and protein) can be stored and presented. Raw Sequence: Data without description. FASTA
More informationUGENE Quick Start Guide
Quick Start Guide This document contains a quick introduction to UGENE. For more detailed information, you can find the UGENE User Manual and other special manuals in project website: http://ugene.unipro.ru.
More informationMoBEDAC -- Integrated data and analysis for the indoor and built environment. Folker Meyer Argonne National Laboratory GSC 13 Shenzhen, China
MoBEDAC -- Integrated data and analysis for the indoor and built environment Folker Meyer Argonne National Laboratory GSC 13 Shenzhen, China NGS is causing paradigm shift Environmental clone libraries
More informationRegular Expressions and Pattern Matching james.wasmuth@ed.ac.uk
Regular Expressions and Pattern Matching james.wasmuth@ed.ac.uk Regular Expression (regex): a separate language, allowing the construction of patterns. used in most programming languages. very powerful
More informationThe Galaxy workflow. George Magklaras PhD RHCE
The Galaxy workflow George Magklaras PhD RHCE Biotechnology Center of Oslo & The Norwegian Center of Molecular Medicine University of Oslo, Norway http://www.biotek.uio.no http://www.ncmm.uio.no http://www.no.embnet.org
More information4. DNA replication Pages: 979-984 Difficulty: 2 Ans: C Which one of the following statements about enzymes that interact with DNA is true?
Chapter 25 DNA Metabolism Multiple Choice Questions 1. DNA replication Page: 977 Difficulty: 2 Ans: C The Meselson-Stahl experiment established that: A) DNA polymerase has a crucial role in DNA synthesis.
More informationMolecular Genetics. RNA, Transcription, & Protein Synthesis
Molecular Genetics RNA, Transcription, & Protein Synthesis Section 1 RNA AND TRANSCRIPTION Objectives Describe the primary functions of RNA Identify how RNA differs from DNA Describe the structure and
More informationMORPHEUS. http://biodev.cea.fr/morpheus/ Prediction of Transcription Factors Binding Sites based on Position Weight Matrix.
MORPHEUS http://biodev.cea.fr/morpheus/ Prediction of Transcription Factors Binding Sites based on Position Weight Matrix. Reference: MORPHEUS, a Webtool for Transcripton Factor Binding Analysis Using
More informationTranslation Study Guide
Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to
More informationGenetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )
Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins
More informationSeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications
Product Bulletin Sequencing Software SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications Comprehensive reference sequence handling Helps interpret the role of each
More informationVector NTI Advance 11 Quick Start Guide
Vector NTI Advance 11 Quick Start Guide Catalog no. 12605050, 12605099, 12605103 Version 11.0 December 15, 2008 12605022 Published by: Invitrogen Corporation 5791 Van Allen Way Carlsbad, CA 92008 U.S.A.
More informationOrganelle Speed Dating Game Instructions and answers for teachers
Organelle Speed Dating Game Instructions and answers for teachers These instructions should accompany the OCR resources GCSE (9 1) Combined Science 21 st Century Science B Organelle Speed Dating Game learner
More informationHidden Markov Models in Bioinformatics. By Máthé Zoltán Kőrösi Zoltán 2006
Hidden Markov Models in Bioinformatics By Máthé Zoltán Kőrösi Zoltán 2006 Outline Markov Chain HMM (Hidden Markov Model) Hidden Markov Models in Bioinformatics Gene Finding Gene Finding Model Viterbi algorithm
More informationGene Models & Bed format: What they represent.
GeneModels&Bedformat:Whattheyrepresent. Gene models are hypotheses about the structure of transcripts produced by a gene. Like all models, they may be correct, partly correct, or entirely wrong. Typically,
More informationAnoto pendocuments. User s Guide
Anoto pendocuments User s Guide Copyright 1997 2009 Anoto AB. All rights reserved. Anoto, Magic Box and the Anoto logotype are trademarks owned by Anoto AB. All other trademarks are the property of their
More informationGuide for Bioinformatics Project Module 3
Structure- Based Evidence and Multiple Sequence Alignment In this module we will revisit some topics we started to look at while performing our BLAST search and looking at the CDD database in the first
More informationithenticate User Manual
ithenticate User Manual Updated November 20, 2009 Contents Introduction 4 New Users 4 Logging In 4 Resetting Your Password 5 Changing Your Password or Username 6 The ithenticate Account Homepage 7 Main
More informationBactoGeNIE: a large-scale comparative genome visualization for big displays
RESEARCH Open Access BactoGeNIE: a large-scale comparative genome visualization for big displays Jillian Aurisano 1*, Khairi Reda 2,3, Andrew Johnson 1, Elisabeta G Marai 1, Jason Leigh 3 From 5th Symposium
More informationPackage hoarder. June 30, 2015
Type Package Title Information Retrieval for Genetic Datasets Version 0.1 Date 2015-06-29 Author [aut, cre], Anu Sironen [aut] Package hoarder June 30, 2015 Maintainer Depends
More informationSTUDENT PORTAL - TURNITIN
Online STUDENT PORTAL - TURNITIN Student Manual Ver. 5 London School of Commerce & School of Business and Law IT Department 2012 1 What is new in STUDENT PORTAL? www.lsclondon.co.uk/student/studentmanual.pdf
More informationCHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA
CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA INTRODUCTION DNA : DNA is deoxyribose nucleic acid. It is made up of a base consisting of sugar, phosphate and one nitrogen base.the
More informationDNA Sequencing Overview
DNA Sequencing Overview DNA sequencing involves the determination of the sequence of nucleotides in a sample of DNA. It is presently conducted using a modified PCR reaction where both normal and labeled
More information17 July 2014 WEB-SERVER MANUAL. Contact: Michael Hackenberg (hackenberg@ugr.es)
WEB-SERVER MANUAL Contact: Michael Hackenberg (hackenberg@ugr.es) 1 1 Introduction srnabench is a free web-server tool and standalone application for processing small- RNA data obtained from next generation
More informationBUDAPEST: Bioinformatics Utility for Data Analysis of Proteomics using ESTs
BUDAPEST: Bioinformatics Utility for Data Analysis of Proteomics using ESTs Richard J. Edwards 2008. Contents 1. Introduction... 2 1.1. Version...2 1.2. Using this Manual...2 1.3. Why use BUDAPEST?...2
More informationithenticate User Manual
ithenticate User Manual Version: 2.0.2 Updated March 16, 2012 Contents Introduction 4 New Users 4 Logging In 4 Resetting Your Password 5 Changing Your Password or Username 6 The ithenticate Account Homepage
More informationProtein Synthesis How Genes Become Constituent Molecules
Protein Synthesis Protein Synthesis How Genes Become Constituent Molecules Mendel and The Idea of Gene What is a Chromosome? A chromosome is a molecule of DNA 50% 50% 1. True 2. False True False Protein
More informationWorking with AppleScript
Tutorial for Macintosh Working with AppleScript 2016 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) +1.734.769.7249 (elsewhere) +1.734.769.7074
More informationG E N OM I C S S E RV I C ES
GENOMICS SERVICES THE NEW YORK GENOME CENTER NYGC is an independent non-profit implementing advanced genomic research to improve diagnosis and treatment of serious diseases. capabilities. N E X T- G E
More informationCentral Dogma. Lecture 10. Discussing DNA replication. DNA Replication. DNA mutation and repair. Transcription
Central Dogma transcription translation DNA RNA Protein replication Discussing DNA replication (Nucleus of eukaryote, cytoplasm of prokaryote) Recall Replication is semi-conservative and bidirectional
More informationConfiguring budget planning for Microsoft Dynamics AX 2012 R2
Microsoft Dynamics AX 2012 R2 Configuring budget planning for Microsoft Dynamics AX 2012 R2 White Paper This document describes configuration considerations for implementing budget planning. October 2012
More informationBIOL 3200 Spring 2015 DNA Subway and RNA-Seq Data Analysis
BIOL 3200 Spring 2015 DNA Subway and RNA-Seq Data Analysis By the end of this lab students should be able to: Describe the uses for each line of the DNA subway program (Red/Yellow/Blue/Green) Describe
More informationToledo Electronic learning environment Associatie K.U.Leuven. Electronic submission of masterpaper through Toledo Manual for students
Toledo Electronic learning environment Associatie K.U.Leuven Electronic submission of masterpaper through Toledo Manual for students Creating a pdf-version of the masterpaper and attachments Intro Possible
More informationBiological Databases and Protein Sequence Analysis
Biological Databases and Protein Sequence Analysis Introduction M. Madan Babu, Center for Biotechnology, Anna University, Chennai 25, India Bioinformatics is the application of Information technology to
More informationXML in IDSS. This overview is divided broadly into two sections, each of which answers one of the following questions:
XML in IDSS With the release of IDSS for the 2007 reporting year, the Excel data (the original GSUB) format will no longer be used for the submission and storage of HEDIS data. In its place, NCQA will
More informationNesstar Server Nesstar WebView Version 3.5
Unlocking data creating knowledge Version 3.5 Release Notes November 2006 Introduction These release notes contain general information about the latest version of the Nesstar products and the new features
More informationDNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!
DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other
More informationINTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS
More informationTeacher Development Workshop ACCOUNTING GRADE 11
Teacher Development Workshop ACCOUNTING GRADE 11 CONTENTS PAGE CONTENTS PAGE... 2 PROGRAMME OF ASSESSMENT FOR GRADE 11... 4 EXAMINATION REQUIREMENTS FOR GRADE 11... 5 TEACHING ACCOUNTING GRADE 11... 6
More informationData search and visualization tools at the Comparative Evolutionary Genomics of Cotton Web resource
Data search and visualization tools at the Comparative Evolutionary Genomics of Cotton Web resource Alan R. Gingle Andrew H. Paterson Joshua A. Udall Jonathan F. Wendel 1 CEGC project goals set the context
More informationModule 10: Bioinformatics
Module 10: Bioinformatics 1.) Goal: To understand the general approaches for basic in silico (computer) analysis of DNA- and protein sequences. We are going to discuss sequence formatting required prior
More informationName: Date: Period: DNA Unit: DNA Webquest
Name: Date: Period: DNA Unit: DNA Webquest Part 1 History, DNA Structure, DNA Replication DNA History http://www.dnaftb.org/dnaftb/1/concept/index.html Read the text and answer the following questions.
More informationScottish Qualifications Authority
National Unit specification: general information Unit code: FH2G 12 Superclass: RH Publication date: March 2011 Source: Scottish Qualifications Authority Version: 01 Summary This Unit is a mandatory Unit
More informationHP INTEGRATED ARCHIVE PLATFORM
You can read the recommendations in the user guide, the technical guide or the installation guide for HP INTEGRATED ARCHIVE PLATFORM. You'll find the answers to all your questions on the HP INTEGRATED
More informationNext Generation Sequencing Data Visualization
Next Generation Sequencing Data Visualization GBrowse2 from GMOD Andreas Gisel Institute for Biomedical Technologies CNR Bari - Italy GMOD is the Generic Model Organism Database project GMOD is a collection
More informationSyllabus of B.Sc. (Bioinformatics) Subject- Bioinformatics (as one subject) B.Sc. I Year Semester I Paper I: Basic of Bioinformatics 85 marks
Syllabus of B.Sc. (Bioinformatics) Subject- Bioinformatics (as one subject) B.Sc. I Year Semester I Paper I: Basic of Bioinformatics 85 marks Semester II Paper II: Mathematics I 85 marks B.Sc. II Year
More informationAppendix 2 Molecular Biology Core Curriculum. Websites and Other Resources
Appendix 2 Molecular Biology Core Curriculum Websites and Other Resources Chapter 1 - The Molecular Basis of Cancer 1. Inside Cancer http://www.insidecancer.org/ From the Dolan DNA Learning Center Cold
More informationGenome Viewing. Module 2. Using Genome Browsers to View Annotation of the Human Genome
Module 2 Genome Viewing Using Genome Browsers to View Annotation of the Human Genome Bert Overduin, Ph.D. PANDA Coordination & Outreach EMBL - European Bioinformatics Institute Wellcome Trust Genome Campus
More informationHow Sequencing Experiments Fail
How Sequencing Experiments Fail v1.0 Simon Andrews simon.andrews@babraham.ac.uk Classes of Failure Technical Tracking Library Contamination Biological Interpretation Something went wrong with a machine
More informationBioinformatics Grid - Enabled Tools For Biologists.
Bioinformatics Grid - Enabled Tools For Biologists. What is Grid-Enabled Tools (GET)? As number of data from the genomics and proteomics experiment increases. Problems arise for the current sequence analysis
More informationBasic attributes of genetic processes (replication, transcription, translation)
411-3 2008 Lecture notes I. First general topic in the course will be mutation (in broadest sense, any change to an organismʼs genetic material). Intimately intertwined with this is the process of DNA
More information