Molecular analyses of EGFR: mutation and amplification detection Petra Nederlof, Moleculaire Pathologie NKI Amsterdam Henrique Ruijter, Ivon Tielen, Lucie Boerrigter, Aafke Ariaens
Outline presentation Molecular assays to detect EGFR activating mutations KRAS mutations EGFR gene amplification NKI approach, results, validation Technical issues Other approaches
COSMIC database
EGFR COSMIC database AA subst. Complex mutations In frame deletions
Mutation analysis EGFR Type of mutations Point mutations activating in exons 18-21 Deletions in exon 19 methods Direct sequencing fragment analysis Melting analysis Real Time PCR Assays In-house tests Commercial kits
Current protocol NKI EGFR CISH KRAS sequencing Codon 12 <=60% tumor cells >=60 tumor cells Fragment analysis exon 19 Direct sequencing Exon 18,19,20,21 Enrichment Exon 21 Sequence analysis
Sensitivity Limiting factors material Tumor cell percentage may be low Paraffin material: cross-linked and fragmented DNA Biopsies / cytological preps Limited amount of material Limiting factors assays
Direct sequencing PCR fragments preferably <250 bp Complete sequence readable in two directions (forward and reverse) Compare with wt sequence same run Check for SNP s Check COSMIC database
Primer_ID Naam F/R Label Amplificatie Sequentie 5' - 3' 2244 2244-EGFRexon18F F Geen Exon 18 GCT GAG GTG ACC CTT GTC TC 2245 2245-EGFRexon18R R Geen Exon 18 CTC CCC ACC AGA CCA TGA 2231 2231-EGFRex19F F Geen Exon 19 CAT GTG GCA CCA TCT CAC A 2232 2232-EGFRex19R R Geen Exon 19 CAG CTG CCA GAC ATG AGA AA 2229 2229-EGFRexon20F F Geen Exon 20 CAT GCG TCT TCA CCT GGA A 2230 2230-EGFRexon20R R Geen Exon 20 AGC AGG TAC TGG GAG CCA AT 2295 2295-EGFRex21A-F F Geen Exon 21 GAA TTC GGA TGC AGA GCT TC 2296 2296-EGFRexon21A-R R Geen Exon 21 TGC CTC CTT CTG CAT GGT AT 2297 2297-EGFRex21B-F F Geen Exon 21 GAG GAC CGT CGC TTG GTG 2298 2298-EGFRexon21B-R R Geen Exon 21 ATC CTC CCC TGC ATG TGT TA 2237 2237-EGFRex19F-FAM F FAM Exon19 6CATGTGGCACCATCTCACA 2242 2242-EGFRex19R R Geen Exon 19 GTGTCTTCAGCTGCCAGACATGAGAAA 9700 /mpdiag/egfr 4 min 94 C 1 cyclus 0.5 min 94 C 35 cycli 1.00 min 58 C 1.00 min 72 C 7 min 72 C 1 cyclus soak temp 15 C Size of PCR fragments Exon 18 137 bp Exon 19 230 bp Exon 20 248 bp Exon 21A 220 bp Exon 21B 238 bp Sequence analysis not with M13-tails, but with same primers as initial PCR Results in cleaner sequences
Wt EGFR exon 18 sequence paraffin
Wt EGFR exon 18 sequence paraffin
Exon 19 del18 sequence Female, 64y, PA diagnosis: NSCLC Paraffin embedded biopsy
Exon 19 del18 sequence Female, 64y, PA diagnosis: NSCLC Paraffin embedded biopsy
Exon 19 del18 sequence Female, 64y, PA diagnosis: NSCLC Paraffin embedded biopsy 18 nucl
Exon 19 del15 deletion 15 nucl 15 nucl Tumor cell percentage 70% KRAS: no mutation
Cells from pleural fluid Complex mutation: 9bp deletion and point mutation
Point mutation exon 21 Exon 21A R Exon 21B F
Problems Tumor cell percentage <60% Complex mutations Difficult to determine exact location of aberration (inframe?) Some exons to large for 1 PCR reaction Split exon 21 in two fragments with overlap Point mutations more difficult to detect than deletions Not always Forward and Reverse good sequence
Rare but recurrent problems extra peaks may obscure mutation Artifact sequencer?
Rare but recurrent problems extra peaks may obscure mutation Artifact sequencer?
Zelden zo slecht! Kan komen door slechte DNA kwaliteit, Meestal niet te verklaren (slechts 1 exon 1 richting slecht)
What to do in case of low tumor cell % 70% no problems <60% sometimes difficult Sensitivity of direct sequencing enough? Alternatives? Fragment analysis of exon 19 deletions Use restriction sites in wt and mutants Is that an option? Advantages/disadvantages
Most common mutations In COSMIC database N=11266 cases 2803 mutated cases 1063 p.l858r exon 21 (38%) 1161 deletions in exon 19 (42%) Together 80% of mutations
Fragment analysis FAM WT EGFR Exon 19 wt FAM MUT EGFR Exon 19 wt Primers round common deletions in exon 19 Size of the deletion exact position not known Sensitive: 20% tumor cell percentage detectable del 15 wt del 15 del 18
exon 21 c.2573 T>G p.l858r Restriction site in wt, not in mutant TGGCCA wt GGGCCA mut MscI Fragment analysis Enrichment for mutant
Enrichment for mutation exon 21 c.2573 T>G p.l858r 1st PCR exon 21 Cut wt sequence with restriction enzyme MscI mutant is not cut 2nd PCR exon 21 Analyze on agarose gel cut/uncut PCR products Confirm by sequence analysis both cut and uncut product TGGCCA wt GGGCCA mut MscI
Sensitivity assay Un cut cut 70% 30% Mix tumor DNA mut (estimated 70% tumor cells) with wt DNA 70%, 60%, 50%, 40%, 30%, 10%, 5% Direct sequencing 5%
PCR RFLP based analysis EGFR exon 21 L858R Sau 96I Sau 96I Exon 21 CGG PCR FAM Digest with SAu96I 180 bp (wild type) or 91+180 bp (mutant) WT sample H3255 L858R
PCR RFLP based analysis EGFR exon 20 T790M FAM 101 bp (wild type) 92 bp (mutant) 101 92 101 WT sample H1975 T790M
KRAS mutation analysis Methods Direct sequencing codon 12/13 Sensitivity Tested on tumors with different tumor cell % Mutation determined earlier with sensitive radioactive dot-blot assay Sensitivity higher than with EGFR mutations caused by loss of wt allel in tumor?
KRAS sensitivity Wt control 10% tumor cells 15% tumor cells 20% tumor cells 50% tumor cells 60% tumor cells
Material NKI 2005-2007 Total 182 Biopsy 101 (56%) Cytol. Prep 15 (8%) Resection/excision 66 (36%) Female 121 (67%) 6 mutations EGFR
NKI 2005-2007 166 tumors 37 EGFR mutations detected 24 female with mutation (24/113 =21%) 13 male with mutation (13/53 =25%) 24/37 =65% of mutants are female!!
KRAS and EGFR analyses 2006 27 cases KRAS & EGFR mut analyses 1 no results 3 mutation detected EGFR (11%) 23 no mutation EGFR Conclusion no mut KRAS 17 no mut KRAS 6 mut KRAS 6/27 KRAS mutation (22%) all without EGFR mut KRAS mut en EGFR mut never together
KRAS en EGFR analyses 2007 49 cases KRAS & EGFR mut analyses 8 no results 7 mutation EGFR (14%) no mut KRAS 34 no mutation EGFR 24 no mut KRAS 10 mut KRAS Conclusion 10/49 KRAS mutation (20%) no EGFR mut KRAS mut en EGFR mut never seen together
EGFR NKI EGFR mutations no mut exon 18 exon 19 exon 19 exon 21 exon 20 exon 21 2005 60% 6% 17% 0% 3% 14% 35 2006 88% 0% 5% 0% 0% 7% 42 2007 80% 0% 14% 1% 1% 4% 85 totaal 126 2 20 1 2 11 162 2007 KRAS mut KRAS geen MUT N EGFR mut 0% 100% 7 EGFR geen mut 29% 71% 34 6x CISH EGFR 1x amplificatie (7spots) N
Other approaches
Real Time PCR assay DXS EGFR29 Mutation Test kit detects 1% mutant in a background of wt genomic DNA 19 deletions in exon 19 Price 3360,-/20 samples ( 168/sample)
Single Stranded Conformation Polymorphism (SSCP) Wild Type Mutant SSCP for K-ras G12C WT WT G12A
DHPLC WAVE system transgenomics Fragment collection followed by direct sequencing
summary Advantage of sequencing strategy All mutations can be detected if tumor cell percentage is adequate Advantage of fragment analysis Sensitive but: only known mutations and limited by availability of specific enzymes Advantage other techniques High sensitivity but frequently confirmation by sequencing needed Expensive/special equipment required Kits may be expensive
CISH for EGFR amplification our still limited experience! Kit tested: Zytovision Zyto dot SPEC EGFR probe Similar system as HER2 CISH kit
Method DAB Staining in automatic stainer used for IHC peroxidase Critical step, needs optimizing 1 2 3 5 4
Method DAB 5μ paraffin section Probe: Digoxigenylated(Dig)-EGFR peroxidase 1 2 3 5 4
F:\2008\06-13246 EGFR CISH 20x ampl contrast.jpg
Pro s and Con s test IHC FISH CISH PRO easy low costs 2 easy read-out colorful Normal microscope routine CON sensitivity varies misses low amplification special microscope Costly, deterioration of material by decay Not yet Costs 50
Questions Correlation IHC-CISH? Are EGFR genes with activating mutations in kinase domain also amplified? Do both amplified and mutated EGFR tumors react similar to iressa therapy? Does resistance occur in both groups? Is it relevant to be able to detect subpopulations in tumors (1%) with activating mutations? Are KRAS and EGFR mutations mutually exclusive?
QAQC Exchange of material between labs needed to check efficiency of techniques used