Tools for human molecular diagnosis. Joris Vermeesch

Size: px
Start display at page:

Download "Tools for human molecular diagnosis. Joris Vermeesch"

Transcription

1 Tools for human molecular diagnosis Joris Vermeesch

2 Chromosome > DNA

3 Genetic Code

4 Effect of point mutations/polymorphisms

5 Effect of deletions/insertions

6 Effect of splicing mutations IVS2-2A>G Normal splice site Exon 1 Exon 2...CCCCACATAgtaagg......gagtagCCATTCCACAGATTTT......CCCCACATAgtaagg... Cryptic splice site...gagtggccattccacagatttt...

7 Genetic testing 1 gene <> multiple genes Molecular testing 1 disease 1 (single) mutation 1 disease 1 gene different diseases 1 (single) gene (un)known defect karyotyping 1 disease few genes 1 disease 1 chromosomal anomaly different diseases many genes different diseases different anomalies Molecular cytogenetic testing total genome Cytogenetics

8 How do we test which tools to use? Mutation-specific test - Restriction enzyme digestion - Southern blot - Dot blot / reverse dot blot - PCR hybridization - PCR applications PCR/fragment sizing MLPA: large deletion/duplications Mutation detection - Mutation scanning o SSCP o DGGE o DHPLC o HRM-CA - Sequencing o Sanger sequencing o Next Generation Sequencing

9 How do we test which tools to use? Mutation-specific test - Restriction enzyme digestion - Southern blot - Dot blot / reverse dot blot - PCR hybridization - PCR applications PCR/fragment sizing MLPA: large deletion/duplications Mutation detection - Mutation scanning o SSCP o DGGE o DHPLC o HRM-CA - Sequencing o Sanger sequencing o Next Generation Sequencing

10 Factor V (Leiden mutatie 1691A) Mnl I 5 - GGCGAGG GGCAAGG 3 Arg(R) to Gln(Q) at position

11 How do we test which tools to use? Mutation-specific test - Restriction enzyme digestion - Southern blot - Dot blot / reverse dot blot - PCR hybridization - PCR applications PCR/fragment sizing MLPA: large deletion/duplications Mutation detection - Mutation scanning o SSCP o DGGE o DHPLC o HRM-CA - Sequencing o Sanger sequencing o Next Generation Sequencing

12 Southern blot

13 Southern blot FMR

14 How do we test which tools to use? Mutation-specific test - Restriction enzyme digestion - Southern blot - Dot blot / reverse dot blot - PCR hybridization - PCR applications PCR/fragment sizing MLPA: large deletion/duplications Mutation detection - Mutation scanning o SSCP o DGGE o DHPLC o HRM-CA - Sequencing o Sanger sequencing o Next Generation Sequencing

15 Distribution of Cystic Fibrosis Mutations a 6b a 14b a 17b ' 3' Missense AA deletion Nonsense Frameshift Splice site Amino acid Variation Total Membrane spanning ATP-binding R-domain Membrane spanning ATP-binding (Data from the CF Genetic Analysis Consortium- July, 1995)

16 F508del (ex.10) 72.5 % G542X (ex.11) 5.5 % N1303K (ex.21) 3.5 % G>A (in. 10) 2.5 % W1282X (ex.20) 1.0 % G551D (ex.10) 0.5 % R553X (ex.10) 0.5 % I 507del (ex.10) 0.5 %

17 Reverse Dot Blot principe chromogeen paars precipitaat alkalisch fosfatase streptavidine biotine geamplificeerd DNA DNA-probe membraan

18

19 How do we test which tools to use? Mutation-specific test - Restriction enzyme digestion - Southern blot - Dot blot / reverse dot blot - PCR hybridization - PCR applications PCR/fragment sizing MLPA: large deletion/duplications Mutation detection - Mutation scanning o SSCP o DGGE o DHPLC o HRM-CA - Sequencing o Sanger sequencing o Next Generation Sequencing

20 TaqMan

21

22 TaqMan output

23 Molecular beacon

24 FRET (Fluorescence Resonance Energy Transfer) Principe

25 FRET (Fluorescence Resonance Energy Transfer) Principle

26 FRET (Fluorescence Resonance Energy Transfer) Principle

27

28 How do we test which tools to use? Mutation-specific test - Restriction enzyme digestion - Southern blot - Dot blot / reverse dot blot - PCR hybridization - PCR applications PCR/fragment sizing MLPA: large deletion/duplications Mutation detection - Mutation scanning o SSCP o DGGE o DHPLC o HRM-CA - Sequencing o Sanger sequencing o Next Generation Sequencing

29

30 MLPA: Multiplex Ligation-dependent Probe Amplification

31 1,2 1 0,8 0,6 0,4 0,2 0 MLH1 exon 1 MSH2 exon 1 MLH1 exon 2 MSH2 exon 2 MLH1 exon 3 MSH2 exon 3 MLH1 exon 4 MSH2 exon 4 MLH1 exon 5 MSH2 exon 5 MLH1 exon 6 MSH2 exon 6 MLH1 exon 7 MSH2 exon 7 MLH1 exon 8 MSH2 exon 8 MLH1 exon 9 MSH2 exon 9 MLH1 exon 10 MSH2 exon 10 MLH1 exon 11 MSH2 exon 11 MLH1 exon 12 MSH2 exon 12 MLH1 exon 13 MSH2 exon 13 MLH1 exon 14 MSH2 exon 14 MLH1 exon 15 MSH2 exon 15 MLH1 exon 16 MSH2 exon 16 MLH1 exon 17 MLH1 exon 18 MLH1 exon 19 MLPA MSL1&2

32 MLPA - SMA normal patient - SMA

33 How do we test which tools to use? Mutation-specific test - Restriction enzyme digestion - Southern blot - Dot blot / reverse dot blot - PCR hybridization - PCR applications PCR/fragment sizing MLPA: large deletion/duplications Mutation detection - Mutation scanning o SSCP o DGGE o DHPLC o HRM-CA - Sequencing o Sanger sequencing o Next Generation Sequencing

34 SSCP: Single strand conformation polymorphism

35 DGGE: Denaturing gradient gel electrophoresis Denaturant (Formamide/Urea) 0% 100% Separation Based on Differences in Nucleotide Sequence (G+C content) and Melting Characteristics Partially melted Single strands Or with GC-clamp Electrophoresis Double strand

36 DHPLC: Denaturing high performance liquid chromatography wild type mutant heteroduplexes homoduplexes A T G C A C G T A T G C

37 HRM: High resolution melting curve analysis wild type mutant heteroduplexes homoduplexes A T G C A C G T A T G C

38 How do we test which tools to use? Mutation-specific test - Restriction enzyme digestion - Southern blot - Dot blot / reverse dot blot - PCR hybridization - PCR applications PCR/fragment sizing MLPA: large deletion/duplications Mutation detection - Mutation scanning o SSCP o DGGE o DHPLC o HRM-CA - Sequencing o Sanger sequencing o Next Generation Sequencing

39 Sanger sequencing

40 Sequencing - ddntp

41 Sanger sequencing universal primers e1f 5 UTR e2f e3af e3bf e4/5f e6f Exon 1 Exon 2 Exon 3 Exons 4/5Exon 6 500bp 3 UTR 18bp M13-F e1r e2r e3ar e3br e4/5r e6r A30V intron 1 V L A Q D Y Q Q intron 2 ctagctattacgctactagc ctttccccag. gtc CTG GCT CAG gac tac cag cag.gtgggtatgc ctagctattacgctactagc 198C>T 18bp M13-R

42 Asp 90 G C T G A C A A A Asp/Ala 90 G C T G C C A A A A Controle Patiënt

43 Hereditarybreastand ovariancancer BRCA1 /BRCA2 BRCA1(on chromosome 17) BRCA2(on chromosome 13) 5.6 kb, 1863 aa - Affected patients identify the disease-causing mutation in the family - Dominantly inherited heterozygous mutations - Scattered thoughout the genes whole coding regions analyzed - Mostly truncating(nonsense, frameshifts(indels)) 10.3 kb, 3418 aa

44

45 Apostolou P, 2013

46 100 families

47 Aangepast van Fackenthal JD and Olopade OI, Nature Rev Cancer (2007) 185delAG IVS5+3A>G c.2197del5 c.2359dup c.3481del11 c.5266dupc IVS6+1G>A c.5213del4 c.6270del2 c.6275del2 c.8243g> A Exon19d el c.8904del

48

49 Vroeger Per patiënt= 110 PCR stalen 220 sequencing reacties Elke dag= 5 PCR platen 10 sequencing platen

50

51 BRCA MASTR v2.0 (Titanium) : 94 amplicons ng per multiplex PCR reaction

52

53 ROI Extra Specifieke primer Universeel deel Index 1 Complementair aan seq primer

54

55 Genetictesting Molecular testing 1 disease 1 (single) mutation 1 disease 1 gene different diseases 1 (single) gene (un)known defect karyotyping Cytogenetics 1 disease few genes 1 disease 1 chromosomal anomaly different diseases many genes different diseases different anomalies Molecular cytogenetic testing total genome

56

57

58 Projecten in het laboratorium Massive Parallel Sequencing (Illumina HiSeq ) Read Alignment, Mapping, Variant Calling and Annotation (Annovar) Variant Filtering (trio analysis) + CNV database mining IlluminaLibrary Prep and Exome Enrichment (NimbleGen) DE NOVO VARIANTS IN KNOWN MC GENES (8 PTS) DIAGNOSTIC VALUE e.g. CASK, CREBBP, TUBG1, KIF11 SYNDROMIC SPORADIC MC COHORT (19/20 trios) DE NOVO VARIANTS IN CANDIDATE MC GENES (7 PTS) e.g. LMNB1, SEMA4B, PKDL1, SNX21, SBSPON, FAT4, CCDC51 DE NOVO MUTATIONS TESTING IN ZEBRAFISH NO CANDIDATE DE NOVO VARIANTS (3 PTS)

59 Identification of causative mutations in rare disorders

60 Diagnostische exoom sequencing 100 patients 79 de novo mutations Diagnostic yield: 16% 51patients 87 de novo mutations Diagnostic yield: 45-55%

61 Limitations?! Exome is not entirely covered Limited to exons (and flanking regions) Impossible to detect (deep) intronic mutations Not quantitative Impossible to detect deletions or duplications Thousands of SNPs and variants

62 Gen en variant prioritisatie om causale SNPs te detecteren. Sifrim et al., Nature Methods, 2013

63 Volledige genoom analyse

64 Volledige genoom analyse 1.58 exomic variants/individual/generation Diagnostic yield: 62%

65 Wat met genetica in de maatschappij?

Molecular analyses of EGFR: mutation and amplification detection

Molecular analyses of EGFR: mutation and amplification detection Molecular analyses of EGFR: mutation and amplification detection Petra Nederlof, Moleculaire Pathologie NKI Amsterdam Henrique Ruijter, Ivon Tielen, Lucie Boerrigter, Aafke Ariaens Outline presentation

More information

Sequencing and microarrays for genome analysis: complementary rather than competing?

Sequencing and microarrays for genome analysis: complementary rather than competing? Sequencing and microarrays for genome analysis: complementary rather than competing? Simon Hughes, Richard Capper, Sandra Lam and Nicole Sparkes Introduction The human genome is comprised of more than

More information

Recombinant DNA Technology

Recombinant DNA Technology Recombinant DNA Technology Stephen B. Gruber, MD, PhD Division of Molecular Medicine and Genetics November 4, 2002 Learning Objectives Know the basics of gene structure, function and regulation. Be familiar

More information

Gene mutation and molecular medicine Chapter 15

Gene mutation and molecular medicine Chapter 15 Gene mutation and molecular medicine Chapter 15 Lecture Objectives What Are Mutations? How Are DNA Molecules and Mutations Analyzed? How Do Defective Proteins Lead to Diseases? What DNA Changes Lead to

More information

Automated DNA sequencing 20/12/2009. Next Generation Sequencing

Automated DNA sequencing 20/12/2009. Next Generation Sequencing DNA sequencing the beginnings Ghent University (Fiers et al) pioneers sequencing first complete gene (1972) first complete genome (1976) Next Generation Sequencing Fred Sanger develops dideoxy sequencing

More information

Disease gene identification with exome sequencing

Disease gene identification with exome sequencing Disease gene identification with exome sequencing Christian Gilissen Dept. of Human Genetics Radboud University Nijmegen Medical Centre [email protected] Contents Infrastructure Exome sequencing

More information

MRC-Holland MLPA. Related SALSA MLPA probemix P091 CFTR: contains probes for the CFTR gene, related to chronic pancreatitis.

MRC-Holland MLPA. Related SALSA MLPA probemix P091 CFTR: contains probes for the CFTR gene, related to chronic pancreatitis. SALSA MLPA probemix P242-B3 Pancreatitis Lot B3-0215. As compared to version B2 (lot B2-1212), one flanking probe has been removed and four reference probes have been replaced. Hereditary Pancreatitis

More information

Becker Muscular Dystrophy

Becker Muscular Dystrophy Muscular Dystrophy A Case Study of Positional Cloning Described by Benjamin Duchenne (1868) X-linked recessive disease causing severe muscular degeneration. 100 % penetrance X d Y affected male Frequency

More information

Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research. March 17, 2011 Rendez-Vous Séquençage

Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research. March 17, 2011 Rendez-Vous Séquençage Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research March 17, 2011 Rendez-Vous Séquençage Presentation Overview Core Technology Review Sequence Enrichment Application

More information

July 7th 2009 DNA sequencing

July 7th 2009 DNA sequencing July 7th 2009 DNA sequencing Overview Sequencing technologies Sequencing strategies Sample preparation Sequencing instruments at MPI EVA 2 x 5 x ABI 3730/3730xl 454 FLX Titanium Illumina Genome Analyzer

More information

Data Analysis for Ion Torrent Sequencing

Data Analysis for Ion Torrent Sequencing IFU022 v140202 Research Use Only Instructions For Use Part III Data Analysis for Ion Torrent Sequencing MANUFACTURER: Multiplicom N.V. Galileilaan 18 2845 Niel Belgium Revision date: August 21, 2014 Page

More information

Single Nucleotide Polymorphisms (SNPs)

Single Nucleotide Polymorphisms (SNPs) Single Nucleotide Polymorphisms (SNPs) Additional Markers 13 core STR loci Obtain further information from additional markers: Y STRs Separating male samples Mitochondrial DNA Working with extremely degraded

More information

Technical Note. Roche Applied Science. No. LC 18/2004. Assay Formats for Use in Real-Time PCR

Technical Note. Roche Applied Science. No. LC 18/2004. Assay Formats for Use in Real-Time PCR Roche Applied Science Technical Note No. LC 18/2004 Purpose of this Note Assay Formats for Use in Real-Time PCR The LightCycler Instrument uses several detection channels to monitor the amplification of

More information

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Genetic engineering: humans Gene replacement therapy or gene therapy Many technical and ethical issues implications for gene pool for germ-line gene therapy what traits constitute disease rather than just

More information

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing Technology and applications 10/1/2015 Jeroen Van Houdt - Genomics Core - KU Leuven - UZ Leuven 1 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977

More information

1 Mutation and Genetic Change

1 Mutation and Genetic Change CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds

More information

Validation parameters: An introduction to measures of

Validation parameters: An introduction to measures of Validation parameters: An introduction to measures of test accuracy Types of tests All tests are fundamentally quantitative Sometimes we use the quantitative result directly However, it is often necessary

More information

European registered Clinical Laboratory Geneticist (ErCLG) Core curriculum

European registered Clinical Laboratory Geneticist (ErCLG) Core curriculum (February 2015; updated from paper issued by the European Society of Human Genetics Ad hoc committee for the accreditation of clinical laboratory geneticists, published in February 2012) Speciality Profile

More information

BRCA and Breast/Ovarian Cancer -- Analytic Validity Version 2003-6 2-1

BRCA and Breast/Ovarian Cancer -- Analytic Validity Version 2003-6 2-1 ANALYTIC VALIDITY Question 8: Is the test qualitative or quantitative? Question 9: How often is a test positive when a mutation is present (analytic sensitivity)? Question 10: How often is the test negative

More information

The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics

The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics The GS Junior System The Power of Next-Generation Sequencing on Your Benchtop Proven technology: Uses the same long

More information

MRC-Holland MLPA. Description version 12; 02-12-2012

MRC-Holland MLPA. Description version 12; 02-12-2012 SALSA MLPA probemix P083-C1 CDH1 Lot C1-0211. As compared to previous B1 version, new in version C1: two CDH1 probes and several reference probes have been replaced/added. In addition, the 88 and 96nt

More information

NEIGE. diagnosis In oncogenetics. Nicolas Sévenet 02 juillet 2012. [email protected]

NEIGE. diagnosis In oncogenetics. Nicolas Sévenet 02 juillet 2012. n.sevenet@bordeaux.unicancer.fr NEIGE g for molecular NExt g generation sequencing diagnosis In oncogenetics Nicolas Sévenet 02 juillet 2012 [email protected] t@b d i f Reports 15 years Next generation sequencing 06/2011

More information

Introduction to NGS data analysis

Introduction to NGS data analysis Introduction to NGS data analysis Jeroen F. J. Laros Leiden Genome Technology Center Department of Human Genetics Center for Human and Clinical Genetics Sequencing Illumina platforms Characteristics: High

More information

Next generation DNA sequencing technologies. theory & prac-ce

Next generation DNA sequencing technologies. theory & prac-ce Next generation DNA sequencing technologies theory & prac-ce Outline Next- Genera-on sequencing (NGS) technologies overview NGS applica-ons NGS workflow: data collec-on and processing the exome sequencing

More information

Targeted. sequencing solutions. Accurate, scalable, fast TARGETED

Targeted. sequencing solutions. Accurate, scalable, fast TARGETED Targeted TARGETED Sequencing sequencing solutions Accurate, scalable, fast Sequencing for every lab, every budget, every application Ion Torrent semiconductor sequencing Ion Torrent technology has pioneered

More information

Information leaflet. Centrum voor Medische Genetica. Version 1/20150504 Design by Ben Caljon, UZ Brussel. Universitair Ziekenhuis Brussel

Information leaflet. Centrum voor Medische Genetica. Version 1/20150504 Design by Ben Caljon, UZ Brussel. Universitair Ziekenhuis Brussel Information on genome-wide genetic testing Array Comparative Genomic Hybridization (array CGH) Single Nucleotide Polymorphism array (SNP array) Massive Parallel Sequencing (MPS) Version 120150504 Design

More information

Overview of Genetic Testing and Screening

Overview of Genetic Testing and Screening Integrating Genetics into Your Practice Webinar Series Overview of Genetic Testing and Screening Genetic testing is an important tool in the screening and diagnosis of many conditions. New technology is

More information

Focusing on results not data comprehensive data analysis for targeted next generation sequencing

Focusing on results not data comprehensive data analysis for targeted next generation sequencing Focusing on results not data comprehensive data analysis for targeted next generation sequencing Daniel Swan, Jolyon Holdstock, Angela Matchan, Richard Stark, John Shovelton, Duarte Mohla and Simon Hughes

More information

Development of a Workflow to Detect Sequence Variants in the BRCA1 and BRCA2 Genes

Development of a Workflow to Detect Sequence Variants in the BRCA1 and BRCA2 Genes Your Innovative Research BRCA1 and BRCA2 Variant Detection Development of a Workflow to Detect Sequence Variants in the BRCA1 and BRCA2 Genes The oncogenetics group in the DNA Diagnostics division of the

More information

BRCA1 / 2 testing by massive sequencing highlights, shadows or pitfalls?

BRCA1 / 2 testing by massive sequencing highlights, shadows or pitfalls? BRCA1 / 2 testing by massive sequencing highlights, shadows or pitfalls? Giovanni Luca Scaglione, PhD ------------------------ Laboratory of Clinical Molecular Diagnostics and Personalized Medicine, Institute

More information

The following chapter is called "Preimplantation Genetic Diagnosis (PGD)".

The following chapter is called Preimplantation Genetic Diagnosis (PGD). Slide 1 Welcome to chapter 9. The following chapter is called "Preimplantation Genetic Diagnosis (PGD)". The author is Dr. Maria Lalioti. Slide 2 The learning objectives of this chapter are: To learn the

More information

Forensic DNA Testing Terminology

Forensic DNA Testing Terminology Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.

More information

Gene Mapping Techniques

Gene Mapping Techniques Gene Mapping Techniques OBJECTIVES By the end of this session the student should be able to: Define genetic linkage and recombinant frequency State how genetic distance may be estimated State how restriction

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources 1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools

More information

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,

More information

Next Generation Sequencing. mapping mutations in congenital heart disease

Next Generation Sequencing. mapping mutations in congenital heart disease Next Generation Sequencing mapping mutations in congenital heart disease AV Postma PhD Academic Medical Center Amsterdam, the Netherlands Overview talk Congenital heart disease and genetics Next generation

More information

Single-Cell DNA Sequencing with the C 1. Single-Cell Auto Prep System. Reveal hidden populations and genetic diversity within complex samples

Single-Cell DNA Sequencing with the C 1. Single-Cell Auto Prep System. Reveal hidden populations and genetic diversity within complex samples DATA Sheet Single-Cell DNA Sequencing with the C 1 Single-Cell Auto Prep System Reveal hidden populations and genetic diversity within complex samples Single-cell sensitivity Discover and detect SNPs,

More information

Introduction to next-generation sequencing data

Introduction to next-generation sequencing data Introduction to next-generation sequencing data David Simpson Centre for Experimental Medicine Queens University Belfast http://www.qub.ac.uk/research-centres/cem/ Outline History of DNA sequencing NGS

More information

DNA Sequence Analysis

DNA Sequence Analysis DNA Sequence Analysis Two general kinds of analysis Screen for one of a set of known sequences Determine the sequence even if it is novel Screening for a known sequence usually involves an oligonucleotide

More information

The NF1-gene a hotspot for de novo Alu- and L1-insertion?

The NF1-gene a hotspot for de novo Alu- and L1-insertion? The NF1-gene a hotspot for de novo Alu- and L1-insertion? Katharina Wimmer Division Humangenetik, Medizinische Universität Innsbruck Molekulare Diagnostik 2013 Zürich, 1. März, 2013 2 Die im Vortrag vorgestellten

More information

Genetic diagnostics the gateway to personalized medicine

Genetic diagnostics the gateway to personalized medicine Micronova 20.11.2012 Genetic diagnostics the gateway to personalized medicine Kristiina Assoc. professor, Director of Genetic Department HUSLAB, Helsinki University Central Hospital The Human Genome Packed

More information

Castillo et al. Rice Archaeogenetics electronic supplementary information

Castillo et al. Rice Archaeogenetics electronic supplementary information Castillo et al. Rice Archaeogenetics electronic supplementary information Figure S1: PCR amplification for the nuclear genome region Sh4; and the sequence analysis. (a) Electrophoresis of 10 PCR products

More information

Introduction To Real Time Quantitative PCR (qpcr)

Introduction To Real Time Quantitative PCR (qpcr) Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors

More information

SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications

SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications Product Bulletin Sequencing Software SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications Comprehensive reference sequence handling Helps interpret the role of each

More information

Next Generation Sequencing: Technology, Mapping, and Analysis

Next Generation Sequencing: Technology, Mapping, and Analysis Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University [email protected] http://tandem.bu.edu/ The Human Genome Project took

More information

CCR Biology - Chapter 9 Practice Test - Summer 2012

CCR Biology - Chapter 9 Practice Test - Summer 2012 Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible

More information

Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources

Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources Appendix 2 Molecular Biology Core Curriculum Websites and Other Resources Chapter 1 - The Molecular Basis of Cancer 1. Inside Cancer http://www.insidecancer.org/ From the Dolan DNA Learning Center Cold

More information

Test Information Sheet

Test Information Sheet Test Information Sheet GeneDx 207 Perry Parkway Gaithersburg, MD 20877 Phone: 888-729-1206 Fax: 301-710-6594 E-mail: [email protected] www.genedx.com/oncology OncoGene Dx: High/Moderate Risk Panel Sequence

More information

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99. 1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence

More information

Mitochondrial DNA Analysis

Mitochondrial DNA Analysis Mitochondrial DNA Analysis Lineage Markers Lineage markers are passed down from generation to generation without changing Except for rare mutation events They can help determine the lineage (family tree)

More information

Real-Time PCR Vs. Traditional PCR

Real-Time PCR Vs. Traditional PCR Real-Time PCR Vs. Traditional PCR Description This tutorial will discuss the evolution of traditional PCR methods towards the use of Real-Time chemistry and instrumentation for accurate quantitation. Objectives

More information

Genetic Technology. Name: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question.

Genetic Technology. Name: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question. Name: Class: Date: Genetic Technology Multiple Choice Identify the choice that best completes the statement or answers the question. 1. An application of using DNA technology to help environmental scientists

More information

LightCycler 480 Real-Time PCR System. High Resolution Melting: Optimization Strategies. Technical Note No. 1

LightCycler 480 Real-Time PCR System. High Resolution Melting: Optimization Strategies. Technical Note No. 1 LightCycler 480 Real-Time PCR System Technical Note No. 1 High Resolution Melting: Optimization Strategies High resolution melting (HRM) is a novel, closed-tube, post-pcr technique allowing genomic researchers

More information

Umm AL Qura University MUTATIONS. Dr Neda M Bogari

Umm AL Qura University MUTATIONS. Dr Neda M Bogari Umm AL Qura University MUTATIONS Dr Neda M Bogari CONTACTS www.bogari.net http://web.me.com/bogari/bogari.net/ From DNA to Mutations MUTATION Definition: Permanent change in nucleotide sequence. It can

More information

Real time and Quantitative (RTAQ) PCR. so I have an outlier and I want to see if it really is changed

Real time and Quantitative (RTAQ) PCR. so I have an outlier and I want to see if it really is changed Real time and Quantitative (RTAQ) PCR or.. for this audience so I have an outlier and I want to see if it really is changed Nigel Walker, Ph.D. Laboratory of Computational Biology and Risk Analysis, Environmental

More information

Test Information Sheet

Test Information Sheet Test Information Sheet GeneDx 207 Perry Parkway Gaithersburg, MD 20877 Phone: 888-729-1206 Fax: 301-710-6594 E-mail: [email protected] www.genedx.com/oncology OncoGene Dx: Breast/Ovarian Cancer Panel Sequence

More information

Milk protein genetic variation in Butana cattle

Milk protein genetic variation in Butana cattle Milk protein genetic variation in Butana cattle Ammar Said Ahmed Züchtungsbiologie und molekulare Genetik, Humboldt Universität zu Berlin, Invalidenstraβe 42, 10115 Berlin, Deutschland 1 Outline Background

More information

NGS and complex genetics

NGS and complex genetics NGS and complex genetics Robert Kraaij Genetic Laboratory Department of Internal Medicine [email protected] Gene Hunting Rotterdam Study and GWAS Next Generation Sequencing Gene Hunting Mendelian gene

More information

Genomes and SNPs in Malaria and Sickle Cell Anemia

Genomes and SNPs in Malaria and Sickle Cell Anemia Genomes and SNPs in Malaria and Sickle Cell Anemia Introduction to Genome Browsing with Ensembl Ensembl The vast amount of information in biological databases today demands a way of organising and accessing

More information

Lecture 3: Mutations

Lecture 3: Mutations Lecture 3: Mutations Recall that the flow of information within a cell involves the transcription of DNA to mrna and the translation of mrna to protein. Recall also, that the flow of information between

More information

Gene and Chromosome Mutation Worksheet (reference pgs. 239-240 in Modern Biology textbook)

Gene and Chromosome Mutation Worksheet (reference pgs. 239-240 in Modern Biology textbook) Name Date Per Look at the diagrams, then answer the questions. Gene Mutations affect a single gene by changing its base sequence, resulting in an incorrect, or nonfunctional, protein being made. (a) A

More information

MUTATION, DNA REPAIR AND CANCER

MUTATION, DNA REPAIR AND CANCER MUTATION, DNA REPAIR AND CANCER 1 Mutation A heritable change in the genetic material Essential to the continuity of life Source of variation for natural selection New mutations are more likely to be harmful

More information

SOP 3 v2: web-based selection of oligonucleotide primer trios for genotyping of human and mouse polymorphisms

SOP 3 v2: web-based selection of oligonucleotide primer trios for genotyping of human and mouse polymorphisms W548 W552 Nucleic Acids Research, 2005, Vol. 33, Web Server issue doi:10.1093/nar/gki483 SOP 3 v2: web-based selection of oligonucleotide primer trios for genotyping of human and mouse polymorphisms Steven

More information

Biotechnology: DNA Technology & Genomics

Biotechnology: DNA Technology & Genomics Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 The BIG Questions How can we use our knowledge of DNA to: diagnose disease or defect? cure disease or defect? change/improve organisms? What

More information

BioBoot Camp Genetics

BioBoot Camp Genetics BioBoot Camp Genetics BIO.B.1.2.1 Describe how the process of DNA replication results in the transmission and/or conservation of genetic information DNA Replication is the process of DNA being copied before

More information

Lectures 1 and 8 15. February 7, 2013. Genomics 2012: Repetitorium. Peter N Robinson. VL1: Next- Generation Sequencing. VL8 9: Variant Calling

Lectures 1 and 8 15. February 7, 2013. Genomics 2012: Repetitorium. Peter N Robinson. VL1: Next- Generation Sequencing. VL8 9: Variant Calling Lectures 1 and 8 15 February 7, 2013 This is a review of the material from lectures 1 and 8 14. Note that the material from lecture 15 is not relevant for the final exam. Today we will go over the material

More information

Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs)

Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs) Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs) Single nucleotide polymorphisms or SNPs (pronounced "snips") are DNA sequence variations that occur

More information

Molecular typing of VTEC: from PFGE to NGS-based phylogeny

Molecular typing of VTEC: from PFGE to NGS-based phylogeny Molecular typing of VTEC: from PFGE to NGS-based phylogeny Valeria Michelacci 10th Annual Workshop of the National Reference Laboratories for E. coli in the EU Rome, November 5 th 2015 Molecular typing

More information

Overview of Next Generation Sequencing platform technologies

Overview of Next Generation Sequencing platform technologies Overview of Next Generation Sequencing platform technologies Dr. Bernd Timmermann Next Generation Sequencing Core Facility Max Planck Institute for Molecular Genetics Berlin, Germany Outline 1. Technologies

More information

Delivering the power of the world s most successful genomics platform

Delivering the power of the world s most successful genomics platform Delivering the power of the world s most successful genomics platform NextCODE Health is bringing the full power of the world s largest and most successful genomics platform to everyday clinical care NextCODE

More information

Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis

Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype

More information

Bio 102 Practice Problems Genetic Code and Mutation

Bio 102 Practice Problems Genetic Code and Mutation Bio 102 Practice Problems Genetic Code and Mutation Multiple choice: Unless otherwise directed, circle the one best answer: 1. Beadle and Tatum mutagenized Neurospora to find strains that required arginine

More information

Genetics Test Biology I

Genetics Test Biology I Genetics Test Biology I Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Avery s experiments showed that bacteria are transformed by a. RNA. c. proteins.

More information

Simplifying Data Interpretation with Nexus Copy Number

Simplifying Data Interpretation with Nexus Copy Number Simplifying Data Interpretation with Nexus Copy Number A WHITE PAPER FROM BIODISCOVERY, INC. Rapid technological advancements, such as high-density acgh and SNP arrays as well as next-generation sequencing

More information

Bioinformatics Resources at a Glance

Bioinformatics Resources at a Glance Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences

More information

CHROMOSOMES Dr. Fern Tsien, Dept. of Genetics, LSUHSC, NO, LA

CHROMOSOMES Dr. Fern Tsien, Dept. of Genetics, LSUHSC, NO, LA CHROMOSOMES Dr. Fern Tsien, Dept. of Genetics, LSUHSC, NO, LA Cytogenetics is the study of chromosomes and their structure, inheritance, and abnormalities. Chromosome abnormalities occur in approximately:

More information

The Human Genome Project

The Human Genome Project The Human Genome Project Brief History of the Human Genome Project Physical Chromosome Maps Genetic (or Linkage) Maps DNA Markers Sequencing and Annotating Genomic DNA What Have We learned from the HGP?

More information

Human Genome Organization: An Update. Genome Organization: An Update

Human Genome Organization: An Update. Genome Organization: An Update Human Genome Organization: An Update Genome Organization: An Update Highlights of Human Genome Project Timetable Proposed in 1990 as 3 billion dollar joint venture between DOE and NIH with 15 year completion

More information

A complete workflow for pharmacogenomics using the QuantStudio 12K Flex Real-Time

A complete workflow for pharmacogenomics using the QuantStudio 12K Flex Real-Time Application NOte QuantStudio 12K Flex Real-Time PCR System A complete workflow for pharmacogenomics using the QuantStudio 12K Flex Real-Time PCR System Introduction Pharmacogenomics (PGx) is the study

More information

PROVIDER POLICIES & PROCEDURES

PROVIDER POLICIES & PROCEDURES PROVIDER POLICIES & PROCEDURES BRCA GENETIC TESTING The purpose of this document is to provide guidance to providers enrolled in the Connecticut Medical Assistance Program (CMAP) on the requirements for

More information

SERVICES CATALOGUE WITH SUBMISSION GUIDELINES

SERVICES CATALOGUE WITH SUBMISSION GUIDELINES SERVICES CATALOGUE WITH SUBMISSION GUIDELINES 3921 Montgomery Road Cincinnati, Ohio 45212 513-841-2428 www.agctsequencing.com CONTENTS Welcome Dye Terminator Sequencing DNA Sequencing Services - Full Service

More information

National Genetics Reference Laboratory (Wessex) Technology Assessment. Mutation scanning by high resolution melt analysis.

National Genetics Reference Laboratory (Wessex) Technology Assessment. Mutation scanning by high resolution melt analysis. National Genetics Reference Laboratory (Wessex) Technology Assessment Mutation scanning by high resolution melt analysis. Evaluation of Rotor Gene 6000 (Corbett Life Science), HR 1 and 384 well LightScanner

More information

Biological Sciences Initiative. Human Genome

Biological Sciences Initiative. Human Genome Biological Sciences Initiative HHMI Human Genome Introduction In 2000, researchers from around the world published a draft sequence of the entire genome. 20 labs from 6 countries worked on the sequence.

More information

Next Generation Sequencing: Adjusting to Big Data. Daniel Nicorici, Dr.Tech. Statistikot Suomen Lääketeollisuudessa 29.10.2013

Next Generation Sequencing: Adjusting to Big Data. Daniel Nicorici, Dr.Tech. Statistikot Suomen Lääketeollisuudessa 29.10.2013 Next Generation Sequencing: Adjusting to Big Data Daniel Nicorici, Dr.Tech. Statistikot Suomen Lääketeollisuudessa 29.10.2013 Outline Human Genome Project Next-Generation Sequencing Personalized Medicine

More information

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna

More information

G E N OM I C S S E RV I C ES

G E N OM I C S S E RV I C ES GENOMICS SERVICES THE NEW YORK GENOME CENTER NYGC is an independent non-profit implementing advanced genomic research to improve diagnosis and treatment of serious diseases. capabilities. N E X T- G E

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID papillary renal cell carcinoma (translocation-associated) PRCC Human This gene

More information

Molecular Diagnostics in the Clinical Microbiology Laboratory

Molecular Diagnostics in the Clinical Microbiology Laboratory Molecular Diagnostics in the Clinical Microbiology Laboratory Patrick Tang, MD, PhD, FRCPC B.C. Centre for Disease Control University of British Columbia Molecular Diagnostics in the Clinical Microbiology

More information

Services. Updated 05/31/2016

Services. Updated 05/31/2016 Updated 05/31/2016 Services 1. Whole exome sequencing... 2 2. Whole Genome Sequencing (WGS)... 3 3. 16S rrna sequencing... 4 4. Customized gene panels... 5 5. RNA-Seq... 6 6. qpcr... 7 7. HLA typing...

More information

QPCR Applications using Stratagene s Mx Real-Time PCR Platform

QPCR Applications using Stratagene s Mx Real-Time PCR Platform QPCR Applications using Stratagene s Mx Real-Time PCR Platform Dan Schoeffner, Ph.D Field Applications Scientist [email protected] Tech. Services 800-894-1304 Polymerase Chain Reaction Melt

More information

Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS)

Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) A typical RNA Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,

More information

SEQUENCING. From Sample to Sequence-Ready

SEQUENCING. From Sample to Sequence-Ready SEQUENCING From Sample to Sequence-Ready ACCESS ARRAY SYSTEM HIGH-QUALITY LIBRARIES, NOT ONCE, BUT EVERY TIME The highest-quality amplicons more sensitive, accurate, and specific Full support for all major

More information

Leading Genomics. Diagnostic. Discove. Collab. harma. Shanghai Cambridge, MA Reykjavik

Leading Genomics. Diagnostic. Discove. Collab. harma. Shanghai Cambridge, MA Reykjavik Leading Genomics Diagnostic harma Discove Collab Shanghai Cambridge, MA Reykjavik Global leadership for using the genome to create better medicine WuXi NextCODE provides a uniquely proven and integrated

More information

Genetics Module B, Anchor 3

Genetics Module B, Anchor 3 Genetics Module B, Anchor 3 Key Concepts: - An individual s characteristics are determines by factors that are passed from one parental generation to the next. - During gamete formation, the alleles for

More information