Tools for human molecular diagnosis. Joris Vermeesch
|
|
|
- Loreen Wilkinson
- 10 years ago
- Views:
Transcription
1 Tools for human molecular diagnosis Joris Vermeesch
2 Chromosome > DNA
3 Genetic Code
4 Effect of point mutations/polymorphisms
5 Effect of deletions/insertions
6 Effect of splicing mutations IVS2-2A>G Normal splice site Exon 1 Exon 2...CCCCACATAgtaagg......gagtagCCATTCCACAGATTTT......CCCCACATAgtaagg... Cryptic splice site...gagtggccattccacagatttt...
7 Genetic testing 1 gene <> multiple genes Molecular testing 1 disease 1 (single) mutation 1 disease 1 gene different diseases 1 (single) gene (un)known defect karyotyping 1 disease few genes 1 disease 1 chromosomal anomaly different diseases many genes different diseases different anomalies Molecular cytogenetic testing total genome Cytogenetics
8 How do we test which tools to use? Mutation-specific test - Restriction enzyme digestion - Southern blot - Dot blot / reverse dot blot - PCR hybridization - PCR applications PCR/fragment sizing MLPA: large deletion/duplications Mutation detection - Mutation scanning o SSCP o DGGE o DHPLC o HRM-CA - Sequencing o Sanger sequencing o Next Generation Sequencing
9 How do we test which tools to use? Mutation-specific test - Restriction enzyme digestion - Southern blot - Dot blot / reverse dot blot - PCR hybridization - PCR applications PCR/fragment sizing MLPA: large deletion/duplications Mutation detection - Mutation scanning o SSCP o DGGE o DHPLC o HRM-CA - Sequencing o Sanger sequencing o Next Generation Sequencing
10 Factor V (Leiden mutatie 1691A) Mnl I 5 - GGCGAGG GGCAAGG 3 Arg(R) to Gln(Q) at position
11 How do we test which tools to use? Mutation-specific test - Restriction enzyme digestion - Southern blot - Dot blot / reverse dot blot - PCR hybridization - PCR applications PCR/fragment sizing MLPA: large deletion/duplications Mutation detection - Mutation scanning o SSCP o DGGE o DHPLC o HRM-CA - Sequencing o Sanger sequencing o Next Generation Sequencing
12 Southern blot
13 Southern blot FMR
14 How do we test which tools to use? Mutation-specific test - Restriction enzyme digestion - Southern blot - Dot blot / reverse dot blot - PCR hybridization - PCR applications PCR/fragment sizing MLPA: large deletion/duplications Mutation detection - Mutation scanning o SSCP o DGGE o DHPLC o HRM-CA - Sequencing o Sanger sequencing o Next Generation Sequencing
15 Distribution of Cystic Fibrosis Mutations a 6b a 14b a 17b ' 3' Missense AA deletion Nonsense Frameshift Splice site Amino acid Variation Total Membrane spanning ATP-binding R-domain Membrane spanning ATP-binding (Data from the CF Genetic Analysis Consortium- July, 1995)
16 F508del (ex.10) 72.5 % G542X (ex.11) 5.5 % N1303K (ex.21) 3.5 % G>A (in. 10) 2.5 % W1282X (ex.20) 1.0 % G551D (ex.10) 0.5 % R553X (ex.10) 0.5 % I 507del (ex.10) 0.5 %
17 Reverse Dot Blot principe chromogeen paars precipitaat alkalisch fosfatase streptavidine biotine geamplificeerd DNA DNA-probe membraan
18
19 How do we test which tools to use? Mutation-specific test - Restriction enzyme digestion - Southern blot - Dot blot / reverse dot blot - PCR hybridization - PCR applications PCR/fragment sizing MLPA: large deletion/duplications Mutation detection - Mutation scanning o SSCP o DGGE o DHPLC o HRM-CA - Sequencing o Sanger sequencing o Next Generation Sequencing
20 TaqMan
21
22 TaqMan output
23 Molecular beacon
24 FRET (Fluorescence Resonance Energy Transfer) Principe
25 FRET (Fluorescence Resonance Energy Transfer) Principle
26 FRET (Fluorescence Resonance Energy Transfer) Principle
27
28 How do we test which tools to use? Mutation-specific test - Restriction enzyme digestion - Southern blot - Dot blot / reverse dot blot - PCR hybridization - PCR applications PCR/fragment sizing MLPA: large deletion/duplications Mutation detection - Mutation scanning o SSCP o DGGE o DHPLC o HRM-CA - Sequencing o Sanger sequencing o Next Generation Sequencing
29
30 MLPA: Multiplex Ligation-dependent Probe Amplification
31 1,2 1 0,8 0,6 0,4 0,2 0 MLH1 exon 1 MSH2 exon 1 MLH1 exon 2 MSH2 exon 2 MLH1 exon 3 MSH2 exon 3 MLH1 exon 4 MSH2 exon 4 MLH1 exon 5 MSH2 exon 5 MLH1 exon 6 MSH2 exon 6 MLH1 exon 7 MSH2 exon 7 MLH1 exon 8 MSH2 exon 8 MLH1 exon 9 MSH2 exon 9 MLH1 exon 10 MSH2 exon 10 MLH1 exon 11 MSH2 exon 11 MLH1 exon 12 MSH2 exon 12 MLH1 exon 13 MSH2 exon 13 MLH1 exon 14 MSH2 exon 14 MLH1 exon 15 MSH2 exon 15 MLH1 exon 16 MSH2 exon 16 MLH1 exon 17 MLH1 exon 18 MLH1 exon 19 MLPA MSL1&2
32 MLPA - SMA normal patient - SMA
33 How do we test which tools to use? Mutation-specific test - Restriction enzyme digestion - Southern blot - Dot blot / reverse dot blot - PCR hybridization - PCR applications PCR/fragment sizing MLPA: large deletion/duplications Mutation detection - Mutation scanning o SSCP o DGGE o DHPLC o HRM-CA - Sequencing o Sanger sequencing o Next Generation Sequencing
34 SSCP: Single strand conformation polymorphism
35 DGGE: Denaturing gradient gel electrophoresis Denaturant (Formamide/Urea) 0% 100% Separation Based on Differences in Nucleotide Sequence (G+C content) and Melting Characteristics Partially melted Single strands Or with GC-clamp Electrophoresis Double strand
36 DHPLC: Denaturing high performance liquid chromatography wild type mutant heteroduplexes homoduplexes A T G C A C G T A T G C
37 HRM: High resolution melting curve analysis wild type mutant heteroduplexes homoduplexes A T G C A C G T A T G C
38 How do we test which tools to use? Mutation-specific test - Restriction enzyme digestion - Southern blot - Dot blot / reverse dot blot - PCR hybridization - PCR applications PCR/fragment sizing MLPA: large deletion/duplications Mutation detection - Mutation scanning o SSCP o DGGE o DHPLC o HRM-CA - Sequencing o Sanger sequencing o Next Generation Sequencing
39 Sanger sequencing
40 Sequencing - ddntp
41 Sanger sequencing universal primers e1f 5 UTR e2f e3af e3bf e4/5f e6f Exon 1 Exon 2 Exon 3 Exons 4/5Exon 6 500bp 3 UTR 18bp M13-F e1r e2r e3ar e3br e4/5r e6r A30V intron 1 V L A Q D Y Q Q intron 2 ctagctattacgctactagc ctttccccag. gtc CTG GCT CAG gac tac cag cag.gtgggtatgc ctagctattacgctactagc 198C>T 18bp M13-R
42 Asp 90 G C T G A C A A A Asp/Ala 90 G C T G C C A A A A Controle Patiënt
43 Hereditarybreastand ovariancancer BRCA1 /BRCA2 BRCA1(on chromosome 17) BRCA2(on chromosome 13) 5.6 kb, 1863 aa - Affected patients identify the disease-causing mutation in the family - Dominantly inherited heterozygous mutations - Scattered thoughout the genes whole coding regions analyzed - Mostly truncating(nonsense, frameshifts(indels)) 10.3 kb, 3418 aa
44
45 Apostolou P, 2013
46 100 families
47 Aangepast van Fackenthal JD and Olopade OI, Nature Rev Cancer (2007) 185delAG IVS5+3A>G c.2197del5 c.2359dup c.3481del11 c.5266dupc IVS6+1G>A c.5213del4 c.6270del2 c.6275del2 c.8243g> A Exon19d el c.8904del
48
49 Vroeger Per patiënt= 110 PCR stalen 220 sequencing reacties Elke dag= 5 PCR platen 10 sequencing platen
50
51 BRCA MASTR v2.0 (Titanium) : 94 amplicons ng per multiplex PCR reaction
52
53 ROI Extra Specifieke primer Universeel deel Index 1 Complementair aan seq primer
54
55 Genetictesting Molecular testing 1 disease 1 (single) mutation 1 disease 1 gene different diseases 1 (single) gene (un)known defect karyotyping Cytogenetics 1 disease few genes 1 disease 1 chromosomal anomaly different diseases many genes different diseases different anomalies Molecular cytogenetic testing total genome
56
57
58 Projecten in het laboratorium Massive Parallel Sequencing (Illumina HiSeq ) Read Alignment, Mapping, Variant Calling and Annotation (Annovar) Variant Filtering (trio analysis) + CNV database mining IlluminaLibrary Prep and Exome Enrichment (NimbleGen) DE NOVO VARIANTS IN KNOWN MC GENES (8 PTS) DIAGNOSTIC VALUE e.g. CASK, CREBBP, TUBG1, KIF11 SYNDROMIC SPORADIC MC COHORT (19/20 trios) DE NOVO VARIANTS IN CANDIDATE MC GENES (7 PTS) e.g. LMNB1, SEMA4B, PKDL1, SNX21, SBSPON, FAT4, CCDC51 DE NOVO MUTATIONS TESTING IN ZEBRAFISH NO CANDIDATE DE NOVO VARIANTS (3 PTS)
59 Identification of causative mutations in rare disorders
60 Diagnostische exoom sequencing 100 patients 79 de novo mutations Diagnostic yield: 16% 51patients 87 de novo mutations Diagnostic yield: 45-55%
61 Limitations?! Exome is not entirely covered Limited to exons (and flanking regions) Impossible to detect (deep) intronic mutations Not quantitative Impossible to detect deletions or duplications Thousands of SNPs and variants
62 Gen en variant prioritisatie om causale SNPs te detecteren. Sifrim et al., Nature Methods, 2013
63 Volledige genoom analyse
64 Volledige genoom analyse 1.58 exomic variants/individual/generation Diagnostic yield: 62%
65 Wat met genetica in de maatschappij?
Molecular analyses of EGFR: mutation and amplification detection
Molecular analyses of EGFR: mutation and amplification detection Petra Nederlof, Moleculaire Pathologie NKI Amsterdam Henrique Ruijter, Ivon Tielen, Lucie Boerrigter, Aafke Ariaens Outline presentation
Sequencing and microarrays for genome analysis: complementary rather than competing?
Sequencing and microarrays for genome analysis: complementary rather than competing? Simon Hughes, Richard Capper, Sandra Lam and Nicole Sparkes Introduction The human genome is comprised of more than
Recombinant DNA Technology
Recombinant DNA Technology Stephen B. Gruber, MD, PhD Division of Molecular Medicine and Genetics November 4, 2002 Learning Objectives Know the basics of gene structure, function and regulation. Be familiar
Gene mutation and molecular medicine Chapter 15
Gene mutation and molecular medicine Chapter 15 Lecture Objectives What Are Mutations? How Are DNA Molecules and Mutations Analyzed? How Do Defective Proteins Lead to Diseases? What DNA Changes Lead to
Automated DNA sequencing 20/12/2009. Next Generation Sequencing
DNA sequencing the beginnings Ghent University (Fiers et al) pioneers sequencing first complete gene (1972) first complete genome (1976) Next Generation Sequencing Fred Sanger develops dideoxy sequencing
Disease gene identification with exome sequencing
Disease gene identification with exome sequencing Christian Gilissen Dept. of Human Genetics Radboud University Nijmegen Medical Centre [email protected] Contents Infrastructure Exome sequencing
MRC-Holland MLPA. Related SALSA MLPA probemix P091 CFTR: contains probes for the CFTR gene, related to chronic pancreatitis.
SALSA MLPA probemix P242-B3 Pancreatitis Lot B3-0215. As compared to version B2 (lot B2-1212), one flanking probe has been removed and four reference probes have been replaced. Hereditary Pancreatitis
Becker Muscular Dystrophy
Muscular Dystrophy A Case Study of Positional Cloning Described by Benjamin Duchenne (1868) X-linked recessive disease causing severe muscular degeneration. 100 % penetrance X d Y affected male Frequency
Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research. March 17, 2011 Rendez-Vous Séquençage
Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research March 17, 2011 Rendez-Vous Séquençage Presentation Overview Core Technology Review Sequence Enrichment Application
July 7th 2009 DNA sequencing
July 7th 2009 DNA sequencing Overview Sequencing technologies Sequencing strategies Sample preparation Sequencing instruments at MPI EVA 2 x 5 x ABI 3730/3730xl 454 FLX Titanium Illumina Genome Analyzer
Data Analysis for Ion Torrent Sequencing
IFU022 v140202 Research Use Only Instructions For Use Part III Data Analysis for Ion Torrent Sequencing MANUFACTURER: Multiplicom N.V. Galileilaan 18 2845 Niel Belgium Revision date: August 21, 2014 Page
Single Nucleotide Polymorphisms (SNPs)
Single Nucleotide Polymorphisms (SNPs) Additional Markers 13 core STR loci Obtain further information from additional markers: Y STRs Separating male samples Mitochondrial DNA Working with extremely degraded
Technical Note. Roche Applied Science. No. LC 18/2004. Assay Formats for Use in Real-Time PCR
Roche Applied Science Technical Note No. LC 18/2004 Purpose of this Note Assay Formats for Use in Real-Time PCR The LightCycler Instrument uses several detection channels to monitor the amplification of
Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company
Genetic engineering: humans Gene replacement therapy or gene therapy Many technical and ethical issues implications for gene pool for germ-line gene therapy what traits constitute disease rather than just
Next Generation Sequencing
Next Generation Sequencing Technology and applications 10/1/2015 Jeroen Van Houdt - Genomics Core - KU Leuven - UZ Leuven 1 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977
1 Mutation and Genetic Change
CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds
Validation parameters: An introduction to measures of
Validation parameters: An introduction to measures of test accuracy Types of tests All tests are fundamentally quantitative Sometimes we use the quantitative result directly However, it is often necessary
European registered Clinical Laboratory Geneticist (ErCLG) Core curriculum
(February 2015; updated from paper issued by the European Society of Human Genetics Ad hoc committee for the accreditation of clinical laboratory geneticists, published in February 2012) Speciality Profile
BRCA and Breast/Ovarian Cancer -- Analytic Validity Version 2003-6 2-1
ANALYTIC VALIDITY Question 8: Is the test qualitative or quantitative? Question 9: How often is a test positive when a mutation is present (analytic sensitivity)? Question 10: How often is the test negative
The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics
The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics The GS Junior System The Power of Next-Generation Sequencing on Your Benchtop Proven technology: Uses the same long
MRC-Holland MLPA. Description version 12; 02-12-2012
SALSA MLPA probemix P083-C1 CDH1 Lot C1-0211. As compared to previous B1 version, new in version C1: two CDH1 probes and several reference probes have been replaced/added. In addition, the 88 and 96nt
NEIGE. diagnosis In oncogenetics. Nicolas Sévenet 02 juillet 2012. [email protected]
NEIGE g for molecular NExt g generation sequencing diagnosis In oncogenetics Nicolas Sévenet 02 juillet 2012 [email protected] t@b d i f Reports 15 years Next generation sequencing 06/2011
Introduction to NGS data analysis
Introduction to NGS data analysis Jeroen F. J. Laros Leiden Genome Technology Center Department of Human Genetics Center for Human and Clinical Genetics Sequencing Illumina platforms Characteristics: High
Next generation DNA sequencing technologies. theory & prac-ce
Next generation DNA sequencing technologies theory & prac-ce Outline Next- Genera-on sequencing (NGS) technologies overview NGS applica-ons NGS workflow: data collec-on and processing the exome sequencing
Targeted. sequencing solutions. Accurate, scalable, fast TARGETED
Targeted TARGETED Sequencing sequencing solutions Accurate, scalable, fast Sequencing for every lab, every budget, every application Ion Torrent semiconductor sequencing Ion Torrent technology has pioneered
Information leaflet. Centrum voor Medische Genetica. Version 1/20150504 Design by Ben Caljon, UZ Brussel. Universitair Ziekenhuis Brussel
Information on genome-wide genetic testing Array Comparative Genomic Hybridization (array CGH) Single Nucleotide Polymorphism array (SNP array) Massive Parallel Sequencing (MPS) Version 120150504 Design
Overview of Genetic Testing and Screening
Integrating Genetics into Your Practice Webinar Series Overview of Genetic Testing and Screening Genetic testing is an important tool in the screening and diagnosis of many conditions. New technology is
Focusing on results not data comprehensive data analysis for targeted next generation sequencing
Focusing on results not data comprehensive data analysis for targeted next generation sequencing Daniel Swan, Jolyon Holdstock, Angela Matchan, Richard Stark, John Shovelton, Duarte Mohla and Simon Hughes
Development of a Workflow to Detect Sequence Variants in the BRCA1 and BRCA2 Genes
Your Innovative Research BRCA1 and BRCA2 Variant Detection Development of a Workflow to Detect Sequence Variants in the BRCA1 and BRCA2 Genes The oncogenetics group in the DNA Diagnostics division of the
BRCA1 / 2 testing by massive sequencing highlights, shadows or pitfalls?
BRCA1 / 2 testing by massive sequencing highlights, shadows or pitfalls? Giovanni Luca Scaglione, PhD ------------------------ Laboratory of Clinical Molecular Diagnostics and Personalized Medicine, Institute
The following chapter is called "Preimplantation Genetic Diagnosis (PGD)".
Slide 1 Welcome to chapter 9. The following chapter is called "Preimplantation Genetic Diagnosis (PGD)". The author is Dr. Maria Lalioti. Slide 2 The learning objectives of this chapter are: To learn the
Forensic DNA Testing Terminology
Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.
Gene Mapping Techniques
Gene Mapping Techniques OBJECTIVES By the end of this session the student should be able to: Define genetic linkage and recombinant frequency State how genetic distance may be estimated State how restriction
Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology
Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,
Next Generation Sequencing. mapping mutations in congenital heart disease
Next Generation Sequencing mapping mutations in congenital heart disease AV Postma PhD Academic Medical Center Amsterdam, the Netherlands Overview talk Congenital heart disease and genetics Next generation
Single-Cell DNA Sequencing with the C 1. Single-Cell Auto Prep System. Reveal hidden populations and genetic diversity within complex samples
DATA Sheet Single-Cell DNA Sequencing with the C 1 Single-Cell Auto Prep System Reveal hidden populations and genetic diversity within complex samples Single-cell sensitivity Discover and detect SNPs,
Introduction to next-generation sequencing data
Introduction to next-generation sequencing data David Simpson Centre for Experimental Medicine Queens University Belfast http://www.qub.ac.uk/research-centres/cem/ Outline History of DNA sequencing NGS
DNA Sequence Analysis
DNA Sequence Analysis Two general kinds of analysis Screen for one of a set of known sequences Determine the sequence even if it is novel Screening for a known sequence usually involves an oligonucleotide
The NF1-gene a hotspot for de novo Alu- and L1-insertion?
The NF1-gene a hotspot for de novo Alu- and L1-insertion? Katharina Wimmer Division Humangenetik, Medizinische Universität Innsbruck Molekulare Diagnostik 2013 Zürich, 1. März, 2013 2 Die im Vortrag vorgestellten
Genetic diagnostics the gateway to personalized medicine
Micronova 20.11.2012 Genetic diagnostics the gateway to personalized medicine Kristiina Assoc. professor, Director of Genetic Department HUSLAB, Helsinki University Central Hospital The Human Genome Packed
Castillo et al. Rice Archaeogenetics electronic supplementary information
Castillo et al. Rice Archaeogenetics electronic supplementary information Figure S1: PCR amplification for the nuclear genome region Sh4; and the sequence analysis. (a) Electrophoresis of 10 PCR products
Introduction To Real Time Quantitative PCR (qpcr)
Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors
SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications
Product Bulletin Sequencing Software SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications Comprehensive reference sequence handling Helps interpret the role of each
Next Generation Sequencing: Technology, Mapping, and Analysis
Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University [email protected] http://tandem.bu.edu/ The Human Genome Project took
CCR Biology - Chapter 9 Practice Test - Summer 2012
Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible
Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources
Appendix 2 Molecular Biology Core Curriculum Websites and Other Resources Chapter 1 - The Molecular Basis of Cancer 1. Inside Cancer http://www.insidecancer.org/ From the Dolan DNA Learning Center Cold
Test Information Sheet
Test Information Sheet GeneDx 207 Perry Parkway Gaithersburg, MD 20877 Phone: 888-729-1206 Fax: 301-710-6594 E-mail: [email protected] www.genedx.com/oncology OncoGene Dx: High/Moderate Risk Panel Sequence
2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.
1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence
Mitochondrial DNA Analysis
Mitochondrial DNA Analysis Lineage Markers Lineage markers are passed down from generation to generation without changing Except for rare mutation events They can help determine the lineage (family tree)
Real-Time PCR Vs. Traditional PCR
Real-Time PCR Vs. Traditional PCR Description This tutorial will discuss the evolution of traditional PCR methods towards the use of Real-Time chemistry and instrumentation for accurate quantitation. Objectives
Genetic Technology. Name: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question.
Name: Class: Date: Genetic Technology Multiple Choice Identify the choice that best completes the statement or answers the question. 1. An application of using DNA technology to help environmental scientists
LightCycler 480 Real-Time PCR System. High Resolution Melting: Optimization Strategies. Technical Note No. 1
LightCycler 480 Real-Time PCR System Technical Note No. 1 High Resolution Melting: Optimization Strategies High resolution melting (HRM) is a novel, closed-tube, post-pcr technique allowing genomic researchers
Umm AL Qura University MUTATIONS. Dr Neda M Bogari
Umm AL Qura University MUTATIONS Dr Neda M Bogari CONTACTS www.bogari.net http://web.me.com/bogari/bogari.net/ From DNA to Mutations MUTATION Definition: Permanent change in nucleotide sequence. It can
Real time and Quantitative (RTAQ) PCR. so I have an outlier and I want to see if it really is changed
Real time and Quantitative (RTAQ) PCR or.. for this audience so I have an outlier and I want to see if it really is changed Nigel Walker, Ph.D. Laboratory of Computational Biology and Risk Analysis, Environmental
Test Information Sheet
Test Information Sheet GeneDx 207 Perry Parkway Gaithersburg, MD 20877 Phone: 888-729-1206 Fax: 301-710-6594 E-mail: [email protected] www.genedx.com/oncology OncoGene Dx: Breast/Ovarian Cancer Panel Sequence
Milk protein genetic variation in Butana cattle
Milk protein genetic variation in Butana cattle Ammar Said Ahmed Züchtungsbiologie und molekulare Genetik, Humboldt Universität zu Berlin, Invalidenstraβe 42, 10115 Berlin, Deutschland 1 Outline Background
NGS and complex genetics
NGS and complex genetics Robert Kraaij Genetic Laboratory Department of Internal Medicine [email protected] Gene Hunting Rotterdam Study and GWAS Next Generation Sequencing Gene Hunting Mendelian gene
Genomes and SNPs in Malaria and Sickle Cell Anemia
Genomes and SNPs in Malaria and Sickle Cell Anemia Introduction to Genome Browsing with Ensembl Ensembl The vast amount of information in biological databases today demands a way of organising and accessing
Lecture 3: Mutations
Lecture 3: Mutations Recall that the flow of information within a cell involves the transcription of DNA to mrna and the translation of mrna to protein. Recall also, that the flow of information between
Gene and Chromosome Mutation Worksheet (reference pgs. 239-240 in Modern Biology textbook)
Name Date Per Look at the diagrams, then answer the questions. Gene Mutations affect a single gene by changing its base sequence, resulting in an incorrect, or nonfunctional, protein being made. (a) A
MUTATION, DNA REPAIR AND CANCER
MUTATION, DNA REPAIR AND CANCER 1 Mutation A heritable change in the genetic material Essential to the continuity of life Source of variation for natural selection New mutations are more likely to be harmful
SOP 3 v2: web-based selection of oligonucleotide primer trios for genotyping of human and mouse polymorphisms
W548 W552 Nucleic Acids Research, 2005, Vol. 33, Web Server issue doi:10.1093/nar/gki483 SOP 3 v2: web-based selection of oligonucleotide primer trios for genotyping of human and mouse polymorphisms Steven
Biotechnology: DNA Technology & Genomics
Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 The BIG Questions How can we use our knowledge of DNA to: diagnose disease or defect? cure disease or defect? change/improve organisms? What
BioBoot Camp Genetics
BioBoot Camp Genetics BIO.B.1.2.1 Describe how the process of DNA replication results in the transmission and/or conservation of genetic information DNA Replication is the process of DNA being copied before
Lectures 1 and 8 15. February 7, 2013. Genomics 2012: Repetitorium. Peter N Robinson. VL1: Next- Generation Sequencing. VL8 9: Variant Calling
Lectures 1 and 8 15 February 7, 2013 This is a review of the material from lectures 1 and 8 14. Note that the material from lecture 15 is not relevant for the final exam. Today we will go over the material
Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs)
Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs) Single nucleotide polymorphisms or SNPs (pronounced "snips") are DNA sequence variations that occur
Molecular typing of VTEC: from PFGE to NGS-based phylogeny
Molecular typing of VTEC: from PFGE to NGS-based phylogeny Valeria Michelacci 10th Annual Workshop of the National Reference Laboratories for E. coli in the EU Rome, November 5 th 2015 Molecular typing
Overview of Next Generation Sequencing platform technologies
Overview of Next Generation Sequencing platform technologies Dr. Bernd Timmermann Next Generation Sequencing Core Facility Max Planck Institute for Molecular Genetics Berlin, Germany Outline 1. Technologies
Delivering the power of the world s most successful genomics platform
Delivering the power of the world s most successful genomics platform NextCODE Health is bringing the full power of the world s largest and most successful genomics platform to everyday clinical care NextCODE
Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis
Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype
Bio 102 Practice Problems Genetic Code and Mutation
Bio 102 Practice Problems Genetic Code and Mutation Multiple choice: Unless otherwise directed, circle the one best answer: 1. Beadle and Tatum mutagenized Neurospora to find strains that required arginine
Genetics Test Biology I
Genetics Test Biology I Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Avery s experiments showed that bacteria are transformed by a. RNA. c. proteins.
Simplifying Data Interpretation with Nexus Copy Number
Simplifying Data Interpretation with Nexus Copy Number A WHITE PAPER FROM BIODISCOVERY, INC. Rapid technological advancements, such as high-density acgh and SNP arrays as well as next-generation sequencing
Bioinformatics Resources at a Glance
Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences
CHROMOSOMES Dr. Fern Tsien, Dept. of Genetics, LSUHSC, NO, LA
CHROMOSOMES Dr. Fern Tsien, Dept. of Genetics, LSUHSC, NO, LA Cytogenetics is the study of chromosomes and their structure, inheritance, and abnormalities. Chromosome abnormalities occur in approximately:
The Human Genome Project
The Human Genome Project Brief History of the Human Genome Project Physical Chromosome Maps Genetic (or Linkage) Maps DNA Markers Sequencing and Annotating Genomic DNA What Have We learned from the HGP?
Human Genome Organization: An Update. Genome Organization: An Update
Human Genome Organization: An Update Genome Organization: An Update Highlights of Human Genome Project Timetable Proposed in 1990 as 3 billion dollar joint venture between DOE and NIH with 15 year completion
A complete workflow for pharmacogenomics using the QuantStudio 12K Flex Real-Time
Application NOte QuantStudio 12K Flex Real-Time PCR System A complete workflow for pharmacogenomics using the QuantStudio 12K Flex Real-Time PCR System Introduction Pharmacogenomics (PGx) is the study
PROVIDER POLICIES & PROCEDURES
PROVIDER POLICIES & PROCEDURES BRCA GENETIC TESTING The purpose of this document is to provide guidance to providers enrolled in the Connecticut Medical Assistance Program (CMAP) on the requirements for
SERVICES CATALOGUE WITH SUBMISSION GUIDELINES
SERVICES CATALOGUE WITH SUBMISSION GUIDELINES 3921 Montgomery Road Cincinnati, Ohio 45212 513-841-2428 www.agctsequencing.com CONTENTS Welcome Dye Terminator Sequencing DNA Sequencing Services - Full Service
National Genetics Reference Laboratory (Wessex) Technology Assessment. Mutation scanning by high resolution melt analysis.
National Genetics Reference Laboratory (Wessex) Technology Assessment Mutation scanning by high resolution melt analysis. Evaluation of Rotor Gene 6000 (Corbett Life Science), HR 1 and 384 well LightScanner
Biological Sciences Initiative. Human Genome
Biological Sciences Initiative HHMI Human Genome Introduction In 2000, researchers from around the world published a draft sequence of the entire genome. 20 labs from 6 countries worked on the sequence.
Next Generation Sequencing: Adjusting to Big Data. Daniel Nicorici, Dr.Tech. Statistikot Suomen Lääketeollisuudessa 29.10.2013
Next Generation Sequencing: Adjusting to Big Data Daniel Nicorici, Dr.Tech. Statistikot Suomen Lääketeollisuudessa 29.10.2013 Outline Human Genome Project Next-Generation Sequencing Personalized Medicine
Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation
Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna
G E N OM I C S S E RV I C ES
GENOMICS SERVICES THE NEW YORK GENOME CENTER NYGC is an independent non-profit implementing advanced genomic research to improve diagnosis and treatment of serious diseases. capabilities. N E X T- G E
PrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID papillary renal cell carcinoma (translocation-associated) PRCC Human This gene
Molecular Diagnostics in the Clinical Microbiology Laboratory
Molecular Diagnostics in the Clinical Microbiology Laboratory Patrick Tang, MD, PhD, FRCPC B.C. Centre for Disease Control University of British Columbia Molecular Diagnostics in the Clinical Microbiology
Services. Updated 05/31/2016
Updated 05/31/2016 Services 1. Whole exome sequencing... 2 2. Whole Genome Sequencing (WGS)... 3 3. 16S rrna sequencing... 4 4. Customized gene panels... 5 5. RNA-Seq... 6 6. qpcr... 7 7. HLA typing...
QPCR Applications using Stratagene s Mx Real-Time PCR Platform
QPCR Applications using Stratagene s Mx Real-Time PCR Platform Dan Schoeffner, Ph.D Field Applications Scientist [email protected] Tech. Services 800-894-1304 Polymerase Chain Reaction Melt
Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS)
Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) A typical RNA Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,
SEQUENCING. From Sample to Sequence-Ready
SEQUENCING From Sample to Sequence-Ready ACCESS ARRAY SYSTEM HIGH-QUALITY LIBRARIES, NOT ONCE, BUT EVERY TIME The highest-quality amplicons more sensitive, accurate, and specific Full support for all major
Leading Genomics. Diagnostic. Discove. Collab. harma. Shanghai Cambridge, MA Reykjavik
Leading Genomics Diagnostic harma Discove Collab Shanghai Cambridge, MA Reykjavik Global leadership for using the genome to create better medicine WuXi NextCODE provides a uniquely proven and integrated
Genetics Module B, Anchor 3
Genetics Module B, Anchor 3 Key Concepts: - An individual s characteristics are determines by factors that are passed from one parental generation to the next. - During gamete formation, the alleles for
