DNA-Analytik III. Genetische Variabilität



Similar documents
Globally, about 9.7% of cancers in men are prostate cancers, and the risk of developing the

Genomes and SNPs in Malaria and Sickle Cell Anemia

Combining Data from Different Genotyping Platforms. Gonçalo Abecasis Center for Statistical Genetics University of Michigan

Core Facility Genomics

Sequencing and microarrays for genome analysis: complementary rather than competing?

Next Generation Sequencing: Technology, Mapping, and Analysis

SNPbrowser Software v3.5

Single Nucleotide Polymorphisms (SNPs)

An example of bioinformatics application on plant breeding projects in Rijk Zwaan

SeattleSNPs Interactive Tutorial: Web Tools for Site Selection, Linkage Disequilibrium and Haplotype Analysis

The Functional but not Nonfunctional LILRA3 Contributes to Sex Bias in Susceptibility and Severity of ACPA-Positive Rheumatoid Arthritis

Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs)

A Primer of Genome Science THIRD

NGS and complex genetics

SNP Essentials The same SNP story

How To Find Rare Variants In The Human Genome

July 7th 2009 DNA sequencing

Genetics Module B, Anchor 3

How many of you have checked out the web site on protein-dna interactions?

Gene mutation and molecular medicine Chapter 15

Go where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe

Y Chromosome Markers

Innovations in Molecular Epidemiology

GAW 15 Problem 3: Simulated Rheumatoid Arthritis Data Full Model and Simulation Parameters

Overview One of the promises of studies of human genetic variation is to learn about human history and also to learn about natural selection.

DNA Copy Number and Loss of Heterozygosity Analysis Algorithms

Information leaflet. Centrum voor Medische Genetica. Version 1/ Design by Ben Caljon, UZ Brussel. Universitair Ziekenhuis Brussel

Introduction To Epigenetic Regulation: How Can The Epigenomics Core Services Help Your Research? Maria (Ken) Figueroa, M.D. Core Scientific Director

SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications

Heritability: Twin Studies. Twin studies are often used to assess genetic effects on variation in a trait

escience and Post-Genome Biomedical Research

Factors for success in big data science

Journal of Statistical Software

Discovery and Quantification of RNA with RNASeq Roderic Guigó Serra Centre de Regulació Genòmica (CRG)

Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS)

MORPHEUS. Prediction of Transcription Factors Binding Sites based on Position Weight Matrix.

Overview of Genetic Testing and Screening

Data Analysis for Ion Torrent Sequencing

Becker Muscular Dystrophy

Biomedical Big Data and Precision Medicine

Genotyping and quality control of UK Biobank, a large- scale, extensively phenotyped prospective resource

Targeted. sequencing solutions. Accurate, scalable, fast TARGETED

Overview of Next Generation Sequencing platform technologies

SOP 3 v2: web-based selection of oligonucleotide primer trios for genotyping of human and mouse polymorphisms

The Developing Person Through the Life Span 8e by Kathleen Stassen Berger

The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics

Genomic Selection in. Applied Training Workshop, Sterling. Hans Daetwyler, The Roslin Institute and R(D)SVS

Breast cancer and the role of low penetrance alleles: a focus on ATM gene

SEQUENCING. From Sample to Sequence-Ready

GenomeStudio Data Analysis Software

FHF prosjekt :

ONLINE SUPPLEMENTAL MATERIAL. Allele-Specific Expression of Angiotensinogen in Human Subcutaneous Adipose Tissue

A complete workflow for pharmacogenomics using the QuantStudio 12K Flex Real-Time

Original article: DXS10079, DXS10074 and DXS10075: new alleles and SNP occurrence

Towards Integrating the Detection of Genetic Variants into an In-Memory Database

Roberto Ciccone, Orsetta Zuffardi Università di Pavia

Genetic Mutations. Indicator 4.8: Compare the consequences of mutations in body cells with those in gametes.

Lecture 3: Mutations

Focusing on results not data comprehensive data analysis for targeted next generation sequencing

Genetics of Rheumatoid Arthritis Markey Lecture Series

GenomeStudio Data Analysis Software

School of Nursing. Presented by Yvette Conley, PhD

Psychoonkology, Sept lifestyle factors and epigenetics

The following chapter is called "Preimplantation Genetic Diagnosis (PGD)".

INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE E15

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.

Workshop on Methods for Isolation and Identification of Campylobacter spp. June 13-17, 2005

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company

Human Genome and Human Genome Project. Louxin Zhang

Title: Genetics and Hearing Loss: Clinical and Molecular Characteristics

Milk protein genetic variation in Butana cattle

Simplifying Data Interpretation with Nexus Copy Number

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in

Name Class Date. Figure Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.

Genotyping by sequencing and data analysis. Ross Whetten North Carolina State University

DNA Sequence Analysis

Single-Cell Whole Genome Sequencing on the C1 System: a Performance Evaluation

Tools for human molecular diagnosis. Joris Vermeesch

Introduction To Real Time Quantitative PCR (qpcr)

Assuring the Quality of Next-Generation Sequencing in Clinical Laboratory Practice. Supplementary Guidelines

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure enzymes control cell chemistry ( metabolism )

UNIVERSITÀ DEGLI STUDI DI SASSARI

Validation and Replication

SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison

CNV Univariate Analysis Tutorial

Biological Sciences Initiative. Human Genome

Gene Mapping Techniques

HIGH DENSITY DATA STORAGE IN DNA USING AN EFFICIENT MESSAGE ENCODING SCHEME Rahul Vishwakarma 1 and Newsha Amiri 2

Transcription:

DNA-Analytik III Genetische Variabilität

Genetische Variabilität Lexikon Scherer et al. Nat Genet Suppl 39:s7 (2007)

Genetische Variabilität Sequenzvariation Mutationen (Mikro~) Basensubstitution Insertion + Deletion = InDel Polymorphismen SNP ( single nucleotide ~) Polymorphismen resultieren aus Mutationen, die sich mit einer Häufigkeit >1% in einer Population etabliert haben.

SNP-Bestimmung Methoden Sanger-Sequenzierung PyroSequenzierung Quantitative PCR ( TaqMan ) Massenspektrometrie ( Sequenome ) DNA-Chip ( Affimetrix )

SNP-Bestimmung DyeTerminator-Sequenzierung

SNP-Bestimmung DyeTerminator-Sequenzierung

SNP-Bestimmung DyeTerminator-Sequenzierung

InDel-Bestimmung DyeTerminator-Sequenzierung

InDel-Bestimmung DyeTerminator-Sequenzierung + - Ref

Pyrosequencing sequence to analyze: A/GCTGCCT

Bestimmung seltener Mutationen/Variationen Coverage T only Mutation Freq. Ultra deep 454 sequencing Background subtracted 0.16% Primer sequence Coverage C to T ratio: 1/500 Mutation Freq. Primer sequence

SNP-Bestimmung Genotypisierung per Chip Variant Detection Array for allele A a c g t VDA C a c g t C allele signals A allele signals VDA A VDA C A/A A/C C/C Wang et al. Science 280:1077 (1998)

SNP-Bestimmmung High-throughput array-based genotyping Affymetrix Human SNP Array 6.0 >1.8 million markers 906,600 SNPs 946,000 for CNVs Illumina Human 660W-Quad BeadChip 2.6 million markers / four samples 550,000 tag SNPs 100,000 for CNVs 5,000 common CNVs

Genetische Variabilität Terminologie Haplotype = set/region physically linked polymorphism chromosomes major haplotypes 21 SNPs 10..50 kb * * *...AGCTT...CCAAA...TCACC......AGGTT...CCAAA...TCACC......AGGTT...CCAAA...TCGCC......AGGTT...CCGAA...TCGCC... TGATTGTTACAACACTTTACC AGGTCGCTCGAAAATCTAACC AGGCTATTCGAGAGCCTAGGT AAGTTACCCGGGAGCCCAGCC

Genetische Variabilität Haplotypen TIHC. Nature 449:851 2007

HapMap Projekt Gegenstand 270 individuals from 4 geographically diverse populations: YRI Africans: 30 trios (Yoruba in Ibadan, Nigeria) CEU European: 30 trios of northern/western ancestry (Utah, US; CEPH collection) CHB Chinese: 45 unrelated Han individuals (Beijing, China) JPT Japanese: 45 unrelated individuals (Tokyo, Japan) 3.1 million human SNPs genotyped ~25 35% of common SNP variation in the populations surveyed TIHC. Nature 449:851 2007

HapMap Projekt Haplotyp-Blöcke Olsson et al. Arthritis Res & Ther 9:r98 2007

HapMap Projekt Haplotyp-Blöcke Africans Europeans Asians TIHC. Nature 437:1299 2005

Genetische Variabilität TagSNPs Haplotype = set/region physically linked polymorphism chromosomes major haplotypes 21 SNPs 10..50 kb tag SNPs * * *...AGCTT...CCAAA...TCACC......AGGTT...CCAAA...TCACC......AGGTT...CCAAA...TCGCC......AGGTT...CCGAA...TCGCC... TGATTGTTACAACACTTTACC AGGTCGCTCGAAAATCTAACC AGGCTATTCGAGAGCCTAGGT AAGTTACCCGGGAGCCCAGCC T/C A/G TA CA TG CG tag haplotypes

HapMap Projekt Schlussfolgerungen HapMap is estimated to capture the 65-75% untyped common SNPs with a likelihood of 90-96% depending on population. Current generation of commercial genome-wide genotyping products captures 3.1 million HapMap SNPs with 80% in African and up to 95% in non-african populations. TIHC. Nature 449:851 2007

Genetische Variabilität Strukturelle Variationen Chromosom A Chromosom B Inversion InDel Allel-Variation Kombination

Segmentale Duplikation Definition genomic regions >1kb with nt identity >90% Human genome 5.3% segmentally duplicated 87% of all segmental duplications >50 kb

Segmentale Duplikation SNVs Fredman et al., Nat Genet 36, 861 (2004)

Copy number variation (CNV) Detection by DNA microarrays 0.5-2 Mio data points comparative hybridization vs. a reference Lee et al., Nat Genet Suppl 39:s48 (2007)

Strukturelle Variationen Kartierung Eichler et al., Nature 447:161 (2007)

DNA-Analytik epigenetische Modifikationen

Methylierung spontane Desaminierung

Bisulfit Sequenzierung chemische Desaminierung Cytosin Uracil

Bisulfit Sequenzierung Nachweis mit DyeTerminatoren

Bisulfit Sequenzierung Genomweite Analyse

DNA Methylierung Fibroblasten vs. ES Lister et al., Nature 462:315 (2009)

DNA Methylierung ES Lister et al., Nature 462:315 (2009)

DNA Methylierung ES Lister et al., Nature 462:315 (2009)

DNA Methylierung DNA-Methyl-Transferase Aufrechterhaltung histone deacetylase interaction domain de novo

DNA Methylierung Methyl-C bindende Proteine Methyl-CpG Binding Domain Transcriptional Repression Domain

DNA Methylierung Geninaktivierung & Heterochromatisierung

DNA Methylierung X-Inaktivierung Barr-Körper

DNA Methylierung Imprinting / Prägung väterliche mütterliche paternales maternales Gen unterliegt der Prägung / Inaktivierung Imprinting

DNA Methylierung & Krankheit ICF-Syndrom ICF Immunodeficiency Centromeric instability Facial anomalies

DNA Methylierung & Krankheit Rett-Syndrom RETT X-linked dominant, male lethal most common cause of sporadic mental retardation in females period of normal development followed by progressive degeneration in speech and motor skills, seizures, autism, stereotypical, repetitive hand movements

DNA Methylierung & Krankheit Fragiles X-Syndrom

DNA Methylierung Initiation der Transkription Mittel zur Reduzierung genomischer Komplexität?

genome.fli-leibniz.de Teaching