Overview of Next Generation Sequencing platform technologies
|
|
|
- Benedict Piers Thornton
- 9 years ago
- Views:
Transcription
1 Overview of Next Generation Sequencing platform technologies Dr. Bernd Timmermann Next Generation Sequencing Core Facility Max Planck Institute for Molecular Genetics Berlin, Germany
2 Outline 1. Technologies Illumina Roche / Projects and Applications whole Genome Re-sequencing Sequence Capture Amplicon Sequencing 3. Outlook
3 Max Planck Society 80 institutes and research facilities 20,435 people Budget 1,400 million euro in 2010 Max Planck Institute for molecular Genetics
4 Development of Sequencing Throughput Throughput per system [kilobases/day] 1000,000, ,000,000 10,000,000 1,000, , , Gel-based Systems Capillary Sequencing First Generation Capillary Sequencer Next Generation Sequencing Short-Read Sequencer Microwell Pyrosequencing Second Generation Capillary Sequencer Year Modified after MR Stratton et al. Nature 458, (2009)
5 Development of Sequencing Technologies Human Genome Project 1000 Genomes Project 96 sequences in parallel 3.2 billions of sequences per run
6 Sequencing Capacities at the MPI-MG 7 x Illumina 5 x Roche GS 3 x SOLiD 3 x Capillary Systems
7 IT Infrastructure Short Read Technologies TB GB Long Read Technologies 25 x 32 (64) Compute Server with 128 (512 GB) RAM 4 peta byte Storage Capacity
8 Technologies 1. Technologies Illumina Roche / Projects and Applications whole Genome Re-sequencing Sequence Capture Amplicon Sequencing 3. Outlook
9 Genome Sequencer FLX HiSeq 2000/ SOLiD de novo Sequencing Metagenome Analyses Amplicon Sequencing Full length Transcriptome Analyses Sequencing of target regions ChipSeq MeDipSeq mirna RNAseq Sequencing of target regions Whole genome resequencing
10 Principle Illumina Sequencing Library Preparation Cluster Generation Attachement of single molecules to surface Amplification to form clusters
11 3 5 Sequencing by Synthesis (SBS) Cycle 1: Add sequencing reagents A T C A G T C T G C T A C G A First base incorporated Remove unincorporated bases Detect signal Cycle 2-n: Add sequencing reagents and repeat G T C A G T A C C C G A T C G A T 5
12 Conversion of image data to DNA sequences Sequence Reads TCGGGAGTCCTAATGAGCCCGTAATCCCGTTAGTA TGAAGTCGGGAGTCCTAATGAGCCCGTAATCCCGTT CGAATGAAGTCGGGAGTCCTAATGAGCCCGTAATCC GAGCGAATGAAGTCGGGAGTCCTAATGAGCCCGTAA CGAGCGAATGAAGTCGGGAGTCCTAATGAGCCCGTA Referenzsequenz...CGAGCGAATGAAGTCGGGAGTCGTAATGAGCCCGTAATCCCGTTAGTA...
13 Facts Illumina Sequencing (HiSeq 2000) Input Material: Library Preparation: ~ 1.5 days Cluster Generation: ~ 1-3 µg DNA shotgun Sequencing ~ 10 ng ChipSeq Sequencing ~ 1 day Run Time/ Single read ~ 2 days (36 b) Read Length: Paired End ~ 10 days (2 x 100 b) Data Processing: ~ 1 day Output: Reads: Paired End ~ 500 Gb up to 4800 Mio
14 454 Sequencing Instrument 2. Load PicoTiter plate into instrument 3. Load Reagents in a single rack 4. Sequencing 1. Genome is loaded into a PicoTiter plate
15 Principle 454 Sequencing Emulsion Breaking Library Preparation Emulsion PCR Depositing DNA Beads into the PicoTiter Plate Pyrosequencing
16 Facts 454 Sequencing Input Material: Library Preparation : Emulsion PCR: Run Time: Data Processing: Output: ~ 0.5 µg DNA ~ 4 hours ~ 1 day 20 hours ~ 10 hours Titanium MB Reads: Titanium Read length: bases
17 Sequencing Pipeline Library Quantification Library Preparation Sequencing Bead Enrichment
18 Projects and Applications 1. Technologies Illumina Roche / Projects and Applications whole Genome Re-sequencing Sequence Capture Amplicon Sequencing 3. Outlook
19 Goals A public database of essentially all SNPs and detectable CNVs with allele frequency >1% in each of multiple human population samples Pioneer and evaluate methods for: Generating data from next-generation sequencing platforms Exchanging and combining data and analytical methods Discovering and genotyping SNPs and CNVs from nextgen data Imputation with and from next generation sequencing data 454, Illumina and AB SOLiD platforms Academic genome centers in US, UK, Germany, China and platform companies (Nature 2010, Science 2010 and Nature 2011)
20 OncoTrack, Methods for systematic next generation oncology biomarker development, is an international consortium of over 60 scientists, that has launched one of Europe s largest collaborative academicindustry research projects to develop and assess novel approaches for identification of new markers for colon cancer.
21 Protein Cell lines Tissues Mutations Methylation DNA mrna RNA mirna Sequencing Bioinformatics
22 total RNA Isolation RNAseq small RNA Depletion Mapping quality control dsdna generation using random hexamers expression profiling Illumina library preparation massive parallel sequencing
23 Sequence Capture GWAS Candidate Genes Whole Exome MB 35 MB 385 k Array, Nimblegen In-solution Enrichment 2.1 Mio Array, Nimblegen In-solution Enrichment
24 Targeted Resequencing: Project outline Identification patients Sample preparation Sequence capture Work-flow Next-Gen sequencing Functional characterization Follow-up sequencing Bioinformatics
25 Principle of sequence capture DNA Preparation Enrichment of target regions Sequencing genomic DNA Hybridization Fragments ( bp) Selection with streptavidin beads Ligation of adapters A1 SP1 Amplification and Quantification A2
26 Cleft lip with or without cleft palate (CL/P) Cooperation with M. Nöthen and E. Mangold Epidemiology of nonsyndromic CL/P Prevalence among live births ~ 1 : Risk for siblings 1 : 20 1 : 25 λ s Mangold E. et al. (2010), Nature Genetics
27 Cleft lip with or without cleft palate (CL/P) Resequencing as follow up of GWAS 3 Loci on chr 8 (640Kb), 10 (161Kb) and 17 (340Kb) in 20 affected individuals MID tagging and pooling of 10 samples Enrichment using the 2.1M NimbleGen array Sequencing on a Roche GS FLX system
28 Mapping
29 Cleft lip with or without cleft palate (CL/P) Preliminary Results unique variants (>10 x Coverage) variants not listed in dbsnp (hg19) 4 coding Variants Detection of structural Variations not yet finished
30 Mutation detection pipeline quality Concordance with Affymetrix Array "genome-wide human SNP array 6.0"
31 Amplicon Sequencing Aim Detection and quantification of new and known variants METHOD Amplification and sequencing of target regions Multiple alignments of sequences against a reference reference patient sequences
32 Amplicon Sequencing A A-primer (21 bp) key MID Sequence of interest Locus specific PCR amplification MID key B B-primer (21 bp) empcr Amplification and sequencing Long reads required to sequence through the locus specific primer, enable haplotyping over longer distances 100s to 1000s of amplicon clones sequenced simultaneously
33 Amplicon Sequencing IRON Study Interlaboratory Robustness of NGS
34 Amplicon Sequencing IRON Study Hematology Focus Group
35 Amplicon Sequencing IRON Study Results per each amplicon, the median coverage eached was 713-fold, ranging from 553-fold to 878-fold a total of 92 variants (44 distinct mutations and 10 SNPs) were observed in comparison to data available from Sanger sequencing, 454 amplicon deep-sequencing detected all mutations and SNPs that were previously known we here confirm in a multicenter analysis that ampliconbased deep-sequencing is technically feasible, achieves a high concordance across multiple laboratories, and therefore allows a broad and in-depth molecular characterization of hematological malignancies. Kohlmann et al. (2011), Leukemia
36 Sensitivity of mutation detection as a function of tumor cell content Querings et al. (2011), PlosOne
37 Outlook Establishment of small scale NGS systems Analysis of complete genomes Personalized medicine
38 Acknowledgments Sequencing Facility: Ilona Hauenschild Sonia Paturej Tina Moser Ina Lehmann Norbert Merges Daniela Roth Sabrina Rau Heiner Kuhl Sven Klages Martin Werber Hans Lehrach Bernhard Herrmann Hilger Ropers Martin Vingron Michal Schweiger Martin Kerick Markus Ralser
39 Thanks for your attention!
Next generation DNA sequencing technologies. theory & prac-ce
Next generation DNA sequencing technologies theory & prac-ce Outline Next- Genera-on sequencing (NGS) technologies overview NGS applica-ons NGS workflow: data collec-on and processing the exome sequencing
The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics
The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics The GS Junior System The Power of Next-Generation Sequencing on Your Benchtop Proven technology: Uses the same long
Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research. March 17, 2011 Rendez-Vous Séquençage
Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research March 17, 2011 Rendez-Vous Séquençage Presentation Overview Core Technology Review Sequence Enrichment Application
Automated DNA sequencing 20/12/2009. Next Generation Sequencing
DNA sequencing the beginnings Ghent University (Fiers et al) pioneers sequencing first complete gene (1972) first complete genome (1976) Next Generation Sequencing Fred Sanger develops dideoxy sequencing
G E N OM I C S S E RV I C ES
GENOMICS SERVICES THE NEW YORK GENOME CENTER NYGC is an independent non-profit implementing advanced genomic research to improve diagnosis and treatment of serious diseases. capabilities. N E X T- G E
Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis
Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype
Introduction to next-generation sequencing data
Introduction to next-generation sequencing data David Simpson Centre for Experimental Medicine Queens University Belfast http://www.qub.ac.uk/research-centres/cem/ Outline History of DNA sequencing NGS
July 7th 2009 DNA sequencing
July 7th 2009 DNA sequencing Overview Sequencing technologies Sequencing strategies Sample preparation Sequencing instruments at MPI EVA 2 x 5 x ABI 3730/3730xl 454 FLX Titanium Illumina Genome Analyzer
Next Generation Sequencing
Next Generation Sequencing Technology and applications 10/1/2015 Jeroen Van Houdt - Genomics Core - KU Leuven - UZ Leuven 1 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977
SEQUENCING. From Sample to Sequence-Ready
SEQUENCING From Sample to Sequence-Ready ACCESS ARRAY SYSTEM HIGH-QUALITY LIBRARIES, NOT ONCE, BUT EVERY TIME The highest-quality amplicons more sensitive, accurate, and specific Full support for all major
History of DNA Sequencing & Current Applications
History of DNA Sequencing & Current Applications Christopher McLeod President & CEO, 454 Life Sciences, A Roche Company IMPORTANT NOTICE Intended Use Unless explicitly stated otherwise, all Roche Applied
Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS)
Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) A typical RNA Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,
Data Analysis for Ion Torrent Sequencing
IFU022 v140202 Research Use Only Instructions For Use Part III Data Analysis for Ion Torrent Sequencing MANUFACTURER: Multiplicom N.V. Galileilaan 18 2845 Niel Belgium Revision date: August 21, 2014 Page
Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center
Computational Challenges in Storage, Analysis and Interpretation of Next-Generation Sequencing Data Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center Next Generation Sequencing
Core Facility Genomics
Core Facility Genomics versatile genome or transcriptome analyses based on quantifiable highthroughput data ascertainment 1 Topics Collaboration with Harald Binder and Clemens Kreutz Project: Microarray
Genomics Services @ GENterprise
Genomics Services @ GENterprise since 1998 Mainz University spin-off privately financed 6-10 employees since 2006 Genomics Services @ GENterprise Sequencing Service (Sanger/3730, 454) Genome Projects (Bacteria,
NGS data analysis. Bernardo J. Clavijo
NGS data analysis Bernardo J. Clavijo 1 A brief history of DNA sequencing 1953 double helix structure, Watson & Crick! 1977 rapid DNA sequencing, Sanger! 1977 first full (5k) genome bacteriophage Phi X!
BRCA1 / 2 testing by massive sequencing highlights, shadows or pitfalls?
BRCA1 / 2 testing by massive sequencing highlights, shadows or pitfalls? Giovanni Luca Scaglione, PhD ------------------------ Laboratory of Clinical Molecular Diagnostics and Personalized Medicine, Institute
Single-Cell DNA Sequencing with the C 1. Single-Cell Auto Prep System. Reveal hidden populations and genetic diversity within complex samples
DATA Sheet Single-Cell DNA Sequencing with the C 1 Single-Cell Auto Prep System Reveal hidden populations and genetic diversity within complex samples Single-cell sensitivity Discover and detect SNPs,
14/12/2012. HLA typing - problem #1. Applications for NGS. HLA typing - problem #1 HLA typing - problem #2
www.medical-genetics.de Routine HLA typing by Next Generation Sequencing Kaimo Hirv Center for Human Genetics and Laboratory Medicine Dr. Klein & Dr. Rost Lochhamer Str. 9 D-8 Martinsried Tel: 0800-GENETIK
Introduction To Epigenetic Regulation: How Can The Epigenomics Core Services Help Your Research? Maria (Ken) Figueroa, M.D. Core Scientific Director
Introduction To Epigenetic Regulation: How Can The Epigenomics Core Services Help Your Research? Maria (Ken) Figueroa, M.D. Core Scientific Director Gene expression depends upon multiple factors Gene Transcription
New generation sequencing: current limits and future perspectives. Giorgio Valle CRIBI - Università di Padova
New generation sequencing: current limits and future perspectives Giorgio Valle CRIBI Università di Padova Around 2004 the Race for the 1000$ Genome started A few questions... When? How? Why? Standard
Nazneen Aziz, PhD. Director, Molecular Medicine Transformation Program Office
2013 Laboratory Accreditation Program Audioconferences and Webinars Implementing Next Generation Sequencing (NGS) as a Clinical Tool in the Laboratory Nazneen Aziz, PhD Director, Molecular Medicine Transformation
Services. Updated 05/31/2016
Updated 05/31/2016 Services 1. Whole exome sequencing... 2 2. Whole Genome Sequencing (WGS)... 3 3. 16S rrna sequencing... 4 4. Customized gene panels... 5 5. RNA-Seq... 6 6. qpcr... 7 7. HLA typing...
Targeted. sequencing solutions. Accurate, scalable, fast TARGETED
Targeted TARGETED Sequencing sequencing solutions Accurate, scalable, fast Sequencing for every lab, every budget, every application Ion Torrent semiconductor sequencing Ion Torrent technology has pioneered
DNA Sequence Analysis
DNA Sequence Analysis Two general kinds of analysis Screen for one of a set of known sequences Determine the sequence even if it is novel Screening for a known sequence usually involves an oligonucleotide
PreciseTM Whitepaper
Precise TM Whitepaper Introduction LIMITATIONS OF EXISTING RNA-SEQ METHODS Correctly designed gene expression studies require large numbers of samples, accurate results and low analysis costs. Analysis
New Technologies for Sensitive, Low-Input RNA-Seq. Clontech Laboratories, Inc.
New Technologies for Sensitive, Low-Input RNA-Seq Clontech Laboratories, Inc. Outline Introduction Single-Cell-Capable mrna-seq Using SMART Technology SMARTer Ultra Low RNA Kit for the Fluidigm C 1 System
Introduction Bioo Scientific
Next Generation Sequencing Catalog 2014-2015 Introduction Bioo Scientific Bioo Scientific is a global life science company headquartered in Austin, TX, committed to providing innovative products and superior
Genome Sequencer System. Amplicon Sequencing. Application Note No. 5 / February 2007. www.roche-applied-science.com
Genome Sequencer System Application Note No. 5 / February 2007 Amplicon Sequencing www.roche-applied-science.com 1 Amplicon Sequencing Corresponding author: Tom Jarvie, 454 Life Sciences Corporation, Branford,
Next Generation Sequencing: Technology, Mapping, and Analysis
Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University [email protected] http://tandem.bu.edu/ The Human Genome Project took
TruSeq Custom Amplicon v1.5
Data Sheet: Targeted Resequencing TruSeq Custom Amplicon v1.5 A new and improved amplicon sequencing solution for interrogating custom regions of interest. Highlights Figure 1: TruSeq Custom Amplicon Workflow
Single-Cell Whole Genome Sequencing on the C1 System: a Performance Evaluation
PN 100-9879 A1 TECHNICAL NOTE Single-Cell Whole Genome Sequencing on the C1 System: a Performance Evaluation Introduction Cancer is a dynamic evolutionary process of which intratumor genetic and phenotypic
restriction enzymes 350 Home R. Ward: Spring 2001
restriction enzymes 350 Home Restriction Enzymes (endonucleases): molecular scissors that cut DNA Properties of widely used Type II restriction enzymes: recognize a single sequence of bases in dsdna, usually
TECHNOLOGIES, PRODUCTS & SERVICES for MOLECULAR DIAGNOSTICS, MDx ABA 298
DIAGNOSTICS BUSINESS ANALYSIS SERIES: TECHNOLOGIES, PRODUCTS & SERVICES for MOLECULAR DIAGNOSTICS, MDx ABA 298 By ADAMS BUSINESS ASSOCIATES MAY 2014. May 2014 ABA 298 1 Technologies, Products & Services
DNA Sequencing & The Human Genome Project
DNA Sequencing & The Human Genome Project An Endeavor Revolutionizing Modern Biology Jutta Marzillier, Ph.D Lehigh University Biological Sciences November 13 th, 2013 Guess, who turned 60 earlier this
Genomic Applications on Cray supercomputers: Next Generation Sequencing Workflow. Barry Bolding. Cray Inc Seattle, WA
Genomic Applications on Cray supercomputers: Next Generation Sequencing Workflow Barry Bolding Cray Inc Seattle, WA 1 CUG 2013 Paper Genomic Applications on Cray supercomputers: Next Generation Sequencing
Introduction To Real Time Quantitative PCR (qpcr)
Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors
Consistent Assay Performance Across Universal Arrays and Scanners
Technical Note: Illumina Systems and Software Consistent Assay Performance Across Universal Arrays and Scanners There are multiple Universal Array and scanner options for running Illumina DASL and GoldenGate
Illumina Sequencing Technology
Illumina Sequencing Technology Highest data accuracy, simple workflow, and a broad range of applications. Introduction Figure 1: Illumina Flow Cell Illumina sequencing technology leverages clonal array
Oncology Insights Enabled by Knowledge Base-Guided Panel Design and the Seamless Workflow of the GeneReader NGS System
White Paper Oncology Insights Enabled by Knowledge Base-Guided Panel Design and the Seamless Workflow of the GeneReader NGS System Abstract: This paper describes QIAGEN s philosophy and process for developing
Accelerate genomic breakthroughs in microbiology. Gain deeper insights with powerful bioinformatic tools.
Accelerate genomic breakthroughs in microbiology. Gain deeper insights with powerful bioinformatic tools. Empowering microbial genomics. Extensive methods. Expansive possibilities. In microbiome studies
How many of you have checked out the web site on protein-dna interactions?
How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss
Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals
Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals Xiaohui Xie 1, Jun Lu 1, E. J. Kulbokas 1, Todd R. Golub 1, Vamsi Mootha 1, Kerstin Lindblad-Toh
Bioanalyzer Applications for
Bioanalyzer Applications for Next-Gen Sequencing: Updates and Tips March 1 st, 2011 Charmian Cher, Ph.D Field Applications Scientist Page 1 Agenda 1 2 3 Next-gen sequencing library preparation workflow
Introduction to NGS data analysis
Introduction to NGS data analysis Jeroen F. J. Laros Leiden Genome Technology Center Department of Human Genetics Center for Human and Clinical Genetics Sequencing Illumina platforms Characteristics: High
GeneSifter: Next Generation Data Management and Analysis for Next Generation Sequencing
for Next Generation Sequencing Dale Baskin, N. Eric Olson, Laura Lucas, Todd Smith 1 Abstract Next generation sequencing technology is rapidly changing the way laboratories and researchers approach the
Focusing on results not data comprehensive data analysis for targeted next generation sequencing
Focusing on results not data comprehensive data analysis for targeted next generation sequencing Daniel Swan, Jolyon Holdstock, Angela Matchan, Richard Stark, John Shovelton, Duarte Mohla and Simon Hughes
Next Generation Sequencing for DUMMIES
Next Generation Sequencing for DUMMIES Looking at a presentation without the explanation from the author is sometimes difficult to understand. This document contains extra information for some slides that
Disease gene identification with exome sequencing
Disease gene identification with exome sequencing Christian Gilissen Dept. of Human Genetics Radboud University Nijmegen Medical Centre [email protected] Contents Infrastructure Exome sequencing
The University is comprised of seven colleges and offers 19. including more than 5000 graduate students.
UNC CHARLOTTE A doctoral, research-intensive university, UNC Charlotte is the largest institution of higher education in the Charlotte region. The University is comprised of seven colleges and offers 19
Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company
Genetic engineering: humans Gene replacement therapy or gene therapy Many technical and ethical issues implications for gene pool for germ-line gene therapy what traits constitute disease rather than just
UKB_WCSGAX: UK Biobank 500K Samples Genotyping Data Generation by the Affymetrix Research Services Laboratory. April, 2015
UKB_WCSGAX: UK Biobank 500K Samples Genotyping Data Generation by the Affymetrix Research Services Laboratory April, 2015 1 Contents Overview... 3 Rare Variants... 3 Observation... 3 Approach... 3 ApoE
Leading Genomics. Diagnostic. Discove. Collab. harma. Shanghai Cambridge, MA Reykjavik
Leading Genomics Diagnostic harma Discove Collab Shanghai Cambridge, MA Reykjavik Global leadership for using the genome to create better medicine WuXi NextCODE provides a uniquely proven and integrated
Next Generation Sequencing; Technologies, applications and data analysis
; Technologies, applications and data analysis Course 2542 Dr. Martie C.M. Verschuren Research group Analysis techniques in Life Science, Breda Prof. dr. Johan T. den Dunnen Leiden Genome Technology Center,
Delivering the power of the world s most successful genomics platform
Delivering the power of the world s most successful genomics platform NextCODE Health is bringing the full power of the world s largest and most successful genomics platform to everyday clinical care NextCODE
A Primer of Genome Science THIRD
A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:
Genetic diagnostics the gateway to personalized medicine
Micronova 20.11.2012 Genetic diagnostics the gateway to personalized medicine Kristiina Assoc. professor, Director of Genetic Department HUSLAB, Helsinki University Central Hospital The Human Genome Packed
An Overview of DNA Sequencing
An Overview of DNA Sequencing Prokaryotic DNA Plasmid http://en.wikipedia.org/wiki/image:prokaryote_cell_diagram.svg Eukaryotic DNA http://en.wikipedia.org/wiki/image:plant_cell_structure_svg.svg DNA Structure
LifeScope Genomic Analysis Software 2.5
USER GUIDE LifeScope Genomic Analysis Software 2.5 Graphical User Interface DATA ANALYSIS METHODS AND INTERPRETATION Publication Part Number 4471877 Rev. A Revision Date November 2011 For Research Use
Bioruptor NGS: Unbiased DNA shearing for Next-Generation Sequencing
STGAAC STGAACT GTGCACT GTGAACT STGAAC STGAACT GTGCACT GTGAACT STGAAC STGAAC GTGCAC GTGAAC Wouter Coppieters Head of the genomics core facility GIGA center, University of Liège Bioruptor NGS: Unbiased DNA
Next Generation Sequencing. mapping mutations in congenital heart disease
Next Generation Sequencing mapping mutations in congenital heart disease AV Postma PhD Academic Medical Center Amsterdam, the Netherlands Overview talk Congenital heart disease and genetics Next generation
Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
NGS Technologies for Genomics and Transcriptomics
NGS Technologies for Genomics and Transcriptomics Massimo Delledonne Department of Biotechnologies - University of Verona http://profs.sci.univr.it/delledonne 13 years and $3 billion required for the Human
Computational Genomics. Next generation sequencing (NGS)
Computational Genomics Next generation sequencing (NGS) Sequencing technology defies Moore s law Nature Methods 2011 Log 10 (price) Sequencing the Human Genome 2001: Human Genome Project 2.7G$, 11 years
Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms
Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms Introduction Mate pair sequencing enables the generation of libraries with insert sizes in the range of several kilobases (Kb).
School of Nursing. Presented by Yvette Conley, PhD
Presented by Yvette Conley, PhD What we will cover during this webcast: Briefly discuss the approaches introduced in the paper: Genome Sequencing Genome Wide Association Studies Epigenomics Gene Expression
Description: Molecular Biology Services and DNA Sequencing
Description: Molecular Biology s and DNA Sequencing DNA Sequencing s Single Pass Sequencing Sequence data only, for plasmids or PCR products Plasmid DNA or PCR products Plasmid DNA: 20 100 ng/μl PCR Product:
Genotyping by sequencing and data analysis. Ross Whetten North Carolina State University
Genotyping by sequencing and data analysis Ross Whetten North Carolina State University Stein (2010) Genome Biology 11:207 More New Technology on the Horizon Genotyping By Sequencing Timeline 2007 Complexity
Next Generation Sequencing; Technologies, applications and data analysis
; Technologies, applications and data analysis Course 2542 Dr. Martie C.M. Verschuren Research group Analysis techniques in Life Science, Breda Prof. dr. Johan T. den Dunnen Leiden Genome Technology Center,
How is genome sequencing done?
How is genome sequencing done? Using 454 Sequencing on the Genome Sequencer FLX System, DNA from a genome is converted into sequence data through four primary steps: Step One DNA sample preparation; Step
Rapid Aneuploidy and CNV Detection in Single Cells using the MiSeq System
i Technical Note: Reproductive Health Rapid Aneuploidy and CNV Detection in Single Cells using the MiSeq System Comparison between data generated from single cells using 24sure array-based screening and
Biomedical Big Data and Precision Medicine
Biomedical Big Data and Precision Medicine Jie Yang Department of Mathematics, Statistics, and Computer Science University of Illinois at Chicago October 8, 2015 1 Explosion of Biomedical Data 2 Types
An example of bioinformatics application on plant breeding projects in Rijk Zwaan
An example of bioinformatics application on plant breeding projects in Rijk Zwaan Xiangyu Rao 17-08-2012 Introduction of RZ Rijk Zwaan is active worldwide as a vegetable breeding company that focuses on
Handling next generation sequence data
Handling next generation sequence data a pilot to run data analysis on the Dutch Life Sciences Grid Barbera van Schaik Bioinformatics Laboratory - KEBB Academic Medical Center Amsterdam Very short intro
Forensic DNA Testing Terminology
Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.
Bioinformatics Unit Department of Biological Services. Get to know us
Bioinformatics Unit Department of Biological Services Get to know us Domains of Activity IT & programming Microarray analysis Sequence analysis Bioinformatics Team Biostatistical support NGS data analysis
FOR REFERENCE PURPOSES
BIOO LIFE SCIENCE PRODUCTS FOR REFERENCE PURPOSES This manual is for Reference Purposes Only. DO NOT use this protocol to run your assays. Periodically, optimizations and revisions are made to the kit
Overview of Genetic Testing and Screening
Integrating Genetics into Your Practice Webinar Series Overview of Genetic Testing and Screening Genetic testing is an important tool in the screening and diagnosis of many conditions. New technology is
GenomeStudio Data Analysis Software
GenomeStudio Analysis Software Illumina has created a comprehensive suite of data analysis tools to support a wide range of genetic analysis assays. This single software package provides data visualization
TGC AT YOUR SERVICE. Taking your research to the next generation
TGC AT YOUR SERVICE Taking your research to the next generation 1. TGC At your service 2. Applications of Next Generation Sequencing 3. Experimental design 4. TGC workflow 5. Sample preparation 6. Illumina
An Introduction to Next-Generation Sequencing Technology
An Introduction to Next-eneration Sequencing Technology Deciphering DNA sequences is essential for virtually all branches of biological research. With the advent of capillary electrophoresis (CE)-based
ncounter Leukemia Fusion Gene Expression Assay Molecules That Count Product Highlights ncounter Leukemia Fusion Gene Expression Assay Overview
ncounter Leukemia Fusion Gene Expression Assay Product Highlights Simultaneous detection and quantification of 25 fusion gene isoforms and 23 additional mrnas related to leukemia Compatible with a variety
RNAseq / ChipSeq / Methylseq and personalized genomics
RNAseq / ChipSeq / Methylseq and personalized genomics 7711 Lecture Subhajyo) De, PhD Division of Biomedical Informa)cs and Personalized Biomedicine, Department of Medicine University of Colorado School
Go where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe
Go where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe Go where the biology takes you. To published results faster With proven scalability To the forefront of discovery To limitless applications
NEXT GENERATION SEQUENCING
NEXT GENERATION SEQUENCING Dr. R. Piazza SANGER SEQUENCING + DNA NEXT GENERATION SEQUENCING Flowcell NEXT GENERATION SEQUENCING Library di DNA Genomic DNA NEXT GENERATION SEQUENCING NEXT GENERATION SEQUENCING
Next Generation Sequencing; Technologies, applications and data analysis
; Technologies, applications and data analysis Course 2542 Dr. Martie C.M. Verschuren Avans Hogeschool Research group Analysis techniques in Life Science, Breda Prof. dr. Johan T. den Dunnen Leiden Genome
14.3 Studying the Human Genome
14.3 Studying the Human Genome Lesson Objectives Summarize the methods of DNA analysis. State the goals of the Human Genome Project and explain what we have learned so far. Lesson Summary Manipulating
Analysis of gene expression data. Ulf Leser and Philippe Thomas
Analysis of gene expression data Ulf Leser and Philippe Thomas This Lecture Protein synthesis Microarray Idea Technologies Applications Problems Quality control Normalization Analysis next week! Ulf Leser:
Investigating the genetic basis for intelligence
Investigating the genetic basis for intelligence Steve Hsu University of Oregon and BGI www.cog-genomics.org Outline: a multidisciplinary subject 1. What is intelligence? Psychometrics 2. g and GWAS: a
Concepts and methods in sequencing and genome assembly
BCM-2004 Concepts and methods in sequencing and genome assembly B. Franz LANG, Département de Biochimie Bureau: H307-15 Courrier électronique: [email protected] Outline 1. Concepts in DNA and RNA
Intro to Bioinformatics
Intro to Bioinformatics Marylyn D Ritchie, PhD Professor, Biochemistry and Molecular Biology Director, Center for Systems Genomics The Pennsylvania State University Sarah A Pendergrass, PhD Research Associate
How To Get A Cell Print
QUICK CELL CAPTURE AND CHARACTERIZATION GUIDE FOR CELLSEARCH CUSTOMERS CellSave EDTA Blood sample Rare cell capture Enumeration Single protein marker Cell capture for molecular characterization CELLSEARCH
Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources
Appendix 2 Molecular Biology Core Curriculum Websites and Other Resources Chapter 1 - The Molecular Basis of Cancer 1. Inside Cancer http://www.insidecancer.org/ From the Dolan DNA Learning Center Cold
