MOL.911 HNL Expression

1 W I S S E N T E C H N I K L E I D E N S C H A F T MOL.911 HNL Expression www.tugraz.at

2 Hydroxynitrile lyase (Hnl) R 1 HCN R 1 OH R 2 C O R 2 C * CN S selective: Hevea brasiliensis R selective: Prunus spp.

3 (S) Hnl of Hevea brasiliensis and (R) Hnl of Prunus amygdalus Hb_Hnl Type II Hnl intracellular protein 29.2 kda homodimer / hydrolase fold protein catalytic triad (S) selektive Pam_Hnl Type I Hnl secretory protein 61 kda ( 57.9 kda) Homology to oxidases FAD N glycosylated isoenzymes (R) selektive

4 3 D structure of Hb_HNL C81 K236 S80 H235 D207

5 Intracellular Hnl Expression in Escherichia coli Translational Coupling ATG...AATAAGGAGAATAAACCATGGCATTC Met...AsnLysGluGlu * MetAlaPhe mini-cistron SD NcoI Hnl ORF P trc HbHnl ORF T rrnb pse420 phnl-200

6 Soluble

7 Intracellular Hnl Expression in Saccharomyces cerevisiae and Pichia pastoris ATTATTCGAACGAGGCCATGGCATTC EcoRI MetAlaPhe Hnl ORF AAAGATCCCCCGGGCTGCAGGAATTCCATGGCATTC Hnl ORF BamHI/BglI MetAlaPhe P AOX PGK Hnl ORF T PGK AOX phild2 pma91 phnl-400 phnl-300

8 Secretory Hnl Expression in Saccharomyces cerevisiae and Pichia pastoris XbaI MF 1-leader GGGGTATCTCTCGAGAAAAGAGAGGCATTC GlyValSerLeuGluLysArgGluAlaPhe Hnl ORF P AOX PGK P.pastoris AOX1 Promoter Hnl ORF phnl-401 T PGK AOX phild2 pma91 Vector basis S.cerevisiae PGK Promoter phnl-309

9 Secretion targeted Hb_Hnl accumulates in the cell periphery intracellular secretory Direction of a naturally intracellularly expressed protein into the secretory pathway leads to accumolation in the cell membrane

10 Hb Hnl expression in filamentous fungi P gpd Hnl ORF T trpc panhnl P gla Hnl ORF T trpc pglahnl P uce aox Hnl ORF T pucehnl trpc paoxhnl P gla SS gla24 Hnl ORF T trpc pglass1hnl P gpd P gla P P aox gla SS gla24 Hnl ORF T trpc p***hnl pyrg pyrg gpd: A.niger glyceraldehydephosphate dehydrogenase gla: A.awamori glucoamylase uce: unknown constitutively expressed gene, P.chrysogenum aox: P.chrysogenum alcohol oxidase

11 Intracellular Hnl Expression in Penicillium chrysogenum under control of P AOX P AOX Termination Problem AOX: Penicillium chrysogenum Alcohol Oxidase Hnl ORF T paoxhnl TrpC P AOX Hnl ORF T AOX paoxhnl Ta paoxhnl TaT P AOX Hnl ORF T AOX T TrpC

12 Southern analysis of Penicillium chrysogenum P AOX transformants 1 2 3 4 5 6 7 8 9 10 11 1 2 3 4 5 6 7 8 9 10 11 paoxhnl TaT B Multiple ectopic integration paoxhnl Ta

13 Northern blot analysis of Penicillium chrysogenum P AOX transformants paoxhnl TaT 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 C 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 Hnl probe C Actin probe

14 Western blot analysis of Penicillium chrysogenum P AOX transformants Protease Problems Total cellular proteins SDS PAGE Western blot with Hnl Antibody 1 2 3 4 5 6 7 8 9 1 2 3 4 5 6 7 8 9 10 B 97 kd 66 kd 45 kd paoxhnl TaT 97 kd 66 kd 45 kd A 31 kd 21 kd 14 kd 66 kd 45 kd 31 kd 21 kd 14 kd A 31 kd 21 kd 14 kd Hnl paoxhnl Ta 97 kd 66 kd 45 kd 31 kd 21 kd 14 kd Degradation!

15 Expression analysis of Penicillium chrysogenum P AOX transformants AOX Promoter Activity Test uida: Reporter gene, ß glucuronidase paoxhnl TaT Hnl Expression negative control AOX::uidA fusion 2% lactose ph 8 Blue colour = cleavage of X Glucose by ß glucuronidase v.i. 2 3 4 5 6 7 8 9 10 purified HNL

16 Gene replacement in Pichia pastoris at AOX1 NotI AOX1 promoter HIS4 selection marker AOX1 transcription termination signal 3 AOX1 region Amp R F1 ori ColE1 replicon NotI 5 P AOX1 Gene o.i. TT HIS4 3 AOX1 Mut s 5 AOX1 TT 3

17 Pichia pastoris Hb_Hnl expression strain 1 17 Fed batch fermentation 500 40 Cell density [OD600] 400 300 200 100 0 Cell density Methanol Hnl-activity 0 0 50 100 150 200 250 300 time [h] 30 20 10 specific Hnl-activity [U/mg]

18 Pichia pastoris Hb_Hnl expression strain 1 17 Fed batch fermentation Fermentation time (hours after induction) 0 15 27 29 49 63 79 87 97 ST 111 119 135 145 151 159 169 194 ST Soluble proteins in cell extracts

19 Heterologous Hnl Expression (shake flask experiments) Construct Host cytosol (U/mg) purified enzyme (U/mg) total per culture Hevea brasiliensis phnl 200 E. coli phnl 300 S. cerevisiae phnl 400 P. pastoris panhnl A. niger 0.42 15 20 0.5 U/g (leaves) 0.6 0.1 U/ml OD=4 4.6 20 1.2 U/ml OD=4 15.7 40 6.2 U/ml OD=4 0.6 ~ 0.1 U/ml nd

20 Production of Hb_Hnl with Pichia pastoris Expression System ( Fed Batch Fermentation) Cell wet weight Cell dry weight Total protein Hnl protein Hnl units 400 g / l 100 g / l 56 g / l 23 g / l 1.4 x 10 6 / l

21 (S) Hnl of Hevea brasiliensis and (R) Hnl of Prunus amygdalus Hb_Hnl Type II Hnl intracellular protein 29.2 kda homodimer / hydrolase fold protein catalytic triad (S) selektive Pam_Hnl Type I Hnl secretory protein 61 kda ( 57.9 kda) Homology to oxidases FAD N glycosylated isoenzymes (R) selektive

22 Pam_Hnl5: Secretory Expression of Prunus amygdalus (R) Hnl in Pichia pastoris P AOX1 SS Hnl ORF TT HIS4 3 AOX1 Host: Pichia pastoris GS115 Endo H d n u EndoF u Endo F n d Alpha factor signal sequence 97 kda Mut s and Mut + Transformants 66 kda 39 kda Functional secretory expression 27 kda highly glycosylated 21 kda 14 kda

23 High level Expression Clone D1 17??? Super expression strain D1 17 Standard expression clone Hnl wt great success with expression Engineered Hnl Proteins do it the same way! High expression levels were Not Reproducible!!

24 High level Expression Clone D1 17??? ATTATTCGAACGAGGCCATGGCATTC MetAlaPhe EcoRI Hnl ORF phnl 400 P AOX Hnl ORF T AOX phild2 Intracellular Hnl Expression in Pichia pastoris Hasslacher et al., Prot.Expr.Purif., 1997 Not the Problem!

25 Molecular Analysis of Expression Strain Southern blotting HNL probe Strange Fragments AOX1 Probe More than one Copy Integrated How??

26 Molecular Analysis of Expression Strain ~ 400 bp Deletion Hnl Δ 383 bp Δ 29 bp Hnl Tandem Integration head to head (divergent) P AOX1 P AOX1 3 copies of Hnl, 1 standard Integration in AOX1 Locus 2 truncated, in a head to head oriented AOX1 Promoter Fragments

27 phhaox561( HbHNLwt) Expression analysis Expression phhaox915( HbHNLwt) paoxgrazlang( HbHNLwt) paoxgrazshort( HbHNLwt) paoxgraztotal( HbHNLwt) single copy D1.17

28 Specific genomic setup Hartner et al., Nucleic Acids Research, 2008, Vol. 36, Specific complex?? Concerted action of activators?? Repression active site deleted??

29 CYC1 transcription termination TEF1 promoter Zeocin EM7 promoter EcoRV (6610) 3 AOX1 XmnI (6164) EcoRV (7578) EheI (5801) BglI (7445) EheI (5687) EheI (5666) XmnI (5160) hh Expression vector ColE1 ori phhaox 561-HbHNL wt 8568 bp HIS4 BglII (2) paox1- hh SalI (4211) HindIII (74) BglI (3622) XmnI (3728) EheI (3766) KpnI (3837) 1.17 hhaox1 long BglI (676) 1.17 hhaox1 short KpnI (3225) HindIII (1413) EcoRI (1484) NdeI (1527) HbHNL wt NotI (2269) XmnI (2280) 3 AOX transcription termina HindIII (2615) HindIII (2627) EcoRV (2785) GOI

30 Expression of Hb_Hnl mutants in Pichia pastoris Super expression strain D1 17 Standard expression clone Novel expression clones Modified hh AOX1 based promoter System Intracellular Expression Hnl

31 Screening for High level Expression Screening systems based on principle of translational coupling Well known in Prokayotes Does it work in Eukaryotes??? P AOX1 Hb_HNL Sh_ble 3 AOX1 Zeocin R 5 Cap 3 Poly A ATG Stop Hb_Hnl Veeresh Juturu, PhD Thesis Stop Start NNNUGAATGNNN. Bicistronic system 1 mrna, 2 Proteins Sh_Ble

32 Correlating Hnl expression to zeocin resistance Veeresh Juturu, PhD Thesis Increasing Zeocin Concentration MD 4.9x10 4 BMMS 4.9x10 4 BMMS 4.9x10 4 50 µg/ml BMMS 4.9x10 4 100 µg/ml BMMS 4.9x10 4, 150 µg/ml

33 Hnl expression Screen for High Resistance Check for Expression Level A B C D E F 1 2 3 4 5 6 7 8 50 mg/l Zeocin 150 mg/l Zeocin Controls + ++ Single copy D1 17 Row A Clones from BMMS 50 µg/ml Zeo Row C Clones from BMMS 150 µg/ml Zeo Lane 1D 1F GFP expressing strain ( control) Lane 4D 4F P. pastoris HNL single copy strain (+ control) Lane 8D 8F P. pastoris HNL multi copy strain (+ control)