R. Landstorfer et al. BMC Genomics, Audrey Segura
|
|
- Laurence Lewis
- 7 years ago
- Views:
Transcription
1 Comparison of strand-specific transcriptomes of enterohemorrhagic Escherichia coli O157:H7 EDL933 under eleven different environmental conditions including radish sprouts and cattle feces R. Landstorfer et al. BMC Genomics, 2014 Audrey Segura Journal Club of Microbiology, 18 th of November
2 Enterohemorrhagic E. coli (EHEC) Worldwide zoonotic foodborne pathogen o Hemorrhagic colitis o Hemolytic uremic syndrome : HUS (kidney failure) EHEC serotype O157:H7: most outbreaks and sporadic cases of HUS Public health problem: no therapy in humans (antibiotics treatment under debate) 2
3 Carriage of EHEC Major reservoir of EHEC strains: gastrointestinal tract of ruminants Fecal shedding Contamination of the environment Outbreak in US, 2006 (Uhlich et al., 2008) Outbreak in Japan, 1996 (Watanabe et al., 1999) Multiple infection sources Large environmental niches of EHEC Outbreak in US, 1996 (CDC, 1997) 3
4 Ecology of EHEC Ecology of this pathogen outside its human host unknown EHEC strains persistent in environment (Semenov et al., 2010) Large spectrum of environmental niches of EHEC (water, plants, animals) (Duffitt et al., 2011 ; Barker et al., 1999) Lack of global approaches to investigate gene regulation of EHEC from a broad environmental spectrum o Classical techniques are not enough sensitive o Many genes are not characterized: annotated as hypothetical genes 4
5 Hypothetical genes in EHEC 1/3 of the genes of EHEC annotated as hypothetical encoding proteins that do not have homology with any other protein Sequencing Genome Transcriptomic Prediction of hypothetical genes No evidence for the expression of these genes Confirmation of the expression of the hypothetical genes 5
6 Aim of the study To identify genes of EHEC involved in environmental and plant persitence with a special focus on hypothetical genes from a large variety of ecological niches Approach used: Strand-specific RNA-seq to EHEC Sequencing the transcriptome of EHEC O157:H7 under several culture conditions 6
7 Strain and culture conditions Strain: E. coli O157:H7 EDL933 Culture conditions: -LB : reference medium, 37 C -LB-15 C -LB-pH9 -LB-pH4 -LB-nitrite ph6: 200 mg/l sodium nitrite -LB-antibiotics: sulfamethoxazole + trimethoprim -LB-solid -M9 minimal medium (MM) -Spinach (extract) -Radish sprouts -Cattle feces RNA extraction when bacteria enter the stationary growth phase Strand-specific RNA-Seq: SOLiD System and Illumina System 7
8 Test the reproducibility of the sequencing process Sequencing of two technical replicates by SOLiD System Comparison of RPKM values of each replicate Coefficient correlation R 2 = 1 Combinaison of technical replicates for further analysis Sequencing of two biological replicates on two different plateforms: SOLiD System and Illumina System Comparison of RPKM values of each replicates for each plateform Coefficient correlation R 2 =
9 Sequencing results: number of reads Genome size: bp Plasmid size: bp (1.7%) 26.1 millions reads mapped to the EHEC genome and the plasmid po157 9
10 Sequencing results: expression of annotated gene Annotated gene in EDL933: 5379 genes Determination of the number of transcribed genes by an estimation of a threshold of backgroung transcription Statistical evaluation to classify genes into «active» or «inactive» 5142 transcribed genes (96%) of which 4877 significantly regulated (log 2 -Fold Change 3 or -1) Number of transcribed genes differs for different conditions 10
11 Sequencing results: in LB-antibiotics and feces conditions LB-antibiotics: lowest number of transcribed genes In feces : low number of transcribed genes compared to sprouts or spinach juice EHEC require more transcribed genes to survive in other conditions 11
12 Sequencing results: hypothetical genes Annotated hypothetical genes in EDL933: 1771 transcribed genes (32.9%) 1559 significantly regulated genes (log 2 -Fold Change 3 or -1) Number of hypothetical genes highly regulated (log 2 -Fold Change 5) Culture conditions Number of hypothetical gene LB-15 C 3 Minimal medium 14 LB-pH9 0 LB-pH4 3 LB-nitrite 1 LB-antibiotics 26 LB-solid 2 Spinach 9 Radish sprouts 9 Cattle feces 13 12
13 Transcription of genes in cattle feces Regulated known genes in feces: - Metabolic enzymes (glycogen metabolism) - Macromolecule-protection - Associated to cellular or membrane stress Hypothetical up-regulated genes in feces (13): - ycdt: involved in biofilm formation - Membrane protein involved in the metabolism of glucuronate (Ramos et al., 2005), also active during human infection (John et al., 2005) Several regulated genes allowing the survival of EHEC in cattle feces Most are associated to cellular or membrane stress In the colon of ruminant: EHEC under environmental stress? 13
14 Gene expression on radish sprouts (1) Very well growth of EHEC on radish sprouts Sprouts incoculated with 4x10 2 CFU/g plant Regulated genes associated to sugar degradation: fructose, trehalose, arabinose EHEC able to use sugars secreted by plants as carbon sources Regulated genes associated to the response to stress - azor: bacterial azoreductase environmental role unknown (Feng et al., 2012) Azo dyes (class of colorant carcinogenic) Severe environmental problem AZOREDUCTASE NADPH NADP + Reduction of azo dyes (destruction) High induction = Detoxification of plant metabolites directed against bacteria? 14
15 Gene expression on radish sprouts (2) Regulated genes associated to adhesion on the plant surface -csggfedba: curli fiber genes Major factor for the formation of biofilm (Brombacher et al., 2006) Associated to adhesion to plants (Saldana et al., 2011) -bsss: regulatory gene for biofilm formation (Domka et al., 2006) -9 hypothetical genes only regulated on sprouts: biofilm growth and formation (Schambri et al., 2003 ; Hancock et al., 2010) Formation of biofilms on plant surfaces using curli Radish sprouts = Suitable habitat for EHEC survival and proliferation 15
16 Transcriptional pattern of regulated genes Up-regulated genes colored in blue Down-regulated genes colored in red Compared to LB-condition LB-based experiments clustering together except LB-antibiotics: - No growth, cell elongation - Block of DNA synthesis - Genes down-regulated LB-antibiotics condition: outer group Spinach medium and MM : more related regulational pattern Low nutrient content Cattle feces: outer group 16
17 Gene expression in the presence of antibiotics Condition with lowest number of regulated genes Highly up-regulated genes: most originate from prophages -CP-933V -BP-933W Encode the shiga-toxin Condition with highest number of hypothetical regulated genes (26) 16/26 antibiotic-induced hypotheticals are encoded by prophages Hypothetical genes Product References Z0314 and Z0316 High similarities to phage tail fiber of CP-933H This study Z1434 High similarities to phage tail fiber of CP-933W John et al., 2005 Z3371 Unknown protein of the prophage CP-933V This study Antibiototics = SOS-response = phage replication = clinical complications 17
18 Conclusions and discussion (1) Distinguishing weakly transcribed genes from background transcription Classification of genes into «active» or «inactive» by statistical evaluation Discovery of a unique set of «active» genes for each culture condition Several hypothetical genes found to be «active» = new candidates for a detailed functional description (new roles for genes) Adaptation of EHEC to different environmental niches 18
19 Conclusions and discussion (2) EHEC ON CATTLE FECES: Growth and survival of EHEC under environmental stress In this study: Method does not reflect what s happen in environment No confirmation about genes involved in environment persistence in cattle feces EHEC ON RADISH SPROUTS: Growth and survival of EHEC (use plant-specific carbon sources, form biofilm, induce stress response) azor: detoxification role in nature? Test natural plant substances for azor induction Test the behavior of EHEC and other pathogens in nature (ΔazoR mutant) In this study: Mono-association of EHEC and sprouts No confirmation whether plants serve as a natural reservoir of EHEC 19
20 EHEC as a «vegetarian» EHEC able to survive and proliferate in plants (Hou et al., 2013) Possible «vegetarian» life style of EHEC? Some genes induced in EHEC on radish sprouts are found in other plant pathogens To scan the EHEC genome for homologous genes from other plant bacteria which are known to be induced in the respective niche To see if EHEC can develop in this niche and which genes are induced 20
Gene Transcription in Prokaryotes
Gene Transcription in Prokaryotes Operons: in prokaryotes, genes that encode protein participating in a common pathway are organized together. This group of genes, arranged in tandem, is called an OPERON.
More informationHow To Understand How Gene Expression Is Regulated
What makes cells different from each other? How do cells respond to information from environment? Regulation of: - Transcription - prokaryotes - eukaryotes - mrna splicing - mrna localisation and translation
More informationMilestones of bacterial genetic research:
Milestones of bacterial genetic research: 1944 Avery's pneumococcal transformation experiment shows that DNA is the hereditary material 1946 Lederberg & Tatum describes bacterial conjugation using biochemical
More informationGreen Fluorescent Protein (GFP): Genetic Transformation, Synthesis and Purification of the Recombinant Protein
Green Fluorescent Protein (GFP): Genetic Transformation, Synthesis and Purification of the Recombinant Protein INTRODUCTION Green Fluorescent Protein (GFP) is a novel protein produced by the bioluminescent
More informationBacterial Transformation and Plasmid Purification. Chapter 5: Background
Bacterial Transformation and Plasmid Purification Chapter 5: Background History of Transformation and Plasmids Bacterial methods of DNA transfer Transformation: when bacteria take up DNA from their environment
More informationTransfection-Transfer of non-viral genetic material into eukaryotic cells. Infection/ Transduction- Transfer of viral genetic material into cells.
Transfection Key words: Transient transfection, Stable transfection, transfection methods, vector, plasmid, origin of replication, reporter gene/ protein, cloning site, promoter and enhancer, signal peptide,
More informationU.S. Meat Animal Research Center Clay Center, NE
Agricultural Research Clay Center, NE The (USMARC) was authorized by Congress on June 16, 1964, following transfer of the Naval Ammunition Depot from the Department of Defense to the Department of Agriculture.
More informationTwincore - Zentrum für Experimentelle und Klinische Infektionsforschung Institut für Molekulare Bakteriologie
Twincore - Zentrum für Experimentelle und Klinische Infektionsforschung Institut für Molekulare Bakteriologie 0 HELMHOLTZ I ZENTRUM FÜR INFEKTIONSFORSCHUNG Technische Universität Braunschweig Institut
More informationCHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA
CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA INTRODUCTION DNA : DNA is deoxyribose nucleic acid. It is made up of a base consisting of sugar, phosphate and one nitrogen base.the
More informationTransmission of genetic variation: conjugation. Transmission of genetic variation: conjugation
Transmission of genetic variation: conjugation Transmission of genetic variation: conjugation Bacterial Conjugation is genetic recombination in which there is a transfer of DNA from a living donor bacterium
More informationLecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION. Professor Bharat Patel Office: Science 2, 2.36 Email: b.patel@griffith.edu.
Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION Professor Bharat Patel Office: Science 2, 2.36 Email: b.patel@griffith.edu.au What is Gene Expression & Gene Regulation? 1. Gene Expression
More informationMDM. Metabolic Drift Mutations - Attenuation Technology
MDM Metabolic Drift Mutations - Attenuation Technology Seite 2 Origin of MDM attenuation technology Prof. Dr. Klaus Linde Pioneer in R&D of human and animal vaccines University of Leipzig Germany Origin
More informationStructure and Function of DNA
Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four
More informationrestriction enzymes 350 Home R. Ward: Spring 2001
restriction enzymes 350 Home Restriction Enzymes (endonucleases): molecular scissors that cut DNA Properties of widely used Type II restriction enzymes: recognize a single sequence of bases in dsdna, usually
More informationCompartmentalization of the Cell. Objectives. Recommended Reading. Professor Alfred Cuschieri. Department of Anatomy University of Malta
Compartmentalization of the Cell Professor Alfred Cuschieri Department of Anatomy University of Malta Objectives By the end of this session the student should be able to: 1. Identify the different organelles
More informationCHAPTER 6 GRIFFITH/HERSHEY/CHASE: DNA IS THE GENETIC MATERIAL IDENTIFICATION OF DNA DNA AND HEREDITY DNA CAN GENETICALLY TRANSFORM CELLS
CHAPTER 6 GRIFFITH/HERSHEY/CHASE: DNA IS THE GENETIC MATERIAL In 1928, Frederick Griffith was able to transform harmless bacteria into virulent pathogens with an extract that Oswald Avery proved, in 1944,
More informationMedical Microbiology Culture Media :
Lecture 3 Dr. Ismail I. Daood Medical Microbiology Culture Media : Culture media are used for recognition and identification (diagnosis) of microorganisms. The media are contained in plates (Petri dishes),
More informationFACULTY OF MEDICAL SCIENCE
Doctor of Philosophy Program in Microbiology FACULTY OF MEDICAL SCIENCE Naresuan University 171 Doctor of Philosophy Program in Microbiology The time is critical now for graduate education and research
More informationBacterial Transformation with Green Fluorescent Protein. Table of Contents Fall 2012
Bacterial Transformation with Green Fluorescent Protein pglo Version Table of Contents Bacterial Transformation Introduction..1 Laboratory Exercise...3 Important Laboratory Practices 3 Protocol...... 4
More informationGENE CLONING AND RECOMBINANT DNA TECHNOLOGY
GENE CLONING AND RECOMBINANT DNA TECHNOLOGY What is recombinant DNA? DNA from 2 different sources (often from 2 different species) are combined together in vitro. Recombinant DNA forms the basis of cloning.
More informationBiotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College
Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology
More informationStudent name ID # 2. (4 pts) What is the terminal electron acceptor in respiration? In photosynthesis? O2, NADP+
1. Membrane transport. A. (4 pts) What ion couples primary and secondary active transport in animal cells? What ion serves the same function in plant cells? Na+, H+ 2. (4 pts) What is the terminal electron
More informationBacterial and Phage Genetic Switches
Bacterial and Phage Genetic Switches Prof. C. J. Dorman Department of Microbiology, Moyne Institute of Preventive Medicine, Trinity College, Dublin. Lecture 1 The genetic switch controlling the lytic-lysogen
More informationSzent István University Postgraduate School of Veterinary Science
Szent István University Postgraduate School of Veterinary Science Genetic background of the virulence factors of atypical bovine Escherichia coli O157 strains PhD dissertation theses Domonkos László Sváb
More informationNotch 1 -dependent regulation of cell fate in colorectal cancer
Notch 1 -dependent regulation of cell fate in colorectal cancer Referees: PD Dr. Tobias Dick Prof. Dr. Wilfried Roth http://d-nb.info/1057851272 CONTENTS Summary 1 Zusammenfassung 2 1 INTRODUCTION 3 1.1
More informationDetailed Information for Escherichia coli
Detailed Information for Escherichia coli Although is may be hard to believe, some types of E. coli are actually good and help out your body! Right now, at this very moment, there are E. coli bacteria
More informationEU Reference Laboratory for E. coli Department of Veterinary Public Health and Food Safety Unit of Foodborne Zoonoses Istituto Superiore di Sanità
Identification and characterization of Verocytotoxin-producing Escherichia coli (VTEC) by Real Time PCR amplification of the main virulence genes and the genes associated with the serogroups mainly associated
More informationLocalised Sex, Contingency and Mutator Genes. Bacterial Genetics as a Metaphor for Computing Systems
Localised Sex, Contingency and Mutator Genes Bacterial Genetics as a Metaphor for Computing Systems Outline Living Systems as metaphors Evolutionary mechanisms Mutation Sex and Localized sex Contingent
More informationGenetics Test Biology I
Genetics Test Biology I Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Avery s experiments showed that bacteria are transformed by a. RNA. c. proteins.
More informationViruses. Viral components: Capsid. Chapter 10: Viruses. Viral components: Nucleic Acid. Viral components: Envelope
Viruses Chapter 10: Viruses Lecture Exam #3 Wednesday, November 22 nd (This lecture WILL be on Exam #3) Dr. Amy Rogers Office Hours: MW 9-10 AM Too small to see with a light microscope Visible with electron
More informationLAB 16 Rapid Colony Transformation of E. coli with Plasmid DNA
LAB 16 Rapid Colony Transformation of E. coli with Plasmid DNA Objective: In this laboratory investigation, plasmids containing fragments of foreign DNA will be used to transform Escherichia coli cells,
More informationLecture Overview. Hydrogen Bonds. Special Properties of Water Molecules. Universal Solvent. ph Scale Illustrated. special properties of water
Lecture Overview special properties of water > water as a solvent > ph molecules of the cell > properties of carbon > carbohydrates > lipids > proteins > nucleic acids Hydrogen Bonds polarity of water
More informationModule 3 Questions. 7. Chemotaxis is an example of signal transduction. Explain, with the use of diagrams.
Module 3 Questions Section 1. Essay and Short Answers. Use diagrams wherever possible 1. With the use of a diagram, provide an overview of the general regulation strategies available to a bacterial cell.
More informationUnderstanding West Nile Virus Infection
Understanding West Nile Virus Infection The QIAGEN Bioinformatics Solution: Biomedical Genomics Workbench (BXWB) + Ingenuity Pathway Analysis (IPA) Functional Genomics & Predictive Medicine, May 21-22,
More informationRNA & Protein Synthesis
RNA & Protein Synthesis Genes send messages to cellular machinery RNA Plays a major role in process Process has three phases (Genetic) Transcription (Genetic) Translation Protein Synthesis RNA Synthesis
More informationCould bacteriuria hold the key to understanding urgency/ urge incontinence
Could bacteriuria hold the key to understanding urgency/ urge incontinence 8:15 to 8:20min: Prof Kate Moore, introduction and welcome 8:20-8:35: Dr Colin Walsh 8:35-8:45: Discussion 8:45-9.00: Dr Kylie
More informationCloning and Expression of Recombinant Proteins
Cloning and Expression of Recombinant Proteins Dr. Günther Woehlke Dept. Physics E22 (Biophysics) Technical University Munich James-Franck-Str. D-85748 Garching Germany guenther.woehlke@mytum.de 1 Created
More informationCONTROLLING MICROBIAL GROWTH IN WINE
CONTROLLING MICROBIAL GROWTH IN WINE Section 3. Alcohol The alcohol content of wines is an important parameter in limiting microbial growth for only some of the enologically important organisms. The relative
More informationLecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides
Lecture Series 7 From DNA to Protein: Genotype to Phenotype Reading Assignments Read Chapter 7 From DNA to Protein A. Genes and the Synthesis of Polypeptides Genes are made up of DNA and are expressed
More informationGenetics Lecture Notes 7.03 2005. Lectures 1 2
Genetics Lecture Notes 7.03 2005 Lectures 1 2 Lecture 1 We will begin this course with the question: What is a gene? This question will take us four lectures to answer because there are actually several
More informationAcknowledgements. Developing collaborative lab experiments across disciplines through the identification of bacteria
Acknowledgements Developing collaborative lab experiments across disciplines through the identification of bacteria Joanna Huxster, Ph.D. Sarah Moss, MS 15 Emily Bilyk, BS 16 Brian M. Forster, Ph.D. Lab
More informationCanadian Microbiome Initiative
Canadian Microbiome Initiative Background The human body plays host to trillions of microbes, including bacteria, viruses and protists. These microbes constitute the Human Microbiome that resides both
More informationMicro RNAs: potentielle Biomarker für das. Blutspenderscreening
Micro RNAs: potentielle Biomarker für das Blutspenderscreening micrornas - Background Types of RNA -Coding: messenger RNA (mrna) -Non-coding (examples): Ribosomal RNA (rrna) Transfer RNA (trna) Small nuclear
More informationGENE REGULATION. Teacher Packet
AP * BIOLOGY GENE REGULATION Teacher Packet AP* is a trademark of the College Entrance Examination Board. The College Entrance Examination Board was not involved in the production of this material. Pictures
More informationRULES FOR THE EVOLUTION OF GENE CIRCUITRY
RULES FOR THE EVOLUTION OF GENE CIRCUITRY M. A. SAVAGEAU Department of Microbiology & Immunology, The University of Michigan Medical School, Ann Arbor, Michigan 48109-0629 USA Cells possess the genes required
More informationFrequently Asked Questions Next Generation Sequencing
Frequently Asked Questions Next Generation Sequencing Import These Frequently Asked Questions for Next Generation Sequencing are some of the more common questions our customers ask. Questions are divided
More informationGenetic Technology. Name: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question.
Name: Class: Date: Genetic Technology Multiple Choice Identify the choice that best completes the statement or answers the question. 1. An application of using DNA technology to help environmental scientists
More information1 Mutation and Genetic Change
CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds
More informationOrganization and Structure of Cells
Organization and Structure of Cells All living things fall into one of the two categories: prokaryotes eukaryotes The distinction is based on whether or not a cell has a nucleus. Prokaryotic cells do not
More informationInduction of Enzyme Activity in Bacteria:The Lac Operon. Preparation for Laboratory: Web Tutorial - Lac Operon - submit questions
Induction of Enzyme Activity in Bacteria:The Lac Operon Preparation for Laboratory: Web Tutorial - Lac Operon - submit questions I. Background: For the last week you explored the functioning of the enzyme
More informationPhotosynthesis and Cellular Respiration. Stored Energy
Photosynthesis and Cellular Respiration Stored Energy What is Photosynthesis? plants convert the energy of sunlight into the energy in the chemical bonds of carbohydrates sugars and starches. SUMMARY EQUATION:
More informationRecombinant DNA and Biotechnology
Recombinant DNA and Biotechnology Chapter 18 Lecture Objectives What Is Recombinant DNA? How Are New Genes Inserted into Cells? What Sources of DNA Are Used in Cloning? What Other Tools Are Used to Study
More informationCarbon-organic Compounds
Elements in Cells The living substance of cells is made up of cytoplasm and the structures within it. About 96% of cytoplasm and its included structures are composed of the elements carbon, hydrogen, oxygen,
More informationActivity 7.21 Transcription factors
Purpose To consolidate understanding of protein synthesis. To explain the role of transcription factors and hormones in switching genes on and off. Play the transcription initiation complex game Regulation
More informationCALL FOR DATA ON VEROTOXIGENIC ESCHERICHIA COLI (VTEC) / SHIGATOXIGENIC E. COLI (STEC)
Joint FAO/WHO Expert Meetings on Microbiological Risk Assessment (JEMRA) CALL FOR DATA ON VEROTOXIGENIC ESCHERICHIA COLI (VTEC) / SHIGATOXIGENIC E. COLI (STEC) Background Deadline: 17 June 2016 Verotoxigenic
More informationName: Hour: Elements & Macromolecules in Organisms
Name: Hour: Elements & Macromolecules in Organisms Most common elements in living things are carbon, hydrogen, nitrogen, and oxygen. These four elements constitute about 95% of your body weight. All compounds
More informationEukaryotes have organelles
Energy-transducing Eukaryotes have organelles membrane systems An organelle is a discrete membrane bound cellular structure specialized functions. An organelle is to the cell what an organ is to the body
More informationThe Molecules of Cells
The Molecules of Cells I. Introduction A. Most of the world s population cannot digest milk-based foods. 1. These people are lactose intolerant because they lack the enzyme lactase. 2. This illustrates
More informationChapter 14 Urinalysis, Body Fluids and Other Specimens. Objectives:
EXERCISE 15: CHEMICAL EXAMINATION OF URINE Textbook: Skill: Chapter 14 Urinalysis, Body Fluids and Other Specimens 15 points Objectives: 1. Name 10 routine chemical tests performed on urine and list a
More informationCell Structure & Function!
Cell Structure & Function! Chapter 3! The most exciting phrase to hear in science, the one that heralds new discoveries, is not 'Eureka!' but 'That's funny.! -- Isaac Asimov Animal Cell Plant Cell Cell
More informationIntroduction to transcriptome analysis using High Throughput Sequencing technologies (HTS)
Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) A typical RNA Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,
More informationRisk Factors for Escherichia coli O157:H7 on Cattle Ranches
Risk Factors for Escherichia coli O157:H7 on Cattle Ranches Royce Larsen - UCCE L. Benjamin UC Davis M. Jay-Russell UC Davis R. Atwill UC Davis M. Cooley USDA ARS D. Carychao USDA ARS R. Mandrell USDA
More informationStandards, Guidelines and Best Practices for RNA-Seq V1.0 (June 2011) The ENCODE Consortium
Standards, Guidelines and Best Practices for RNA-Seq V1.0 (June 2011) The ENCODE Consortium I. Introduction: Sequence based assays of transcriptomes (RNA-seq) are in wide use because of their favorable
More informationPatent issues in Industrial Biotech:
Patent issues in Industrial Biotech: Nucleic Acids, Life Forms & Natural Products Konrad Sechley PhD, Vancouver, Canada 18 April, 2016 OVERVIEW Gene patenting Life Forms & Natural Products Conclusions
More information10.1 The function of Digestion pg. 402
10.1 The function of Digestion pg. 402 Macromolecules and Living Systems The body is made up of more than 60 % water. The water is found in the cells cytoplasm, the interstitial fluid and the blood (5
More information1. When you come to a station, attempt to answer each question for that station.
Name: Block: Steps for completing this study guide 1. When you come to a station, attempt to answer each question for that station. 2. Once you are done answering the questions, or if you can t answer
More informationKEY CONCEPT Organisms can be classified based on physical similarities. binomial nomenclature
Section 17.1: The Linnaean System of Classification Unit 9 Study Guide KEY CONCEPT Organisms can be classified based on physical similarities. VOCABULARY taxonomy taxon binomial nomenclature genus MAIN
More informationChapter 11: Molecular Structure of DNA and RNA
Chapter 11: Molecular Structure of DNA and RNA Student Learning Objectives Upon completion of this chapter you should be able to: 1. Understand the major experiments that led to the discovery of DNA as
More informationHow To Understand The Human Body
Introduction to Biology and Chemistry Outline I. Introduction to biology A. Definition of biology - Biology is the study of life. B. Characteristics of Life 1. Form and size are characteristic. e.g. A
More informationThe Effects of Glycerol, Glucose, Galactose, Lactose and Glucose with Galactose on the Induction of β-galactosidase in Escherichia coli
The Effects of Glycerol, Glucose, Galactose, Lactose and Glucose with Galactose on the Induction of β-galactosidase in Escherichia coli VICKY CHAN, LISA F. DREOLINI, KERRY A. FLINTOFF, SONJA J. LLOYD,
More informationTranslation Study Guide
Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to
More informationReplication Study Guide
Replication Study Guide This study guide is a written version of the material you have seen presented in the replication unit. Self-reproduction is a function of life that human-engineered systems have
More informationGiven these characteristics of life, which of the following objects is considered a living organism? W. X. Y. Z.
Cell Structure and Organization 1. All living things must possess certain characteristics. They are all composed of one or more cells. They can grow, reproduce, and pass their genes on to their offspring.
More informationNO CALCULATORS OR CELL PHONES ALLOWED
Biol 205 Exam 1 TEST FORM A Spring 2008 NAME Fill out both sides of the Scantron Sheet. On Side 2 be sure to indicate that you have TEST FORM A The answers to Part I should be placed on the SCANTRON SHEET.
More informationEndocrine System: Practice Questions #1
Endocrine System: Practice Questions #1 1. Removing part of gland D would most likely result in A. a decrease in the secretions of other glands B. a decrease in the blood calcium level C. an increase in
More informationCystic Fibrosis Webquest Sarah Follenweider, The English High School 2009 Summer Research Internship Program
Cystic Fibrosis Webquest Sarah Follenweider, The English High School 2009 Summer Research Internship Program Introduction: Cystic fibrosis (CF) is an inherited chronic disease that affects the lungs and
More informationIntroduction to Genome Annotation
Introduction to Genome Annotation AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT
More informationQuick Hit Activity Using UIL Science Contests For Formative and Summative Assessments of Pre-AP and AP Biology Students
Quick Hit Activity Using UIL Science Contests For Formative and Summative Assessments of Pre-AP and AP Biology Students Activity Title: Quick Hit Goal of Activity: To perform formative and summative assessments
More informationBIOMARKERS AND TOXICITY MECHANISMS 06 Mechanisms Metabolism & Detoxification. Luděk Bláha, PřF MU, RECETOX www.recetox.cz
BIOMARKERS AND TOXICITY MECHANISMS 06 Mechanisms Metabolism & Detoxification Luděk Bláha, PřF MU, RECETOX www.recetox.cz Metabolism and detoxification Chemicals enter body... mostly via food Pass directly
More informationThe National Antimicrobial Resistance Monitoring System (NARMS)
The National Antimicrobial Resistance Monitoring System (NARMS) Strategic Plan 2012-2016 Table of Contents Background... 2 Mission... 3 Overview of Accomplishments, 1996-2011... 4 Strategic Goals and Objectives...
More informationPrinciples and Applications of Soil Microbiology
Principles and Applications of Soil Microbiology Edited by David M. Sylvia JefFry J. Fuhrmann Peter G. Hartel David A. Zuberer Technische Universitat Darmstadt FACHBEREICH 10 BIOLOGIE B i b I : o t h e
More informationGUIDELINES FOR THE REGISTRATION OF BIOLOGICAL PEST CONTROL AGENTS FOOD AND AGRICULTURE ORGANIZATION OF THE UNITED NATIONS
GUIDELINES FOR THE REGISTRATION OF BIOLOGICAL PEST CONTROL AGENTS FOOD AND AGRICULTURE ORGANIZATION OF THE UNITED NATIONS -ii- GUIDELINES ON THE REGISTRATION OF BIOLOGICAL PEST CONTROL AGENTS FOOD AND
More informationCulture-Independent Diagnostics Forum: Charting a Path for Public Health
Culture-Independent Diagnostics Forum: Charting a Path for Public Health The Consumer Perspective Dr. Barbara Kowalcyk April 25, 2012 A Basic Human Right Food is strength, and food is peace and food is
More informationFood Processing: Understanding and Controlling E. Coli Contamination
Loss Control Department Technical Information Paper Series Food Processing: Understanding and Controlling E. Coli Contamination Copyright 1998 The Hartford Loss Control Department TIPS Series S 190.007
More informationF1 Generation. F2 Generation. AaBb
How was DNA shown to be the genetic material? We need to discuss this in an historical context. During the 19th century most scientists thought that a bit of the essence of each and every body part was
More informationModeling and Simulation of Gene Regulatory Networks
Modeling and Simulation of Gene Regulatory Networks Hidde de Jong INRIA Grenoble - Rhône-Alpes Hidde.de-Jong@inria.fr http://ibis.inrialpes.fr INRIA Grenoble - Rhône-Alpes and IBIS IBIS: systems biology
More informationJust the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
More information2.1.2 Characterization of antiviral effect of cytokine expression on HBV replication in transduced mouse hepatocytes line
i 1 INTRODUCTION 1.1 Human Hepatitis B virus (HBV) 1 1.1.1 Pathogenesis of Hepatitis B 1 1.1.2 Genome organization of HBV 3 1.1.3 Structure of HBV virion 5 1.1.4 HBV life cycle 5 1.1.5 Experimental models
More informationName Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in
DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results
More informationBasic Concepts Recombinant DNA Use with Chapter 13, Section 13.2
Name Date lass Master 19 Basic oncepts Recombinant DN Use with hapter, Section.2 Formation of Recombinant DN ut leavage Splicing opyright lencoe/mcraw-hill, a division of he Mcraw-Hill ompanies, Inc. Bacterial
More informationName Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.
13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both
More informationThe world of non-coding RNA. Espen Enerly
The world of non-coding RNA Espen Enerly ncrna in general Different groups Small RNAs Outline mirnas and sirnas Speculations Common for all ncrna Per def.: never translated Not spurious transcripts Always/often
More informationPhoto Cell Resp Practice. A. ATP B. oxygen C. DNA D. water. The following equation represents the process of photosynthesis in green plants.
Name: ate: 1. Which molecule supplies the energy for cellular functions?. TP. oxygen. N. water 2. Photosynthesis The following equation represents the process of photosynthesis in green plants. What happens
More informationMethods of Grading S/N Style of grading Percentage Score 1 Attendance, class work and assignment 10 2 Test 20 3 Examination 70 Total 100
COURSE: MIB 303 Microbial Physiology and Metabolism (3 Units- Compulsory) Course Duration: Three hours per week for 15 weeks (45 hours). Lecturer: Jimoh, S.O. B.Sc., M.Sc, Ph.D Microbiology (ABU, Zaria)
More informationSample Questions for Exam 3
Sample Questions for Exam 3 1. All of the following occur during prometaphase of mitosis in animal cells except a. the centrioles move toward opposite poles. b. the nucleolus can no longer be seen. c.
More informationShouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center
Computational Challenges in Storage, Analysis and Interpretation of Next-Generation Sequencing Data Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center Next Generation Sequencing
More informationDigestive System Why is digestion important? How is food digested? Physical Digestion and Movement
Digestive System The digestive system is made up of the digestive tract a series of hollow organs joined in a long, twisting tube from the mouth to the anus and other organs that help the body break down
More informationUnderstanding the immune response to bacterial infections
Understanding the immune response to bacterial infections A Ph.D. (SCIENCE) DISSERTATION SUBMITTED TO JADAVPUR UNIVERSITY SUSHIL KUMAR PATHAK DEPARTMENT OF CHEMISTRY BOSE INSTITUTE 2008 CONTENTS Page SUMMARY
More informationBacterial Next Generation Sequencing - nur mehr Daten oder auch mehr Wissen? Dag Harmsen Univ. Münster, Germany dharmsen@uni-muenster.
Bacterial Next Generation Sequencing - nur mehr Daten oder auch mehr Wissen? Dag Harmsen Univ. Münster, Germany dharmsen@uni-muenster.de Commercial Disclosure Dag Harmsen is co-founder and partial owner
More informationBacillus Subtilis Expression Vectors. Product Information and Instructions November 2005
Bacillus Subtilis Expression Vectors Product Information and Instructions November 2005 1 Content 1. Introduction... 3 2. The pht Vectors...4 2.1. Vector Map pht01...4 2.2. Vector Map pht43...5 2.3. Location
More information