Next Generation Sequencing data Analysis at Genoscope. Jean-Marc Aury
|
|
|
- MargaretMargaret Weaver
- 10 years ago
- Views:
Transcription
1 Next Generation Sequencing data Analysis at Genoscope Jean-Marc Aury
2 Introduction Presentation of Genoscope and NGS activities Overview of sequencing technologies Sequencing and assembly of prokaryotic and eukaryotic genomes Annotating genomes using massive-scale RNA-Seq Future projects
3 Genoscope (National Sequencing center) Among the largest sequencing center in Europe Part of the CEA Institut de Génomique since 05/2007 Provide high-throughput sequencing data to the French Academic community, and carry out in-house genomic projects Involved in large genome projects : human genome project, arabidopsis, rice, Coordination of large genome projects : tetraodon, paramecium, vitis, oikopleura, and as well fungal genomes (botrytis, tuber) and prokaryotic genomes
4 Genoscope (National Sequencing center) NGS activities : Sequencing of prokaryotic genomes (2007) RNA-Seq / Annotation of eukaryotic genomes (2008) SNP calling : identification of mutations (2008) Metagenomic projects (2008) Sequencing of large eukaryotic genomes (2009/2010) Chip-Seq, detection of structural variations, (2009/2010)
5 Genoscope (National Sequencing center) Sequencing capacity : 19 ABI /Roche Titanium 2 Illumina GA2 1 Solid v3
6 Genoscope (National Sequencing center) Access to the Genoscope sequencing capacity by call for tender Project Sequencing Assembly / Finishing Prokaryotics genomes annotation (MAGE) Eukaryotics genomes annotation (GAZE)
7 Sequencing technologies Applied Biosystems ABI 3730XL Illumina / Solexa Genetic Analyzer Roche / 454 Genome Sequencer FLX Applied Biosystems SOLiD What s different : Quantity and types of data Quality of data
8 Sequencing technologies 454 / Roche Genome Sequence FLX Gs20 20Mb / run 100bp / read GSFLX Standard 100Mb / run 250bp / read GSFLX Titanium 500Mb / run 500bp / read Actual version (GSFLX Titanium) : Majority of 500bp reads Around reads / run and 500Mbp / run Run duration : 8h High error rate in homopolymer sequences Good assemblies at 20X of coverage No cloning biases
9 Sequencing technologies 454 / Roche Genome Sequence FLX 1 fragment -> 1 bead 1 bead -> 1 read
10 Sequencing technologies Illumina / Solexa Genetic Analyzer GA II 8Gb / run 50bp / read Paired reads GA IIx 90 Gb / run 150bp / read 14 days / run Paired reads and mate pairs Hi-Seq Gb / run 100bp / read 8 days / run Paired reads and mate pairs Actual version (Genome Analyzer IIx): Reads of 108bp Around 640M reads / run and 70Gbp / run 10 days / run very low error rate (70% of perfect reads) No indels => good complementarity with the 454 technology No coverage gaps Price
11 Sequencing technologies Illumina / Solexa Genetic Analyzer
12 Sequencing technologies 454 / Roche Genome Sequence FLX ¼ run on Acinetobacter baylyi (3,5Mb) ~ reads Cumulative size of 130Mb 99,9% of aligned reads Average error rate : 0,55% 37% deletions, 53% insertions, 10% substitutions. Errors accumulated around homopolymers => error rate is not constant
13 Sequencing technologies Illumina / Solexa Genetic Analyzer 1 lane on Acinetobacter baylyi (3,5Mb) 11,4M reads cumulative size of 900Mb 98,5% aligned reads Average error rate : 0,38% 3% deletions, 2% insertions, 95% substitutions.
14 Sequencing technologies
15 Sequencing of prokaryotic genomes
16 Prokaryotic genomes sequencing 454 / Roche Genome Sequence FLX Required genome coverage :
17 Prokaryotic genomes sequencing 454 / Roche Genome Sequence FLX Required genome coverage :
18 Prokaryotic genomes sequencing 454 / Roche Genome Sequence FLX Required genome coverage :
19 Procaryotic genomes sequencing Sanger Unpaired 454 Unpaired + PE 454 Coverage 7.4X 20X 25X Assembler Arachne (Broad Institute) Newbler (454/Roche) Newbler (454/Roche) # of contigs Contigs N50 (Kb) # of scaffolds Scaffolds N50 (Kb) 2, ,000 Assembly size (% of reference) 3.417Mb (95%) Mb (98%) Mb (98%) Mis-assemblies # of errors 3, Substitutions 2, Insertions / Deletions
20 Prokaryotic genomes sequencing Good assembly structure (more scaffolds => library of 3 and 10Kb for the Sanger assembly against 3Kb for the 454 assembly) Good representativeness of the genome (homogeneous coverage) Error rate is still too high for a high quality draft : ~ 1 error / 8,5Kb. The vast majority are indels (introducing frameshifts in coding regions) Rational : polish the consensus of the 454 assembly with a complementary technology.
21 Prokaryotic genomes sequencing Illumina / Solexa Genetic Analyzer 1 lane on Acinetobacter baylyi (3,5Mb) 11,4M reads cumulative size of 900Mb 98,5% aligned reads Average error rate : 0,38% 3% deletions, 2% insertions, 95% substitutions.
22 Prokaryotic genomes sequencing Alignment of illumina reads on the 454 assembly using Soap (gapped alignments) : 2 mismatches and 3 gaps Only uniquely mapped reads were retained Each difference was kept only if it met the following three criteria : Error is not located in the first 5bps or the last 5bps Quality of the considered base, the previous and the next one are above 20 Remaining sequences (around the error) are not homopolymers Each detected difference is considered as a sequencing error if : At least three reads detected the given error 70% of the reads located at that position agree
23 Prokaryotic genomes sequencing Illumina sequencing coverage : At 50X, still remains 163 errors : 51 were attributed to errors in the original consensus sequence or to the presence of variations occurring during cultivation 112 are found in repetitive regions or low coverage (with illumina reads) regions (contigs extremity).
24 Prokaryotic genomes sequencing Step Sequenced reads Uniquely mapped reads Filtered reads Number of reads Number of bases Genome coverage 50,0X 45,5X 16,9X Alignment of illumina reads on the 454 assembly using Soap (gapped alignments) : 2 mismatches and 3 gaps Only uniquely mapped reads were retained Each difference was kept only if it met the following three criteria : Error is not located in the first 5bps or the last 5bps Quality of the considered base, the previous and the next one are above 20 Remaining sequences (around the error) are not homopolymers
25 Prokaryotic genomes sequencing Sanger Unpaired + PE 454 unpaired + paired 454 with Illumina / Solexa GA1 Coverage 7.4X 25X 25X and 50X Assembler Arachne (Broad Institute) Newbler (454/Roche) Newbler (454 / Roche) # of contigs Contigs N50 (Kb) # of scaffolds Scaffolds N50 (Kb) 2,200 1,000 1,000 Assembly size (% of reference) 3.417Mb (95%) Mb (98%) Mb (98%) Mis-assemblies # of errors 3, (1 error / 8Kb) 163 (1 error / 22Kb) Substitutions 2, Insertions / Deletions
26 Prokaryotic genomes sequencing
27 Prokaryotic genomes sequencing Genomic DNA Roche/454 sequenced paired-end library to a ~7x fragment size coverage (for 3Kb fragments) Add 454 unpaired data to a final 25x coverage Newbler assembly Correct errors with ~50x Solexa/illumina short reads data High quality draft (< 10-4 error rate)
28 Microbial Genome Sequencing Evolution Propose a strategy to sequence prokaryotic genomes, accounting for assembly quality and costs Mixing 454 and illumina technologies to obtain high quality drafts (454 provide read length and illumina low error rate) (15X) + Sanger (4X) ~20 projects Sanger - 12X ~40 projects 454 (20X) + Sanger (1X) + Solexa (~50X) ~15 projects 454 (20X) + Solexa (~50X) 1 project Arachne Phrap Newbler
29 Prokaryotic genomes sequencing Sanger unpaired + paired Illumina 76bp + Illumina 76bp illumina GAI Illumina MP 10Kb Illumina MP 10Kb 52bp 52bp Coverage 7.4X 25X and 50X 100X and 50X 100X and 50X Assembler Arachne (Broad Institute) Newbler (454 / Roche) Soap (BGI) Velvet (EBI) # of contigs Contigs N50 (Kb) # of scaffolds Scaffolds N50 (Kb) 2,200 3,600 3,183 3, Mb (95%) Mb (98%) 58K N Mb (98%) 457K N Mb (100%) 11K N Mis-assemblies # of errors 3,442 <127 1 error / 28Kb 20 1 error / 175Kb error / 17Kb Substitutions 2, Insertions / Assembly size (% of reference) 7
30 Eukaryotic Genome Sequencing Evolution Extend prokaryotic strategy to eukaryotic genomes Sanger sequencing is still used to sequence long DNA fragments : >20Kb, BAC ends, Sanger - 10X - >12 projects Tetraodon, paramecium, vitis, meloidogyne, tuber, blastocystis, chondrus, podospora, oikopleura, Ectocarpus (~15X) + Sanger BAC ends + Solexa (~50X) 9 projects : Cocoa, banana, trypanosome, citrus, clytia, adineta, coffee, trout, colza Newbler Arachne
31 Annotating genomes using RNA-Seq
32 Annotating genomes using RNA-Seq Goal : annotate eukaryotic genomes using transcriptomic data from ultra-high throughput sequencers : Illumina and Solid Difficulties : Predict complete gene structures with 40 bp reads Align short reads to exon/exon junctions (mapping algorithms allow a limited number of gaps during alignments). Molecular biology: Power sequencing. Brenton R. Graveley. Nature 453, (26 June 2008)
33 Typical RNA-Seq experiments
34 Annotation de génomes eucaryotes Short-Read Sequencing Technologies for Transcriptional Analyses. Simon SA, Zhai J, Nandety RS, McCormick KP, Zeng J, Mejia D, Meyers BC. Annu Rev Plant Biol Jan 9.
35 Annotating genomes using RNA-Seq Coverage heterogeneity at the exon and gene level - simulated data - real data At the exon level - experimental biases - alternative splicing Biases between 3 and 5 at the gene level exons
36 Annotating genomes using RNA-Seq 1. covtigs construction genome mapped reads coverage depth threshold covtigs Step 1. covtigs construction
37 Annotating genomes using RNA-Seq Inaccurate detection of splicing junctions GGTGTTCACTACTTAGCCATGAAGATCTAGATTTCACACTTTTAGAAGCCTTAGAAAGCTG... covtig TGAAGATCTAGATTTCACACTTTTAGAAGCCTT TGAAGATCTAGATTTCACACTTTTAGAAGCCTT TGAAGATCTAGATTTCACACTTTTAGAAGCCTT TGAAGATCTAGATTTCACACTTTTAGAAGCCTT TGAAGATCTAGATTTCACACTTTTAGAAGCCTT TGAAGATCTAGATTTCAAACTTTTAGAAGCCTT TGAAGATCTAGATTTCACACTTTTAGAAGCCTT TGAAGATCTAGATTTCACACTTTTAGAAGCCTT TGAAGATCTAGATTTCACACTTTTAGAAGCCTT TGAAGATCTAGATTTCACACTTTTAGAAGCCTT TGAAGATCTAGATTTCACACTTTTAGAAGCCTT TGAAGATCTAGATTTCACACTTTTAGAAGCCT TGAAGATCTAGATTTCACACTTTTAGAAGCCT TGAAGATCTAGATTTCACACTTTTAGAAGCCT TGAAGATCTAGATTTCACACTTTTAGAAGCCT TGAAGATCTAGATTTCACACTTTTAGAAGCCT CTAGATTTCACACTTTTAGAAGCCTTAGAAAGC TCTAGATTTCACACTTTTAGAAGCCTTAGAAAG CTAGATTTCACACTTTTAGAAGCCTTAGAAAGC CTAGATTTCACACTTTTAGAAGCCTTATAAAG ATCTAGATTTCACACTTTTAGAAGCCTTAGAA CTAGATTTCACACTTTTAGAAGCCTTAGAAAG CTAGATTTCACACTTTTAGAAGCCTTATAAAG ATCTAGATTTCACACTTTTAGAAGCCTTAGAA GACACCATGAAGATCTAGATTTCACACTTTTAG CACCAACACCATGAAGATCTAGATTTCACACTT CACCAACACCATGAAGATCTAGATTTCACACTT CGACACCATGAAGATCTAGATTTCACACTTTTA CCAGCACCCACCAACACCATGAAGATCTAGATT CACCAACACCATGAAGATCTAGATTTCACACTT GGTGCACCCACCAACACCATGAAGATCTAGATT CAACACCATGAAGATCTAGATTTCACACTTTTA CCAACACCATGAAGATCTAGATTTCACACTTTT CACCAACACCATGAAGATCTAGATTTCACACTT Mapped reads Unmapped reads Improvement : Extension of covtigs using unmapped reads
38 2. candidate exons covtig ag 100 nt gt forward and reverse candidate exons Step 2. extraction of candidate exons
39 Annotating genomes using RNA-Seq unmapped reads word dictionary k-mer1 Step 3: Validation of exon/exon junctions. Validation of junctions between candidate exons using a word dictionary built from the unmapped reads. candidate exons gt X1 k-mer2 X2 k-mern Xn verify words existence in the dictionary ag validated junction covtig1...ggtgttcactacttacccatgt...agatctacacacttttagaagcctgaaag... covtig2 Kmers TTACCCAT CTTACCCAT ACTTACCCAT TACTTACCCAT CTACTTACCCAT ACTACTTACCCAT CACTACTTACCCAT TCACTACTTACCCAT TTCACTACTTACCCAT GTTCACTACTTACCCAT ATCTACACACTTTTAGA ATCTACACACTTTTAG ATCTACACACTTTTA ATCTACACACTTTT ATCTACACACTTT ATCTACACACTT ATCTACACACT ATCTACACAC ATCTACACA ATCTACAC Junction validation Creation of the dictionnary Unmapped reads TGTTCACTACTTACCCATATCTACACACTTTTAGAA TCACTACTTACCCATATCTACACACTTTTAGAAGCC GTTCACTACTTACCCATATCTACACACTTTTAGAAG TTCACTACTTACCCATATCTACACACTTTTAGAAGC TGTTCACTACTTACCCATATCTACACACTTTTAGAA GTTCACTACTTACCCATATCTACACACTTTTAGAAG GTGTTCACTACTTACCCATATCTACACACTTTTAGA TGTTCACTACTTACCCATATCTACA GTTCACTACTTACCCATATCTACAC TTCACTACTTACCCATATCTACACA TCACTACTTACCCATATCTACACAC CACTACTTACCCATATCTACACACT...
40 Annotating genomes using RNA-Seq 4. graph of candidate exons linked by validated junctions Open Reading Frame 5. model construction and coding sequence detection G-Mo.R-Se models M1 M5 M2 M6 M M3 M4 7 Real transcripts T1 T 2 T3 T4 T5
41 Annotating genomes using RNA-Seq Method set-up to annotate the vitis genome (500Mb) Around 175 million of illumina reads 4 tissues : leaf, root, stem and callus 140 million of uniquely aligned reads (73,5Mb) around covtigs (38,5Mb) transcript models ( loci), and with a plausible CDS ( loci) Around one week of computation with a desktop computer
42 Annotating genomes using RNA-Seq
43 Annotating genomes using RNA-Seq Characteristics of known and novel G-Mo.R-Se models (all, and with a plausible CDS) All models Models with a plausible CDS (65%) cdnas Number of loci 18,811 12,236 7,895 Number of models 45,290 28,283 9,827* Number of models per locus * ~ ESTs assembled, 95% of assembled transcripts detected by Gmorse Alternative splicing events detected in cdnas and G-Mo.R-Se models cdnas 7,895 loci alternative acceptor/donor % skipped % mutually exclusive 4 0.4% intron retention (IR) (944 without IR) Total Total number of loci with alternative splicing (% of 783 (9.9%) (598 all identified loci) without IR) Models (all) 19,486 loci % % % - Events common to cdnas and models Models (CDS) (% of cdna 12,341 loci events) % 156 (22.6%) % 18 (7.2%) % 1 (25.0%) - 11, (18.5%) 1602 (8.2%) 1029 (8.3%) - G-Mo.R-Se is not optimised to detect splicing events, but it detects more alternative transcripts than classical cdna sequencing.
44 Annotating genomes using RNA-Seq G-Mo.R-Se (Gene MOdeling using Rna-Seq), is downloadable from Genoscope website : Used with illumina data, but it can be easily adapt to manage Solid data (in colorspace) Method used to annotate the whole vitis genome Example of a novel gene identified by G-Mo.R-Se
45 Capture and sequencing for mutation discovery Laboratoire de Ressources Génomique : Gabòr Gyapay Laboratoire de Séquençage : Patrick Wincker Laboratoire d Analyse BIoinformatique des Séquences : François Artiguenave, Vincent Meyer, Marc Wessner, Benjamin Noel
46 Capture and sequencing for mutation discovery Goal : detection of mutations (SNPs) on large genomes (typically the human genome) parallelization of several samples reasonable cost Principle : Target regions on the human genome of several megabases. Amplify these targeted regions High throughput sequencing Nimblegen chips and 454 sequencing For which projects? Rare genetic diseases Cancer research
47 Capture and sequencing for mutation discovery Digital Light Processing technology
48 Capture and sequencing for mutation discovery
49 Capture and sequencing for mutation discovery Pilot project : genes, exons, cumulative of 4 Mb 8 samples : 4 tumor samples et 4 corresponding normal samples with 1 GSFLX run per sample (~ 100Mb) selected regions : 3,97Mb (average size of 300bp) Nimblegen design : targeted regions ; 5,6Mb (average size of 400bp) Selected regions Targeted regions
50 Plateforme détection de mutations Alignment of sequencing data with the human genome
51 Capture and sequencing for mutation discovery Alignment of sequencing data with the human genome B # reads # aligned reads # reads overlapping targeted regions # reads included in targeted regions # targeted regions with at least one read # targeted regions entirely covered C D E F G H I (88%) (85%) (94%) (88%) (89%) (76%) (69%) (64%) (63%) (66%) (44%) (3%) (90%) (69%) (90%) (8%) (49%) (49%) (50%) (46%) (45%)) 424 (43%) (44%) (39%) (92%) (93%) (96%) (93%) (79%) 783 (6%) (92%) (20%) (82%) (86%) (83%) (82%) 8610 (65%) 142 (1%) (82%) 622 (5%)
52 Capture and sequencing for mutation discovery B C D E F H Initial coverage 42,9 53,3 35,1 35,1 41,1 29,6 Average coverage 13,9 15,8 12,7 11,5 10,5 10,1 Minimal coverage Maximal coverage 80,7 102,2 102,1 113,0 111,0 86,0 # regions with 10X coverage (53%) (60%) (54%) (44%) (31%) (41%)
53 Capture and sequencing for mutation discovery Fragments size : bp Sequencing of ~225 bp Targeted region Sequencing region
54 Capture and sequencing for mutation discovery Detection of around SNPs Extraction of 50 SNPs after selection and classification Criteria quality of the predicted SNP (sequencing depth and quality values) localization of the predicted SNP comparison between samples and with known SNPs
55 Current and future projects Diversification of applications and projects : de novo sequencing, genome annotation, re-sequencing, metagenomic, functional genomic, identification of mutations and structure variations Increase of number and size of projects
56 Current and future projects De novo sequencing : Assembly of prokaryotic genomes with Illumina sequencing only Sequencing of large eukaryotic genomes with 454 and Sanger : banana (~500Mb ; WGS with 20X X Sanger), cocoa (~400Mb ; WGS with 20X Sanger BAC ends), trout (~2Gb ; WGS with 454 and Sanger BAC ends), wheat chromosome 3b (~1Gb ; 454) Benchmarking assembly of illumina data for large eukaryotic genomes : banana, cocoa, Re-sequencing : 100 Arabidopsis genomes : transposons mobility and methylation
57 Metagenomic project Hyena coprolites (fossilized animal dung) from french cave 8 illumina lanes : reads of 50bp (around 3,5Gb) Ancient and modern DNA => very short fragments Adapter clipping : reads (around 2,4Gb) Modern DNA Ancient DNA 26octobre février 2010 Rennes,
58 Metagenomic project Denovo assembly : SOAPdenovo assembly : ~1hour on 8 cores ; 20Gb of memory contigs ( longer than 100bp) ; cumulative size of 9Mb Longest contig : bp only 5% of reads are assembled => criteria are too stringent Reconstruction of mitochondrials genomes : Mapping of short reads on modern mitochondrial genomes Assembly of mapped reads with permissive criteria reads extracted from red deer mitochondrial genome 156 contigs with a cumulative size of bp (longest 315bp)
59 Current and future projects Tara Oceans Project: Eukaryotic meta-genomic and meta-transcriptomic 3 years expedition with regular sampling at different depth and different cell size fractions. Pilot project in progress 1 sampling station, 3 different depths, 4 cell size fractions, 2 sequencing technologies (454 and illumina) Sequencing of DNA, total RNA, messenger RNA and Tags (V4 and V9 18S) Establish a collection of reference genome sequences (culture and single cell) and gene catalogue
60 Conclusion Price-cutting => burst of novel applications Still at the beginning, NGS change every month : Illumina announce 200Gbases per run (8days) with the HiSeq /Roche will provide Kb reads in 2011 Next-next generation is coming : single molecule sequencing, longer reads, runtime decrease,... Necessity to provide adequate IT infrastructure : production, storage and analysis.
61 Thank you Laboratoire d Analyse Bioinformatique des Séquences François Artiguenave Jean-Marc Aury Christophe Battail Maria Bernard France Denoeud Kamel Jabbari Olivier Jaillon Hamid Khalili Amine Madoui Vincent Meyer Benjamin Noel Corinne da Silva Marc Wessner Laboratoire de séquençage Patrick Wincker Corinne Cruaud Julie Poulain Adriana Alberti Karine Labadie Laboratoire finishing Valérie Barbe Sophie Mangenot Laboratoire d informatique Claude Scarpelli Veronique Anthouard Arnaud Couloux Frederic Gavory Eric Pelletier Gaelle Samson
Application du séquençage génomique et transcriptomique à haut débit au Genoscope. Jean-Marc Aury
Application du séquençage génomique et transcriptomique à haut débit au Genoscope Jean-Marc Aury Introduction Presentation of Genoscope and NGS activities Overview of sequencing technologies Sequencing
Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center
Computational Challenges in Storage, Analysis and Interpretation of Next-Generation Sequencing Data Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center Next Generation Sequencing
Next Generation Sequencing: Technology, Mapping, and Analysis
Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University [email protected] http://tandem.bu.edu/ The Human Genome Project took
Go where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe
Go where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe Go where the biology takes you. To published results faster With proven scalability To the forefront of discovery To limitless applications
Computational Genomics. Next generation sequencing (NGS)
Computational Genomics Next generation sequencing (NGS) Sequencing technology defies Moore s law Nature Methods 2011 Log 10 (price) Sequencing the Human Genome 2001: Human Genome Project 2.7G$, 11 years
Next Generation Sequencing
Next Generation Sequencing Technology and applications 10/1/2015 Jeroen Van Houdt - Genomics Core - KU Leuven - UZ Leuven 1 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977
Introduction to NGS data analysis
Introduction to NGS data analysis Jeroen F. J. Laros Leiden Genome Technology Center Department of Human Genetics Center for Human and Clinical Genetics Sequencing Illumina platforms Characteristics: High
NGS data analysis. Bernardo J. Clavijo
NGS data analysis Bernardo J. Clavijo 1 A brief history of DNA sequencing 1953 double helix structure, Watson & Crick! 1977 rapid DNA sequencing, Sanger! 1977 first full (5k) genome bacteriophage Phi X!
July 7th 2009 DNA sequencing
July 7th 2009 DNA sequencing Overview Sequencing technologies Sequencing strategies Sample preparation Sequencing instruments at MPI EVA 2 x 5 x ABI 3730/3730xl 454 FLX Titanium Illumina Genome Analyzer
Next generation DNA sequencing technologies. theory & prac-ce
Next generation DNA sequencing technologies theory & prac-ce Outline Next- Genera-on sequencing (NGS) technologies overview NGS applica-ons NGS workflow: data collec-on and processing the exome sequencing
Introduction to next-generation sequencing data
Introduction to next-generation sequencing data David Simpson Centre for Experimental Medicine Queens University Belfast http://www.qub.ac.uk/research-centres/cem/ Outline History of DNA sequencing NGS
Overview of Next Generation Sequencing platform technologies
Overview of Next Generation Sequencing platform technologies Dr. Bernd Timmermann Next Generation Sequencing Core Facility Max Planck Institute for Molecular Genetics Berlin, Germany Outline 1. Technologies
Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS)
Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) A typical RNA Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,
History of DNA Sequencing & Current Applications
History of DNA Sequencing & Current Applications Christopher McLeod President & CEO, 454 Life Sciences, A Roche Company IMPORTANT NOTICE Intended Use Unless explicitly stated otherwise, all Roche Applied
A Primer of Genome Science THIRD
A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:
Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms
Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms Introduction Mate pair sequencing enables the generation of libraries with insert sizes in the range of several kilobases (Kb).
LifeScope Genomic Analysis Software 2.5
USER GUIDE LifeScope Genomic Analysis Software 2.5 Graphical User Interface DATA ANALYSIS METHODS AND INTERPRETATION Publication Part Number 4471877 Rev. A Revision Date November 2011 For Research Use
Core Facility Genomics
Core Facility Genomics versatile genome or transcriptome analyses based on quantifiable highthroughput data ascertainment 1 Topics Collaboration with Harald Binder and Clemens Kreutz Project: Microarray
Next generation sequencing (NGS)
Next generation sequencing (NGS) Vijayachitra Modhukur BIIT [email protected] 1 Bioinformatics course 11/13/12 Sequencing 2 Bioinformatics course 11/13/12 Microarrays vs NGS Sequences do not need to be known
Focusing on results not data comprehensive data analysis for targeted next generation sequencing
Focusing on results not data comprehensive data analysis for targeted next generation sequencing Daniel Swan, Jolyon Holdstock, Angela Matchan, Richard Stark, John Shovelton, Duarte Mohla and Simon Hughes
RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison
RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the
New generation sequencing: current limits and future perspectives. Giorgio Valle CRIBI - Università di Padova
New generation sequencing: current limits and future perspectives Giorgio Valle CRIBI Università di Padova Around 2004 the Race for the 1000$ Genome started A few questions... When? How? Why? Standard
De Novo Assembly Using Illumina Reads
De Novo Assembly Using Illumina Reads High quality de novo sequence assembly using Illumina Genome Analyzer reads is possible today using publicly available short-read assemblers. Here we summarize the
Discovery and Quantification of RNA with RNASeq Roderic Guigó Serra Centre de Regulació Genòmica (CRG) [email protected]
Bioinformatique et Séquençage Haut Débit, Discovery and Quantification of RNA with RNASeq Roderic Guigó Serra Centre de Regulació Genòmica (CRG) [email protected] 1 RNA Transcription to RNA and subsequent
SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications
Product Bulletin Sequencing Software SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications Comprehensive reference sequence handling Helps interpret the role of each
G E N OM I C S S E RV I C ES
GENOMICS SERVICES THE NEW YORK GENOME CENTER NYGC is an independent non-profit implementing advanced genomic research to improve diagnosis and treatment of serious diseases. capabilities. N E X T- G E
Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem
FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem Elsa Bernard Laurent Jacob Julien Mairal Jean-Philippe Vert September 24, 2013 Abstract FlipFlop implements a fast method for de novo transcript
Tutorial for Windows and Macintosh. Preparing Your Data for NGS Alignment
Tutorial for Windows and Macintosh Preparing Your Data for NGS Alignment 2015 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) 1.734.769.7249
NGS Technologies for Genomics and Transcriptomics
NGS Technologies for Genomics and Transcriptomics Massimo Delledonne Department of Biotechnologies - University of Verona http://profs.sci.univr.it/delledonne 13 years and $3 billion required for the Human
Analysis of NGS Data
Analysis of NGS Data Introduction and Basics Folie: 1 Overview of Analysis Workflow Images Basecalling Sequences denovo - Sequencing Assembly Annotation Resequencing Alignments Comparison to reference
An Overview of DNA Sequencing
An Overview of DNA Sequencing Prokaryotic DNA Plasmid http://en.wikipedia.org/wiki/image:prokaryote_cell_diagram.svg Eukaryotic DNA http://en.wikipedia.org/wiki/image:plant_cell_structure_svg.svg DNA Structure
Standards, Guidelines and Best Practices for RNA-Seq V1.0 (June 2011) The ENCODE Consortium
Standards, Guidelines and Best Practices for RNA-Seq V1.0 (June 2011) The ENCODE Consortium I. Introduction: Sequence based assays of transcriptomes (RNA-seq) are in wide use because of their favorable
Nazneen Aziz, PhD. Director, Molecular Medicine Transformation Program Office
2013 Laboratory Accreditation Program Audioconferences and Webinars Implementing Next Generation Sequencing (NGS) as a Clinical Tool in the Laboratory Nazneen Aziz, PhD Director, Molecular Medicine Transformation
Disease gene identification with exome sequencing
Disease gene identification with exome sequencing Christian Gilissen Dept. of Human Genetics Radboud University Nijmegen Medical Centre [email protected] Contents Infrastructure Exome sequencing
Human Genome Organization: An Update. Genome Organization: An Update
Human Genome Organization: An Update Genome Organization: An Update Highlights of Human Genome Project Timetable Proposed in 1990 as 3 billion dollar joint venture between DOE and NIH with 15 year completion
Automated DNA sequencing 20/12/2009. Next Generation Sequencing
DNA sequencing the beginnings Ghent University (Fiers et al) pioneers sequencing first complete gene (1972) first complete genome (1976) Next Generation Sequencing Fred Sanger develops dideoxy sequencing
Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research. March 17, 2011 Rendez-Vous Séquençage
Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research March 17, 2011 Rendez-Vous Séquençage Presentation Overview Core Technology Review Sequence Enrichment Application
Frequently Asked Questions Next Generation Sequencing
Frequently Asked Questions Next Generation Sequencing Import These Frequently Asked Questions for Next Generation Sequencing are some of the more common questions our customers ask. Questions are divided
The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics
The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics The GS Junior System The Power of Next-Generation Sequencing on Your Benchtop Proven technology: Uses the same long
An example of bioinformatics application on plant breeding projects in Rijk Zwaan
An example of bioinformatics application on plant breeding projects in Rijk Zwaan Xiangyu Rao 17-08-2012 Introduction of RZ Rijk Zwaan is active worldwide as a vegetable breeding company that focuses on
Introduction to Bioinformatics 3. DNA editing and contig assembly
Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 [email protected]
Data Analysis for Ion Torrent Sequencing
IFU022 v140202 Research Use Only Instructions For Use Part III Data Analysis for Ion Torrent Sequencing MANUFACTURER: Multiplicom N.V. Galileilaan 18 2845 Niel Belgium Revision date: August 21, 2014 Page
Microbial Oceanomics using High-Throughput DNA Sequencing
Microbial Oceanomics using High-Throughput DNA Sequencing Ramiro Logares Institute of Marine Sciences, CSIC, Barcelona 9th RES Users'Conference 23 September 2015 Importance of microbes in the sunlit ocean
Next Generation Sequencing: Adjusting to Big Data. Daniel Nicorici, Dr.Tech. Statistikot Suomen Lääketeollisuudessa 29.10.2013
Next Generation Sequencing: Adjusting to Big Data Daniel Nicorici, Dr.Tech. Statistikot Suomen Lääketeollisuudessa 29.10.2013 Outline Human Genome Project Next-Generation Sequencing Personalized Medicine
DNA Sequencing & The Human Genome Project
DNA Sequencing & The Human Genome Project An Endeavor Revolutionizing Modern Biology Jutta Marzillier, Ph.D Lehigh University Biological Sciences November 13 th, 2013 Guess, who turned 60 earlier this
New Technologies for Sensitive, Low-Input RNA-Seq. Clontech Laboratories, Inc.
New Technologies for Sensitive, Low-Input RNA-Seq Clontech Laboratories, Inc. Outline Introduction Single-Cell-Capable mrna-seq Using SMART Technology SMARTer Ultra Low RNA Kit for the Fluidigm C 1 System
The NGS IT notes. George Magklaras PhD RHCE
The NGS IT notes George Magklaras PhD RHCE Biotechnology Center of Oslo & The Norwegian Center of Molecular Medicine University of Oslo, Norway http://www.biotek.uio.no http://www.ncmm.uio.no http://www.no.embnet.org
BIOL 3200 Spring 2015 DNA Subway and RNA-Seq Data Analysis
BIOL 3200 Spring 2015 DNA Subway and RNA-Seq Data Analysis By the end of this lab students should be able to: Describe the uses for each line of the DNA subway program (Red/Yellow/Blue/Green) Describe
Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis
Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype
Challenges associated with analysis and storage of NGS data
Challenges associated with analysis and storage of NGS data Gabriella Rustici Research and training coordinator Functional Genomics Group [email protected] Next-generation sequencing Next-generation sequencing
SEQUENCING. From Sample to Sequence-Ready
SEQUENCING From Sample to Sequence-Ready ACCESS ARRAY SYSTEM HIGH-QUALITY LIBRARIES, NOT ONCE, BUT EVERY TIME The highest-quality amplicons more sensitive, accurate, and specific Full support for all major
Version 5.0 Release Notes
Version 5.0 Release Notes 2011 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) +1.734.769.7249 (elsewhere) +1.734.769.7074 (fax) www.genecodes.com
Deep Sequencing Data Analysis
Deep Sequencing Data Analysis Ross Whetten Professor Forestry & Environmental Resources Background Who am I, and why am I teaching this topic? I am not an expert in bioinformatics I started as a biologist
Genomics Services @ GENterprise
Genomics Services @ GENterprise since 1998 Mainz University spin-off privately financed 6-10 employees since 2006 Genomics Services @ GENterprise Sequencing Service (Sanger/3730, 454) Genome Projects (Bacteria,
Using Illumina BaseSpace Apps to Analyze RNA Sequencing Data
Using Illumina BaseSpace Apps to Analyze RNA Sequencing Data The Illumina TopHat Alignment and Cufflinks Assembly and Differential Expression apps make RNA data analysis accessible to any user, regardless
Analysis of ChIP-seq data in Galaxy
Analysis of ChIP-seq data in Galaxy November, 2012 Local copy: https://galaxy.wi.mit.edu/ Joint project between BaRC and IT Main site: http://main.g2.bx.psu.edu/ 1 Font Conventions Bold and blue refers
Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources
Appendix 2 Molecular Biology Core Curriculum Websites and Other Resources Chapter 1 - The Molecular Basis of Cancer 1. Inside Cancer http://www.insidecancer.org/ From the Dolan DNA Learning Center Cold
When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want
1 When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want to search other databases as well. There are very
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS
NECC History. Karl V. Steiner 2011 Annual NECC Meeting, Orono, Maine March 15, 2011
NECC History Karl V. Steiner 2011 Annual NECC Meeting, Orono, Maine March 15, 2011 EPSCoR Cyberinfrastructure Workshop First regional NENI (now NECC) Workshop held in Vermont in August 2007 Workshop heldinkentucky
How Sequencing Experiments Fail
How Sequencing Experiments Fail v1.0 Simon Andrews [email protected] Classes of Failure Technical Tracking Library Contamination Biological Interpretation Something went wrong with a machine
CRAC: An integrated approach to analyse RNA-seq reads Additional File 3 Results on simulated RNA-seq data.
: An integrated approach to analyse RNA-seq reads Additional File 3 Results on simulated RNA-seq data. Nicolas Philippe and Mikael Salson and Thérèse Commes and Eric Rivals February 13, 2013 1 Results
Introduction to Genome Annotation
Introduction to Genome Annotation AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT
escience and Post-Genome Biomedical Research
escience and Post-Genome Biomedical Research Thomas L. Casavant, Adam P. DeLuca Departments of Biomedical Engineering, Electrical Engineering and Ophthalmology Coordinated Laboratory for Computational
Hadoopizer : a cloud environment for bioinformatics data analysis
Hadoopizer : a cloud environment for bioinformatics data analysis Anthony Bretaudeau (1), Olivier Sallou (2), Olivier Collin (3) (1) [email protected], INRIA/Irisa, Campus de Beaulieu, 35042,
Recombinant DNA and Biotechnology
Recombinant DNA and Biotechnology Chapter 18 Lecture Objectives What Is Recombinant DNA? How Are New Genes Inserted into Cells? What Sources of DNA Are Used in Cloning? What Other Tools Are Used to Study
Expression Quantification (I)
Expression Quantification (I) Mario Fasold, LIFE, IZBI Sequencing Technology One Illumina HiSeq 2000 run produces 2 times (paired-end) ca. 1,2 Billion reads ca. 120 GB FASTQ file RNA-seq protocol Task
How is genome sequencing done?
How is genome sequencing done? Using 454 Sequencing on the Genome Sequencer FLX System, DNA from a genome is converted into sequence data through four primary steps: Step One DNA sample preparation; Step
An Introduction to Next-Generation Sequencing Technology
n Introduction to Next-eneration Sequencing echnology Part II: n overview of DN Sequencing pplications Diverse pplications Next-generation sequencing (NS) platforms enable a wide variety of applications,
Next Generation Sequencing; Technologies, applications and data analysis
; Technologies, applications and data analysis Course 2542 Dr. Martie C.M. Verschuren Research group Analysis techniques in Life Science, Breda Prof. dr. Johan T. den Dunnen Leiden Genome Technology Center,
Bioruptor NGS: Unbiased DNA shearing for Next-Generation Sequencing
STGAAC STGAACT GTGCACT GTGAACT STGAAC STGAACT GTGCACT GTGAACT STGAAC STGAAC GTGCAC GTGAAC Wouter Coppieters Head of the genomics core facility GIGA center, University of Liège Bioruptor NGS: Unbiased DNA
How long is long enough?
How long is long enough? - Modeling to predict genome assembly performance - Hayan Lee@Schatz Lab Feb 26, 2014 Quantitative Biology Seminar 1 Outline Background Assembly history Recent sequencing technology
Structure and Function of DNA
Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four
An Introduction to Next-Generation Sequencing Technology
n Introduction to Next-eneration Sequencing echnology Deciphering DN sequences is essential for virtually all branches of biological research. With the advent of capillary electrophoresis (E)-based Sanger
GenBank, Entrez, & FASTA
GenBank, Entrez, & FASTA Nucleotide Sequence Databases First generation GenBank is a representative example started as sort of a museum to preserve knowledge of a sequence from first discovery great repositories,
Description: Molecular Biology Services and DNA Sequencing
Description: Molecular Biology s and DNA Sequencing DNA Sequencing s Single Pass Sequencing Sequence data only, for plasmids or PCR products Plasmid DNA or PCR products Plasmid DNA: 20 100 ng/μl PCR Product:
An Introduction to Next-Generation Sequencing Technology
An Introduction to Next-eneration Sequencing Technology Deciphering DNA sequences is essential for virtually all branches of biological research. With the advent of capillary electrophoresis (CE)-based
Chapter 2. imapper: A web server for the automated analysis and mapping of insertional mutagenesis sequence data against Ensembl genomes
Chapter 2. imapper: A web server for the automated analysis and mapping of insertional mutagenesis sequence data against Ensembl genomes 2.1 Introduction Large-scale insertional mutagenesis screening in
Single-Cell Whole Genome Sequencing on the C1 System: a Performance Evaluation
PN 100-9879 A1 TECHNICAL NOTE Single-Cell Whole Genome Sequencing on the C1 System: a Performance Evaluation Introduction Cancer is a dynamic evolutionary process of which intratumor genetic and phenotypic
Single-Cell DNA Sequencing with the C 1. Single-Cell Auto Prep System. Reveal hidden populations and genetic diversity within complex samples
DATA Sheet Single-Cell DNA Sequencing with the C 1 Single-Cell Auto Prep System Reveal hidden populations and genetic diversity within complex samples Single-cell sensitivity Discover and detect SNPs,
8/7/2012. Experimental Design & Intro to NGS Data Analysis. Examples. Agenda. Shoe Example. Breast Cancer Example. Rat Example (Experimental Design)
Experimental Design & Intro to NGS Data Analysis Ryan Peters Field Application Specialist Partek, Incorporated Agenda Experimental Design Examples ANOVA What assays are possible? NGS Analytical Process
Analysis and Integration of Big Data from Next-Generation Genomics, Epigenomics, and Transcriptomics
Analysis and Integration of Big Data from Next-Generation Genomics, Epigenomics, and Transcriptomics Christopher Benner, PhD Director, Integrative Genomics and Bioinformatics Core (IGC) idash Webinar,
Human Genome and Human Genome Project. Louxin Zhang
Human Genome and Human Genome Project Louxin Zhang A Primer to Genomics Cells are the fundamental working units of every living systems. DNA is made of 4 nucleotide bases. The DNA sequence is the particular
MUTATION, DNA REPAIR AND CANCER
MUTATION, DNA REPAIR AND CANCER 1 Mutation A heritable change in the genetic material Essential to the continuity of life Source of variation for natural selection New mutations are more likely to be harmful
Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company
Genetic engineering: humans Gene replacement therapy or gene therapy Many technical and ethical issues implications for gene pool for germ-line gene therapy what traits constitute disease rather than just
Keeping up with DNA technologies
Keeping up with DNA technologies Mihai Pop Department of Computer Science Center for Bioinformatics and Computational Biology University of Maryland, College Park The evolution of DNA sequencing Since
CHALLENGES IN NEXT-GENERATION SEQUENCING
CHALLENGES IN NEXT-GENERATION SEQUENCING BASIC TENETS OF DATA AND HPC Gray s Laws of data engineering 1 : Scientific computing is very dataintensive, with no real limits. The solution is scale-out architecture
RNAseq / ChipSeq / Methylseq and personalized genomics
RNAseq / ChipSeq / Methylseq and personalized genomics 7711 Lecture Subhajyo) De, PhD Division of Biomedical Informa)cs and Personalized Biomedicine, Department of Medicine University of Colorado School
European Medicines Agency
European Medicines Agency July 1996 CPMP/ICH/139/95 ICH Topic Q 5 B Quality of Biotechnological Products: Analysis of the Expression Construct in Cell Lines Used for Production of r-dna Derived Protein
Genotyping by sequencing and data analysis. Ross Whetten North Carolina State University
Genotyping by sequencing and data analysis Ross Whetten North Carolina State University Stein (2010) Genome Biology 11:207 More New Technology on the Horizon Genotyping By Sequencing Timeline 2007 Complexity
Fast. Integrated Genome Browser & DAS. Easy. Flexible. Free. bioviz.org/igb
bioviz.org/igb Integrated Genome Browser & DAS Free tools for visualizing, sharing, and publishing genomes and genome-scale data. Easy Flexible Fast Free Funding: National Science Foundation Arabidopsis
Searching Nucleotide Databases
Searching Nucleotide Databases 1 When we search a nucleic acid databases, Mascot always performs a 6 frame translation on the fly. That is, 3 reading frames from the forward strand and 3 reading frames
Data Analysis & Management of High-throughput Sequencing Data. Quoclinh Nguyen Research Informatics Genomics Core / Medical Research Institute
Data Analysis & Management of High-throughput Sequencing Data Quoclinh Nguyen Research Informatics Genomics Core / Medical Research Institute Current Issues Current Issues The QSEQ file Number files per
