Supplemental Information. McBrayer et al. Supplemental Data
|
|
- Tabitha Adams
- 8 years ago
- Views:
Transcription
1 1 Supplemental Information McBrayer et al. Supplemental Data
2 2 Figure S1. Glucose consumption rates of MM cell lines exceed that of normal PBMC. (A) Normal PBMC isolated from three healthy donors were cultured in 0.7 mm glucose containing medium for 17 hours and glucose consumption rates were determined (n = 1). (B) MM cell lines were cultured in 1.2 mm glucose containing medium for 3 hours and glucose consumption rates were determined (n 4). (C) L363 cells were incubated in the indicated concentrations of glucose for 48 hours prior to cell viability analysis via AnnexinV/DAPI staining (n = 2). (D) GLUT1 and (E) GLUT4 protein expression was evaluated in MM cell lines and normal B lymphocytes. GAPDH is included as a loading control. Representative blots are shown (n = 2). (F) Cells were transduced with the indicated shrnas and incubated 2 days. Cells were harvested for RNA extraction and GLUT4 expression was analyzed by quantitative real time RT PCR using the same primer/probe set as in Figure 1E (n = 2). (G) Cells were transduced with the indicated shrnas and incubated 2 days. Cells were harvested for RNA extraction and GLUT8 expression was analyzed by quantitative real time RT PCR using the same primer/probe set as in Figure 1E (n = 3). Data in panels B, C, F, and G are means ± SEM.
3 3 Figure S2. GLUT4 expression in myeloma is characterized by an atypical, basal cell surface localization. (A J) CD138+ primary myeloma cells isolated from bone marrow aspirates of three MM patients, five myeloma cell lines and normal B lymphocytes isolated from two healthy donors were immunostained for GLUT4 utilizing a commercial GLUT4 antibody or GLUT4 antiserum (red) and counterstained with DAPI (blue) prior to analysis by confocal immunofluorescence microscopy. Phase image are included to demarcate cell boundaries while DAPI positive regions indicate nuclei. Merged images validate partial localization of GLUT4 to the cell surface. Phase images were not collected for the MM.1S cell line. (K) JJN3 cells were transduced with one of two distinct GLUT4 targeted shrnas or control (C), non targeted shrna. Cells were incubated for 4 days before cell lysates were prepared and GLUT4 expression was assessed by immunoblot analysis. Representative immunoblot is shown. (L) JJN3 cells from part K were analyzed for growth 4 days after transduction by measurement of viable cell concentrations using trypan blue exclusion. Data in panel L are means ± SEM. For data in panels A,B, E G, and K L, n 3. For primary samples in panels C, D, H J, n = 1. * P <.05 ** P <.01 *** P <.005
4 4 Figure S3. GLUT1 suppression in MM cell lines elicits modest phenotypic effects. (A) Cells were transduced with the indicated shrnas and incubated 2 days before protein extraction and analysis of GLUT1 protein expression was performed. Representative blot is shown. (B) Cells from part A were
5 5 cultured in 5 mm glucose containing medium for 5 hours. Glucose consumption rates and lactate production rates were determined and normalized to control shrna expressing cells. (C E) Cells from part A were analyzed for viability and proliferation. Viable cell densities are expressed as fold change relative to the day 0 reading of control shrna expressing cells. (F G) Cell viability on Day 2 in the experiments in parts C E is plotted. Trypan blue exclusion test was used and values are normalized to control shrna expressing cells. (I K) KMS11 cells, L363 cells and normal B lymphocytes isolated from healthy donors were immunostained for GLUT1 using a commercial GLUT1 antibody (red) and counterstained with DAPI (blue) prior to analysis by confocal immunofluorescence microscopy. Phase images are included to demarcate cell boundaries while DAPI positive regions identify nuclei. Data in parts B H are means ± SEM. For data in parts A K, n 3. * P <.05 ** P <.01 *** P <.005
6 6 Figure S4. Anti IgM stimulation of normal B lymphocytes is associated with a decline in GLUT1 expression and increased GLUT4 expression and cell surface localization. B lymphocytes isolated from four different healthy volunteers were stimulated to proliferate through incubation with anti human IgM F(ab ) 2 for 15 hours. Cells were then harvested and immunostained for GLUT1 or GLUT4 (red) and counterstained with DAPI (blue) prior to analysis by confocal immunofluorescence microscopy. Phase images are included to demarcate cell boundaries while DAPI positive regions identify nuclei. Representative images are shown (n = 4).
7 7 Figure S5. Knockdown of intracellularly localized GLUT8 with two distinct shrnas supports target specificity; cell cycle arrest induces glucose transport inhibition. (A) KMS11 cells were transduced with the indicated shrnas. Cells were incubated for 2 days before RNA was extracted and GLUT8 expression was analyzed by quantitative real time RT PCR. Expression is normalized to control shrna expressing cells. (B) KMS11 cells from part A were analyzed for growth 4 days after transduction by measurement of viable cell concentrations using trypan blue exclusion. (C) (E) KMS11 cells, L363 cells and normal B lymphocytes isolated from healthy donors were immunostained for GLUT8 using affinity purified GLUT8
8 8 antiserum (red) and counterstained with DAPI (blue) prior to analysis by confocal immunofluorescence microscopy. Phase images are included to demarcate cell boundaries while DAPI positive regions identify nuclei. (F) KMS11 cells were transduced with GFP or p16 INK4A cdnas and incubated for 3 days before protein extraction and assessment of p16 INK4A expression was performed by immunoblot analysis. GAPDH serves as a loading control. A representative blot is shown. (G) KMS11 cells were transduced on Day 0 as in part F and cell growth was determined by measurement of viable cell densities at Days 0 and 3. (H) GFP and 16 INK4A expressing cells from part F were cultured in 5 mm glucose containing medium for 5 hours and glucose consumption rates were determined. Data in parts A B and G H are means ± SEM. For data in parts B and F H, n = 2. For data in parts A and C E, n 3. * P <.05 ** P <.01 *** P <.005
9 9 Figure S6. Knockdown of exclusively cell surface localized GLUT11 with two distinct shrnas supports target specificity. (A) JJN3 cells were transduced with the indicated shrnas and incubated for 2 days before RNA was extracted and GLUT11 expression was analyzed by quantitative real time RT PCR. Expression is normalized to control shrna expressing cells. (B) JJN3 cells from part A were analyzed for cell death 4 days after transduction via trypan blue exclusion assay (n = 2). (C) KMS11 cells, L363 cells and normal B lymphocytes isolated from healthy donors were immunostained using GLUT11 antiserum (red) and counterstained with DAPI (blue) prior to analysis by confocal immunofluorescence microscopy. Background staining with pre immune serum is included as a control. DAPI staining identifies nuclei. Data in parts A B are means ± SEM. For data in parts A and C, n 3. * P <.05 ** P <.01 *** P <.005
10 10 Figure S7. Ritonavir treatment recapitulates glucose limitation by potentiating doxorubicin cytotoxicity. (A) KMS11 and (B) L363 cells were treated with DMSO (D) vehicle control, 20 µm ritonavir, 25 (L363) or 75 (KMS11) nm doxorubicin or the combination of both drugs for 72 hours. Cell death was assessed by flow cytometric analysis of DAPI staining. Data are means ± SEM (n 3). * P <.05 ** P <.01 *** P <.005
11 11 Supplemental Methods Table S1. Sequences of GLUT specific shrnas. shrna designation NCBI target reference sequence TRC number Sense sequence GLUT4 #1* NM_ TRCN GTGATTGAACAGAGCTACAAT GLUT4 #2 NM_ TRCN CTCCTTCCTCATTGGTATCAT GLUT1 NM_ TRCN CTTCAAAGTTCCTGAGACTAA GLUT8 #1 NM_ TRCN GCTGCTTCTCATGTGCTTCAT GLUT8 #2 NM_ TRCN CCCGGTCTACATCTCCGAAAT GLUT11 #1 NM_ TRCN CGATCACCTAGTCCTGCTTAT GLUT11 #2 NM_ TRCN GCTCATGTGGATCATGCTCAT * shrna used in Figure 2A H shrna used in Figure 4A E shrna used in Figure 4G K
12 12 Table S2. Characterization of GLUT specific primer probe sets used in real time RT PCR experiments Primer probe set cdna target Applied Biosystems TM assay ID NCBI target reference sequence Amplicon GLUT1 Hs _m1 NM_ bp, Exon Boundary 2 3 GLUT2 Hs _m1 NM_ bp, Exon Boundary 1 2 GLUT3 Hs _m1 NM_ bp, Exon Boundary 1 2 GLUT4 Hs _m1 NM_ bp, Exon Boundary 1 2 GLUT5 Hs _m1 NM_ NR_ NM_ GLUT6 Hs _m1 NM_ NM_ bp, Exon Boundary bp, Exon Boundary bp, Exon Boundary bp, Exon Boundary bp, Exon Boundary 2 3 GLUT7 Hs _m1 NM_ bp, Exon Boundary GLUT8 Hs _m1 NM_ bp, Exon Boundary 4 5 GLUT9 Hs _m1 NM_ NM_ bp, Exon Boundary bp, Exon Boundary 2 3 GLUT10 Hs _m1 NM_ bp, Exon Boundary 3 4 GLUT11 Hs _m1 NM_ NM_ NM_ bp, Exon Boundary bp, Exon Boundary bp, Exon Boundary 2 3 GLUT11 Alternate* Hs _m1 Genbank mrnas: CR AB BC BC AK bp 104 bp, Exon Boundary bp, Exon Boundary bp 104 bp, Exon Boundary 5 6 GLUT12 Hs _m1 NM_ bp, Exon Boundary 1 2 * Primer probe set only used for KMS11 cells in Figure 4G
J. Cell Sci. 128: doi:10.1242/jcs.164566: Supplementary Material
Figure S1. Microtubule and microfilament drug treatments severely interfere with mitotic spindle morphology, length and positioning. (A) GFP-fused lamin-a/c, LAP2 or BAF1 localizes to the spindle and all
More informationNotch 1 -dependent regulation of cell fate in colorectal cancer
Notch 1 -dependent regulation of cell fate in colorectal cancer Referees: PD Dr. Tobias Dick Prof. Dr. Wilfried Roth http://d-nb.info/1057851272 CONTENTS Summary 1 Zusammenfassung 2 1 INTRODUCTION 3 1.1
More informationMultiple Myeloma and Colorectal Cancer
Multiple Myeloma and Colorectal Cancer From Systems Immunology to Single Cells Leo Hansmann Mark M. Davis Lab Department of Microbiology&Immunology Stanford University Multiple Myeloma Monoclonal disease
More information2.1.2 Characterization of antiviral effect of cytokine expression on HBV replication in transduced mouse hepatocytes line
i 1 INTRODUCTION 1.1 Human Hepatitis B virus (HBV) 1 1.1.1 Pathogenesis of Hepatitis B 1 1.1.2 Genome organization of HBV 3 1.1.3 Structure of HBV virion 5 1.1.4 HBV life cycle 5 1.1.5 Experimental models
More informationInvestigating the role of a Cryptosporidium parum apyrase in infection
Investigating the role of a Cryptosporidium parum apyrase in infection David Riccardi and Patricio Manque Abstract This project attempted to characterize the function of a Cryptosporidium parvum apyrase
More informationMitotic Membrane Turnover Coordinates Differential Induction of the Heart Progenitor Lineage
Developmental Cell Supplemental Information Mitotic Membrane Turnover Coordinates Differential Induction of the Heart Progenitor Lineage Christina D. Cota and Brad Davidson Supplemental Figures S1-S7 S1.
More informationUses of Flow Cytometry
Uses of Flow Cytometry 1. Multicolour analysis... 2 2. Cell Cycle and Proliferation... 3 a. Analysis of Cellular DNA Content... 4 b. Cell Proliferation Assays... 5 3. Immunology... 6 4. Apoptosis... 7
More informationSuppl. Figure 1. Cells cultured in oxldl take up Oil Red O in a time-dependent
Suppl. Figure 1. Cells cultured in oxldl take up Oil Red O in a time-dependent manner. Uptake of Oil Red O was performed as detailed in Materials and Methods and absorbance of samples was expressed as
More informationCD3/TCR stimulation and surface detection Determination of specificity of intracellular detection of IL-7Rα by flow cytometry
CD3/TCR stimulation and surface detection Stimulation of HPB-ALL cells with the anti-cd3 monoclonal antibody OKT3 was performed as described 3. In brief, antibody-coated plates were prepared by incubating
More informationSUPPLEMENTARY DATA 1
SUPPLEMENTARY DATA 1 Supplementary Figure S1. Overexpression of untagged Ago2 inhibits the nuclear transport of the dotted foci of GFP-signal of myc-gfp-tnrc6a-nes-mut. (A C) HeLa cells expressing myc-gfp-tnrc6a-nes-mut
More informationTitle: Mapping T cell epitopes in PCV2 capsid protein - NPB #08-159. Date Submitted: 12-11-09
Title: Mapping T cell epitopes in PCV2 capsid protein - NPB #08-159 Investigator: Institution: Carol Wyatt Kansas State University Date Submitted: 12-11-09 Industry summary: Effective circovirus vaccines
More informationFig. S1. Identification of CRMs with activity in Ci-Tbx2/3 expression domains outside the notochord. B-F
Fig. S1. Identification of CRMs with activity in Ci-Tbx2/3 expression domains outside the notochord. (A) Top: map of the Ci- Tbx2/3 locus. Teal rectangles and lines denote exons and introns, respectively.
More informationAbout Our Products. Blood Products. Purified Infectious/Inactivated Agents. Native & Recombinant Viral Proteins. DNA Controls and Primers for PCR
About Our Products Purified Infectious/Inactivated Agents ABI produces a variety of specialized reagents, allowing researchers to choose the best preparations for their studies. Available reagents include
More informationHead of College Scholars List Scheme. Summer Studentship. Report Form
Head of College Scholars List Scheme Summer Studentship Report Form This report should be completed by the student with his/her project supervisor. It should summarise the work undertaken during the project
More informationEXPRESSION ARREST shrna mir GENOME- WIDE LIBRARIES
C GUGAAG EXPRESSION ARREST shrna mir GENOME- WIDE LIBRARIES MicroRNA-adapted shrna (shrna mir ) for increased, specific and consistent knockdown. MicroRNA PROCESSING PATHWAY UTILIZED FOR shrna mir Developed
More informationSuperior TrueMAB TM monoclonal antibodies for the recognition of proteins native epitopes
Superior TrueMAB TM monoclonal antibodies for the recognition of proteins native epitopes Outlines Brief introduction of OriGene s mission on gene-centric product solution. TrueMAB monoclonal antibody
More informationProtein Analysis. -Detection and quantification. Toby M Holmes
Protein Analysis -Detection and quantification Toby M Holmes Clinical Research Unit UCD school of Medicine and Medical Sciences Mater Misericordiae University Hospital Dublin Protein structure General
More informationThe immune response Antibodies Antigens Epitopes (antigenic determinants) the part of a protein antigen recognized by an antibody Haptens small
The immune response Antibodies Antigens Epitopes (antigenic determinants) the part of a protein antigen recognized by an antibody Haptens small molecules that can elicit an immune response when linked
More informationSupplemental Material. Methods
Supplemental Material Methods Measurement of lncrnas expression Total RNA was extracted from PAXgene TM tubes using the PAXgene blood RNA kit (Qiagen, Venlo, Netherlands) as described by the manufacturer.
More informationApplication Note No. 2 / July 2012. Quantitative Assessment of Cell Quality, Viability and Proliferation. System
Application Note No. 2 / July 2012 Quantitative Assessment of Cell Quality, Viability and Proliferation System Quantitative Assessment of Cell Quality, Viability and Proliferation Introduction In vitro
More informationReal-time quantitative RT -PCR (Taqman)
Real-time quantitative RT -PCR (Taqman) Author: SC, Patti Lab, 3/03 This is performed as a 2-step reaction: 1. cdna synthesis from DNase 1-treated total RNA 2. PCR 1. cdna synthesis (Advantage RT-for-PCR
More informationTHE His Tag Antibody, mab, Mouse
THE His Tag Antibody, mab, Mouse Cat. No. A00186 Technical Manual No. TM0243 Update date 01052011 I Description.... 1 II Key Features. 2 III Storage 2 IV Applications.... 2 V Examples - ELISA..... 2 VI
More informationChapter 6: Antigen-Antibody Interactions
Chapter 6: Antigen-Antibody Interactions I. Strength of Ag-Ab interactions A. Antibody Affinity - strength of total noncovalent interactions between single Ag-binding site on an Ab and a single epitope
More informationGene Expression Assays
APPLICATION NOTE TaqMan Gene Expression Assays A mpl i fic ationef ficienc yof TaqMan Gene Expression Assays Assays tested extensively for qpcr efficiency Key factors that affect efficiency Efficiency
More informationHuman Leukocyte Antigens - HLA
Human Leukocyte Antigens - HLA Human Leukocyte Antigens (HLA) are cell surface proteins involved in immune function. HLA molecules present antigenic peptides to generate immune defense reactions. HLA-class
More informationChapter 3.2» Custom Monoclonal
198 3 3.2 Custom Monoclonal 199 Mouse monoclonal antibody development Chapter 3.2» Custom Monoclonal 200 In vitro monoclonals expression service 201 Mouse monoclonal antibody additional services 202 Magnetic
More informationThe cell lines used in this study were obtained from the American Type Culture
Supplementary materials and methods Cell culture and drug treatments The cell lines used in this study were obtained from the American Type Culture Collection (ATCC) and grown as previously described.
More informationA novel polarized cell culture model to study HCV infection
A novel polarized cell culture model to study HCV infection Sandrine Belouzard Centre d Infection et d Immunité de Lille 15 ième réunion du réseau national hépatites Paris- 30 janvier 2015 HCV entry and
More informationChapter 6. Antigen-Antibody Properties 10/3/2012. Antigen-Antibody Interactions: Principles and Applications. Precipitin reactions
Chapter 6 Antigen-Antibody Interactions: Principles and Applications Antigen-Antibody Properties You must remember antibody affinity (single) VS avidity (multiple) High affinity: bound tightly and longer!
More informationTABLE OF CONTENT. Page ACKNOWLEDGEMENTS. iii ENGLISH ABSTRACT THAI ABSTRACT. vii LIST OF TABLES LIST OF FIGURES. xvi ABBREVIATIONS.
x TABLE OF CONTENT ACKNOWLEDGEMENTS ENGLISH ABSTRACT THAI ABSTRACT LIST OF TABLES LIST OF FIGURES ABBREVIATIONS iii iv vii xv xvi xviii CHAPTER I: INTRODUCTION 1.1 Statement of problems 1 1.2 Literature
More informationTOOLS sirna and mirna. User guide
TOOLS sirna and mirna User guide Introduction RNA interference (RNAi) is a powerful tool for suppression gene expression by causing the destruction of specific mrna molecules. Small Interfering RNAs (sirnas)
More informationCONTENT. Chapter 1 Review of Literature. List of figures. List of tables
Abstract Abbreviations List of figures CONTENT I-VI VII-VIII IX-XII List of tables XIII Chapter 1 Review of Literature 1. Vaccination against intracellular pathogens 1-34 1.1 Role of different immune responses
More informationSupplementary Figure 1.
Supplementary Figure 1. (A) MicroRNA 212 enhances IS from pancreatic β-cells. INS-1 832/3 β-cells were transfected with precursors for mirnas 212, 375, or negative control oligonucleotides. 48 hrs after
More informationSpeed Matters - Fast ways from template to result
qpcr Symposium 2007 - Weihenstephan Speed Matters - Fast ways from template to result March 28, 2007 Dr. Thorsten Traeger Senior Scientist, Research and Development - 1 - Overview Ạgenda Fast PCR The Challenges
More informationDescription: Molecular Biology Services and DNA Sequencing
Description: Molecular Biology s and DNA Sequencing DNA Sequencing s Single Pass Sequencing Sequence data only, for plasmids or PCR products Plasmid DNA or PCR products Plasmid DNA: 20 100 ng/μl PCR Product:
More informationInternational Beryllium Conference, Montreal, Canada March 10, 2005
Alternative Lymphocyte Proliferation Tests: BrdU and Flow Cytometry Based Tests International Beryllium Conference, Montreal, Canada March 10, 2005 Tim K. Takaro Department of Environmental and Occupational
More informationONLINE SUPPLEMENTAL MATERIAL. Allele-Specific Expression of Angiotensinogen in Human Subcutaneous Adipose Tissue
ONLINE SUPPLEMENTAL MATERIAL Allele-Specific Expression of Angiotensinogen in Human Subcutaneous Adipose Tissue Sungmi Park 1, Ko-Ting Lu 1, Xuebo Liu 1, Tapan K. Chatterjee 2, Steven M. Rudich 3, Neal
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID papillary renal cell carcinoma (translocation-associated) PRCC Human This gene
More informationBiochemical Journal www.biochemj.org
Biochem. J. (2013) 451, 185 194 (Printed in Great Britain) doi:10.1042/bj20130026 SUPPLEMENTARY ONLINE DATA The P-body component USP52/PAN2 is a novel regulator of HIF1A mrna stability John S. BETT*, Adel
More informationReal-Time PCR Vs. Traditional PCR
Real-Time PCR Vs. Traditional PCR Description This tutorial will discuss the evolution of traditional PCR methods towards the use of Real-Time chemistry and instrumentation for accurate quantitation. Objectives
More informationpcas-guide System Validation in Genome Editing
pcas-guide System Validation in Genome Editing Tagging HSP60 with HA tag genome editing The latest tool in genome editing CRISPR/Cas9 allows for specific genome disruption and replacement in a flexible
More informationCell Viability Assays: Microtitration (MTT) Viability Test Live/Dead Fluorescence Assay. Proliferation Assay: Anti-PCNA Staining
Cell Viability Assays: Microtitration (MTT) Viability Test Live/Dead Fluorescence Assay Proliferation Assay: Anti-PCNA Staining Spring 2008 1 Objectives To determine the viability of cells under different
More informationCell viability assays were represented as mean ± S.E. (n=3). Comparisons between the
Supplemental Data 1 Online supplemental information Statistical analysis Cell viability assays were represented as mean ± S.E. (n=3). Comparisons between the groups were performed using repeated measures
More informationAviva Systems Biology
Aviva Custom Antibody Services and Prices Rabbit Polyclonal Antibody Service Package Number Description Package Contents Time Price Polyclonal package 1 (From protein to antiserum) Polyclonal package 2
More informationCFSE Cell Division Assay Kit
CFSE Cell Division Assay Kit Item No. 10009853 Customer Service 800.364.9897 * Technical Support 888.526.5351 www.caymanchem.com TABLE OF CONTENTS GENERAL INFORMATION 3 Materials Supplied 4 Precautions
More informationBasic Science in Medicine
Medical Journal of th e Islamic Republic of Iran Volume 18 Number 3 Fall 1383 November 2004 Basic Science in Medicine ] EXPANSION OF HUMAN CORD BLOOD PRIMITIVE PROGENITORS IN SERUM-FREE MEDIA USING HUMAN
More informationEssentials of Real Time PCR. About Sequence Detection Chemistries
Essentials of Real Time PCR About Real-Time PCR Assays Real-time Polymerase Chain Reaction (PCR) is the ability to monitor the progress of the PCR as it occurs (i.e., in real time). Data is therefore collected
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/7/339/ra80/dc1 Supplementary Materials for Manipulation of receptor oligomerization as a strategy to inhibit signaling by TNF superfamily members Julia T. Warren,
More informationThermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual
Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual F- 470S 20 cdna synthesis reactions (20 µl each) F- 470L 100 cdna synthesis reactions (20 µl each) Table of contents 1. Description...
More informationPROTOCOL. Immunostaining for Flow Cytometry. Background. Materials and equipment required.
PROTOCOL Immunostaining for Flow Cytometry 1850 Millrace Drive, Suite 3A Eugene, Oregon 97403 Rev.0 Background The combination of single cell analysis using flow cytometry and the specificity of antibody-based
More informationAviva Systems Biology
Aviva Custom Antibody Service and Price Mouse Monoclonal Antibody Service Package Number Description Package Contents Time Price Customer provides antigen protein $6,174 Monoclonal package1 (From protein
More informationHiPerFect Transfection Reagent Handbook
Fifth Edition October 2010 HiPerFect Transfection Reagent Handbook For transfection of eukaryotic cells with sirna and mirna Sample & Assay Technologies QIAGEN Sample and Assay Technologies QIAGEN is the
More information3D Cell Culture mimsys G
3D Cell Culture mimsys G xeno-free & nutrient permeable hydrogel for 3D cell culture mimsys G is a xeno-free and non-immunogenic, easy to handle hydrogel for cell encapsulation in 3D experiments in vitro
More informationKMS-Specialist & Customized Biosimilar Service
KMS-Specialist & Customized Biosimilar Service 1. Polyclonal Antibody Development Service KMS offering a variety of Polyclonal Antibody Services to fit your research and production needs. we develop polyclonal
More informationEnumeration and Viability of Nucleated Cells from Bone Marrow, Cord Blood, and Mobilized Peripheral Blood
Application Note Primary Cell Analysis Enumeration and Viability of Nucleated Cells from Bone Marrow, Cord Blood, and Mobilized Peripheral Blood Cell Viability Introduction: Bone Marrow, Cord Blood, Stem
More informationPulling the Plug on Cancer Cell Communication. Stephen M. Ansell, MD, PhD Mayo Clinic
Pulling the Plug on Cancer Cell Communication Stephen M. Ansell, MD, PhD Mayo Clinic Why do Waldenstrom s cells need to communicate? Waldenstrom s cells need activating signals to stay alive. WM cells
More informationEdU Flow Cytometry Kit. User Manual
User Manual Ordering information: (for detailed kit content see Table 2) EdU Flow Cytometry Kits for 50 assays: Product number EdU Used fluorescent dye BCK-FC488-50 10 mg 6-FAM Azide BCK-FC555-50 10 mg
More informationFighting the Battles: Conducting a Clinical Assay
Fighting the Battles: Conducting a Clinical Assay 6 Vocabulary: In Vitro: studies in biology that are conducted using components of an organism that have been isolated from their usual biological surroundings
More informationLESSON 3: ANTIBODIES/BCR/B-CELL RESPONSES
Introduction to immunology. LESSON 3: ANTIBODIES/BCR/B-CELL RESPONSES Today we will get to know: The antibodies How antibodies are produced, their classes and their maturation processes Antigen recognition
More informationOutline. 1. Experiment. 2. Sample analysis and storage. 3. Image analysis and presenting data. 4. Probemaker
Tips and tricks Note: this is just an informative document with general recommendations. Please contact support@olink.com should you have any queries. Document last reviewed 2011-11-17 Outline 1. Experiment
More informationIntroduction to flow cytometry
Introduction to flow cytometry Flow cytometry is a popular laser-based technology. Discover more with our introduction to flow cytometry. Flow cytometry is now a widely used method for analyzing the expression
More informationAnti-CD38 anti-cd3 bispecific antibody in multiple myeloma
Anti-CD38 anti-cd3 bispecific antibody in multiple myeloma David E. Szymkowski Senior Director, Biotherapeutics Proteins by Design 1960s...1980s...2000s... Where are the bispecific antibody drugs? J Exp.
More informationChapter 8. Summary and Perspectives
Chapter 8 Summary and Perspectives 131 Chapter 8 Summary Overexpression of the multidrug resistance protein MRP1 confer multidrug resistance (MDR) to cancer cells. The contents of this thesis describe
More informationMolecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION
Molecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION Susan Carson Heather B. Miller D.Scott Witherow ELSEVIER AMSTERDAM BOSTON HEIDELBERG LONDON NEW YORK OXFORD PARIS SAN DIEGO SAN
More informationHow to construct transgenic mice
How to construct transgenic mice Sandra Beer-Hammer Autumn School 2010 Bad Schandau Methods additional genetic information transgenic mouse line gene inactivation gene-deficient knockout mouse line Jak2
More informationThe Costimulatory Molecule CD27 Maintains Clonally
Immunity, Volume 35 Supplemental Information The Costimulatory Molecule CD7 Maintains Clonally Diverse CD8 + T Cell Responses of Low Antigen Affinity to Protect against Viral Variants Klaas P.J.M. van
More informationA customizable ADCC assay service for antibodies & fusion proteins.
Antibody Dependent Cell- Mediated Cytotoxicity (ADCC) Assay A customizable ADCC assay service for antibodies & fusion proteins. Our ADCC assay service accurately detects cell lysis based on LDH-release.
More informationSpecialty Lab and Immunological Testing Services
Specialty Lab and Immunological Testing Services OVER 30 YEARS OF SPECIALTY LAB EXPERIENCE Precision for Medicine recognizes the critical role that sample testing and handling play in achieving high-quality,
More informationUNDERSTANDING MULTIPLE MYELOMA AND LABORATORY VALUES Benjamin Parsons, DO bmparson@gundersenhealth.org Gundersen Health System Center for Cancer and
UNDERSTANDING MULTIPLE MYELOMA AND LABORATORY VALUES Benjamin Parsons, DO bmparson@gundersenhealth.org Gundersen Health System Center for Cancer and Blood Disorders La Crosse, WI UNDERSTANDING MULTIPLE
More informationCell Viability Measurement
Cell Viability Measurement Viability is a measure of the metabolic state of a cell population which is indicative of the potential for growth Most common method: membrane integrity Trypan blue exclusion:
More informationFigure S1. SDS-PAGE of purified rtmd proteins Figure S2. rtmd1 interferes with chemotaxis of HUVECs induced by rtmd23
Figure S1. SDS-PAGE of purified rtmd proteins SDS-polyacrylamide gel electrophoresis was performed using a 10% separation gel. One microgram of each rtmd protein was applied. Detection was performed with
More informationPreciseTM Whitepaper
Precise TM Whitepaper Introduction LIMITATIONS OF EXISTING RNA-SEQ METHODS Correctly designed gene expression studies require large numbers of samples, accurate results and low analysis costs. Analysis
More informationInstructions. Torpedo sirna. Material. Important Guidelines. Specifications. Quality Control
is a is a state of the art transfection reagent, specifically designed for the transfer of sirna and mirna into a variety of eukaryotic cell types. is a state of the art transfection reagent, specifically
More informationP4 Distribution of Cetuximab in Models of Human Lung Cancer
Dr. Margarete Fischer-Bosch-Institute of Clinical Pharmacology, University of Tübingen, Robert Bosch Foundation Stuttgart, Germany FORSYS Partner Project Predictive Cancer Therapy Project Meeting 14.10.09
More informationProteomics Research with BIOCHAIN
Proteomics Research with IOCHIN Protein Extraction CNMCS Compartmental Protein Extraction Kit Cytoplasmic, Nuclear, Membrane, and Cytoskeleton Protein One kit isolates four different proteins sequentially
More informationCell culture and Sensor Ping-Pong assay. Ecotropic Phoenix HEK293T cells and Trp53 -
Supplemental Experimental Procedures Cell culture and Sensor Ping-Pong assay. Ecotropic Phoenix HEK293T cells and Trp53 - /- MEFs (1) were grown in DMEM supplemented with 10% fetal bovine serum (FBS),
More informationHuman CD4+T Cell Care Manual
Human CD4+T Cell Care Manual INSTRUCTION MANUAL ZBM0067.02 SHIPPING CONDITIONS Human CD4+T Cells, cryopreserved Cryopreserved human CD4+T cells are shipped on dry ice and should be stored in liquid nitrogen
More informationMAB Solut. MABSolys Génopole Campus 1 5 rue Henri Desbruères 91030 Evry Cedex. www.mabsolut.com. is involved at each stage of your project
Mabsolus-2015-UK:Mise en page 1 03/07/15 14:13 Page1 Services provider Department of MABSolys from conception to validation MAB Solut is involved at each stage of your project Creation of antibodies Production
More informationActivation and effector functions of HMI
Activation and effector functions of HMI Hathairat Thananchai, DPhil Department of Microbiology Faculty of Medicine Chiang Mai University 25 August 2015 ว ตถ ประสงค หล งจากช วโมงบรรยายน แล วน กศ กษาสามารถ
More informationSureSilencing shrna Plasmids
User Manual BIOMOL GmbH Waidmannstr. 35 22769 Hamburg info@biomol.de www.biomol.de Phone:+49-40-8532600 or 0800-2466651 (D) Fax: +49-40-85326022 or 0800-2466652 (D) SureSilencing shrna Plasmids Genome-Wide
More informationChapter 2 Antibodies. Contents. Introduction
Chapter 2 Antibodies Keywords Immunohistochemistry Antibody labeling Fluorescence microscopy Fluorescent immunocytochemistry Fluorescent immunohistochemistry Indirect immunocytochemistry Immunostaining
More informationReconsideration Code 86386. Reconsideration Code Description Nuclear Matrix Protein 22 (NMP22), qualitative
Calendar Year 2013 Centers for Medicare and Medicaid Services (CMS) New and Reconsidered Clinical Laboratory Fee Schedule (CLFS) Test Codes And Final Payment Determinations Reconsideration Code 86386 Reconsideration
More informationRNA Viruses. A Practical Approac h. Alan J. Cann
RNA Viruses A Practical Approac h Alan J. Cann List of protocols page xiii Abbreviations xvii Investigation of RNA virus genome structure 1 A j. Easton, A.C. Marriott and C.R. Pringl e 1 Introduction-the
More informationSupporting Information
Supporting Information Kondo et al. 1.173/pnas.787415 SI Methods Conventional and Quantitative RT-PCR. Total RNA was extracted from cultured ES cells or ES-derived cells using the RNeasy Minikit (Qiagen).
More informationInhibition of MicroRNA Sensitizes 3D Breast Cancer Microtissues to Radiation Therapy
CASE STUDY High Content Image Analysis Inhibition of MicroRNA Sensitizes 3D Breast Cancer Microtissues to Radiation Therapy Dr. Nataša Anastasov leads the Personalized Radiation Therapy Group within the
More informationLaboratory Techniques I Oncology for Scientists I
Laboratory Techniques I Oncology for Scientists I September 9 th, 2015 Hayley Affronti, PhD Student Hayley.Affronti@roswellpark.org Dr. Sheila Figel too! When we first hit the lab there are so many things
More informationRPCI 004 v.002 Staining Procedure For all Directly Conjugated Reagents (Whole Blood Method)
Immune Tolerance Network RPCI 004 v.002 Staining Procedure For all Directly Conjugated Reagents (Whole Blood Method) Author: Paul Wallace, Director, RPCI Laboratory of Flow Cytometry Approved by: Paul
More informationIntroduction To Real Time Quantitative PCR (qpcr)
Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors
More informationCyTOF2. Mass cytometry system. Unveil new cell types and function with high-parameter protein detection
CyTOF2 Mass cytometry system Unveil new cell types and function with high-parameter protein detection DISCOVER MORE. IMAGINE MORE. MASS CYTOMETRY. THE FUTURE OF CYTOMETRY TODAY. Mass cytometry resolves
More informationREAL TIME PCR USING SYBR GREEN
REAL TIME PCR USING SYBR GREEN 1 THE PROBLEM NEED TO QUANTITATE DIFFERENCES IN mrna EXPRESSION SMALL AMOUNTS OF mrna LASER CAPTURE SMALL AMOUNTS OF TISSUE PRIMARY CELLS PRECIOUS REAGENTS 2 THE PROBLEM
More informationMolecular Diagnosis of Hepatitis B and Hepatitis D infections
Molecular Diagnosis of Hepatitis B and Hepatitis D infections Acute infection Detection of HBsAg in serum is a fundamental diagnostic marker of HBV infection HBsAg shows a strong correlation with HBV replication
More informationPrinciples of Immunohistochemistry Queen s Laboratory For Molecular Pathology
Principles of Immunohistochemistry Queen s Laboratory For Molecular Pathology Table of Contents POLYCLONAL VERSUS MONOCLONAL ANTIBODIES...PAGE 3 DIRECT & INDIRECT ASSAYS.PAGE 4 LABELS..PAGE 5 DETECTION...PAGE
More informationImmunophenotyping peripheral blood cells
IMMUNOPHENOTYPING Attune Accoustic Focusing Cytometer Immunophenotyping peripheral blood cells A no-lyse, no-wash, no cell loss method for immunophenotyping nucleated peripheral blood cells using the Attune
More informationAAGPs TM Anti-Aging Glyco Peptides. Enhancing Cell, Tissue and Organ Integrity Molecular and biological attributes of lead AAGP molecule
AAGPs TM Anti-Aging Glyco Peptides Enhancing Cell, Tissue and Organ Integrity Molecular and biological attributes of lead AAGP molecule 1 Acknowledgements This presentation was prepared by Dr. Samer Hussein
More informationUnderstanding the immune response to bacterial infections
Understanding the immune response to bacterial infections A Ph.D. (SCIENCE) DISSERTATION SUBMITTED TO JADAVPUR UNIVERSITY SUSHIL KUMAR PATHAK DEPARTMENT OF CHEMISTRY BOSE INSTITUTE 2008 CONTENTS Page SUMMARY
More informationChromatin Immunoprecipitation (ChIP)
Chromatin Immunoprecipitation (ChIP) Day 1 A) DNA shearing 1. Samples Dissect tissue (One Mouse OBs) of interest and transfer to an eppendorf containing 0.5 ml of dissecting media (on ice) or PBS but without
More informationSDS gel electrophoresis was performed using a 4% by 20% gradient gel 8. Quantification of Western blots was performed using Image J Processing and
Supplemental Material: Western blot: SDS gel electrophoresis was performed using a 4% by 20% gradient gel 8. Quantification of Western blots was performed using Image J Processing and Analysis (NIH). Quantitative
More informationEU Reference Laboratory for E. coli Department of Veterinary Public Health and Food Safety Unit of Foodborne Zoonoses Istituto Superiore di Sanità
Identification and characterization of Verocytotoxin-producing Escherichia coli (VTEC) by Real Time PCR amplification of the main virulence genes and the genes associated with the serogroups mainly associated
More informationSecondary Antibodies and Conjugates
biodescriptor biomolecules Full image -- Remove color from text box when placing image Secondary Antibodies and Conjugates Initiative Descriptor Primary Cover Header Popular Reagents for Quality Secondary
More informationLEUKEMIA LYMPHOMA MYELOMA Advances in Clinical Trials
LEUKEMIA LYMPHOMA MYELOMA Advances in Clinical Trials OUR FOCUS ABOUT emerging treatments Presentation for: Judith E. Karp, MD Advancements for Acute Myelogenous Leukemia Supported by an unrestricted educational
More information