Cell culture and Sensor Ping-Pong assay. Ecotropic Phoenix HEK293T cells and Trp53 -
|
|
|
- David Pearson
- 9 years ago
- Views:
Transcription
1 Supplemental Experimental Procedures Cell culture and Sensor Ping-Pong assay. Ecotropic Phoenix HEK293T cells and Trp53 - /- MEFs (1) were grown in DMEM supplemented with 10% fetal bovine serum (FBS), 100 U/ml penicillin and 100 g/ml streptomycin (100-Pen-Strep) at 37 C with 5% CO 2. ERC chicken reporter cells were grown in DMEM supplemented with 10% FBS, 1 mm sodium pyruvate and 100-Pen-Strep at 37 C with 5% CO 2, and frozen in 5% DMSO, 70% FBS and 25% culture medium. In ERCs, Tet-regulatable shrnas were induced by addition of 0.5 g/ml doxycycline (Sigma-Aldrich) that was replaced every 3 days in culture media. The Sensor Ping-Pong assay was conducted as previously described (2). All fluorescence activated cell sorting (FACS) procedures were carried out on a FACSAria II (BD Biosciences). The Top5 gating reference contained the shrnas Braf.5053, Luci.1309, Pten.1523, Pten.2049 and Trp , while the Bottom5 gating reference contained the shrnas Braf.3750, Cdkn2a.218, Cebpa.577, Cebpa.898 and Trp ERC reporter cells were infected with the psensor shrna- Sensor libraries at single copy and sorted either after treatment with doxycycline and G418 (500 g/ml) for 6-7 days or after doxycycline and G418 withdrawal for 6-7 days. For each sort a representation of at least 1000-fold the complexity of the sorted pool was maintained. Retroviral transduction. Cells were transduced as previously described (2). Transduction efficiency was assessed 48 h post infection by quantification of fluorescent reporters using flow cytometry (Guava EasyCyte, Guava Technologies). Where a specific infection rate was desired, test infections were carried out at different dilution rates and ideal infection ratios deduced. Transduced cell populations were usually selected 48 h after infection, using 2.5 g/ml puromycin (Sigma-Aldrich) or 500 g/ml G418 (Geneticin, Gibco-Invitrogen). To obtain singlecopy integrations, cell lines (ERC, Trp53 -/- MEF) were tested to be infectable up to approximately 100% and then infected at <20% efficiency, guaranteeing <2% cells with multiple integrations (2).
2 Deep-sequencing based quantification of shrna representation. Assessment of library composition and changes in shrna representation over sort cycles was carried out as previously described (2). Deep-sequencing template libraries were generated by PCR amplifying shrna guide strands from vector libraries or genomic DNA isolated from at least 5 million cultured cells at each time point (>1000 fold library representation). All samples were sequenced using a custom primer reading reverse into the guide strand (mir30ecoriseq, TAGCCCCTTGAATTCCGAGGCAGTAGGCA). Individual lanes (each corresponding to 1 sample) yielded ~20-30 million reads (Illumina GA II). For each shrna and condition the number of completely matching sequences was determined, normalized to the total read number per lane and imported into a database for further analysis (Access 2007, Microsoft). As final readout of shrna potency a Sensor score was computed (Table S1). Small RNA library cloning and sequencing. Total RNA was purified, size selected, cloned and analyzed by deep-sequencing. In brief, 5-10x10 6 cells were homogenized in TRIzol (Invitrogen) followed by chloroform and phenol:chloroform:isoamyl alcohol (125:24:1, ph 4.5, Ambion) purification, precipitation in isopropanol and resuspension in RNase-free water. All samples were then DNase I (Roche) treated and again phenol:chloroform:isoamyl alcohol purified, precipitated in isopropanol and resuspended in RNase-free water. Approximately 5-10 g total RNA was run on a 12% urea polyacrylamide gel (SequaGel, National Diagnostics) to select mirna-sized small RNAs (18-28 nt) for cloning and sequencing. Mature small RNAs libraries were prepared using the TruSeq Small RNA kit (Illumina) according to manufacturer s recommendations, with index primers (Indices A, Illumina) used for pooling. PCR amplified small RNA libraries where purified on a 6% urea polyacrylamide gel (SequaGel, National Diagnostics) and analyzed by deep-sequencing (HiSeq, Illumina). Sequence reads containing the adaptor were clipped, collapsed and aligned to a reference library before normalization to the total number of reads per sample. The reference library contained guide and passenger
3 strands of all shrnas as well as the mouse mature mirna collection obtained from mirbase, release 19 (3). Statistical analysis. All quantifications of changes in gene expression (microarray data) were carried out using the statistical package R (version ). Differential expression analysis for any two conditions or sample groups was conducted as follows: 1) Raw data files were imported and normalized using the RMA method of the Affy (4) package. 2) The Limma (5) package was then used to define the contrast (comparison) of interest by defining replicates as well as groups. 3) We used an empirical Bayes test to find differentially expressed genes between two groups of interest after adjusting for multiple testing using Bonferroni correction. 4) An adjusted p-value of 0.05 was used as cut-off for all tests. To evaluate the presence of potential off-target effects, two basic hypotheses were tested: 1) There exist sequence-based off-target effects caused by homology of the shrna to non-target transcripts; and 2) There exist sequence-independent off-target effects caused due to general saturation of the microrna machinery. To test for sequence-based off-target effects, we took each shrna and did a differential expression analysis (as explained above) for that shrna compared to wild-type (uninfected Trp53 -/- MEFs and Trp53 -/- MEFs infected with an empty vector control). Next, by comparing the results across the various shrnas, we identified genes that are uniquely up- or downregulated for each shrna (Figure S3A). We found differentially expressed genes for 3 shrnas at high-copy; these genes were not deregulated in the same shrna at low copy. In contrast, to test for sequence-independent off-target effects, we defined two groups for the differential expression analysis: 1) Group 1 were all the shrnas at low copy taken as replicates; and 2) Group 2 contained wild-type samples taken as replicates. The same comparison was run with all the shrnas at high copy as Group 1. While we did not observe any deregulated genes at low copy compared to wild-type, thousands of genes were deregulated at high-copy compared to wild-type (Figure 3B and S3B). For evaluation of Sensor assay performance
4 (Figure 1 and S1), linear dependence of variables was evaluated using the Pearson productmoment correlation coefficient r. Rank correlations were evaluated using the Spearman rank correlation coefficient (rho). Constructs and lentiviral transduction. To generate sirna-resistant KRAS expression vectors, sirna-resistant HA-tagged human KRAS WT and KRAS G12V cdna sequences were first engineered by performing QuikChange Site-Directed Mutagenesis (Agilent Technologies) and then subcloned into the tetracycline-inducible lentiviral expression vector pinducer10 (6). All the PCR-cloned sequences were verified by DNA sequencing. Viruses were produced as previously described (7) Western blot analysis. Antibodies for western blot analysis are from the following sources: human KRAS (Sigma, WH M1; Santa Cruz Biotechnology, sc-30), ARAF (Santa Crus, sc-165 and sc-408), BRAF (Santa Cruz, sc-5284), RAF1 (BD Biosciences # and Santa Cruz sc-7267), MEK1 (EMD Millipore, Upstate ), MEK2 (Santa Cruz, sc-524), phospho-mek1&2 (Cell Signaling, #9101 and #9121), MEK1&2 (Cell Signaling, #8727), phospho-erk1&2 (Cell Signaling, #4377), ERK1&2, (Cell Signaling, #9102), p21 (BD Biosciences, ), BIM (Cell Signaling #2933), GAPDH (Santa Cruz, sc and sc ), Beta-actin (Sigma, clone AC-74), GFP (Santa Cruz, sc-8334), and DsRed (Clontech, ). Rescue of KRAS knockdown. To rescue KRAS sirna-mediated cell killing, SW1116 cells stably expressing a tetracycline-inducible, sirna-resistant HA-KRAS G12V or HA-KRAS WT cdna (Table S2) were pre-treated with or without doxycycline (Sigma, 100 ng/ml) for 60h. Cells were then transfected with KRAS Sensor sirnas in the presence or absence of doxycycline. To examine MAPK pathway rescue, total cell lysates were collected 48h post-transfection and subjected to immunoblotting. For cell viability rescue, cell viability was measured 120 h posttransfection. To assess potency of KRAS shrnas, SW1116-HA-KRAS G12V cells cultured in
5 presence of doxycycline (2 g/ml) were infected at ~30% efficiency with one of 3 KRAS shrnas or a control shrna. Successfully transduced cells were sorted (FACS), and knockdown was quantified by immunoblotting. Nanoparticle formulation and delivery. Cyclodextrin polymer-based nanoparticle excipients are comprised of polycationic cyclodextrin polymers and adamantane-bound PEG molecules for steric stability (Calando Pharmaceuticals). Particles self-assemble when polyanionic sirnas form electrostatic interactions with the polymers at a fixed charge ratio of 3:1 (cation:anion). Some PEG molecules are conjugated to transferrin, whose receptor is overexpressed in a broad range of cancers, for receptor-mediated endocytosis by tumor cells. Additionally, due to size constraints, these intravenously administered 70 nm particles extravasate to the sites of tumor growth through leaky tumor vessels but not normal vessels. Nanoparticle-siRNA treatments were formulated by mixing equal volumes of reconsitituted CALAA-01 excipients and 4 mg/ml sirna (in 10 mm phosphate buffer + 5% (w/v) glucose). Particles were allowed to assemble for 30 min at room temperature before administration into mice via tail vein injection. FACS isolation of transduced cell populations. Tumor tissue was minced into ~1 mm pieces, resuspended in RPMI supplanted with 200 U/mL collagenase type IV and 2.5 U/mL neutral dispase and rocked at 37 C. After 30 min, 100 U/mL DNaseI was added to the solution and rocked for an additional 30 min at 37 C. Cell suspensions were passed through a 70 m filter and cells were pelleted and washed 1X with RBC lysis buffer (150 mm NH 4 Cl, 10 mm KHCO 3, 0.1 mm EDTA). Cells were pelleted and resuspended in RPMI + 1% FBS for FACS sorting. Tumor lysates. Tumor tissue was flash frozen upon harvest and briefly thawed before homogenization with a PowerGen 500 homogenizer in lysis buffer (20 mm Tris ph 7.4, 150 mm NaCl, 1% NP-40, 1 mm EDTA, 1 mm EGTA, 10% glycerol, 50 mm NaF, 5 mm NaPPi, 1 mm
6 PMSF, 0.5 mm DTT, 200 mm Na 3 VO 4, Sigma protease and phosphatase inhibitor solutions). Homogenized lysate was cleared by centrifugation before analysis by SDS-PAGE. Immunohistochemistry and immunofluorescence. Formalin fixed, paraffin embedded tumor tissue was cut into 5 m sections and analyzed by immunohistochemistry and immunofluorescence. Briefly, sections were de-waxed, rehydrated and blocked according to standard IHC protocols. Sections were incubated overnight using the following primary antibodies: DsRed (Clontech, ); GFP (Santa Cruz, sc-5386); perk1/2 (Santa Cruz, sc- 4370), ps6 (Cell Signaling, cs-4858), cleaved caspase-3 (Cell Signaling, cs-9661); Ki67 (Thermo, RM9106-S0). For immunofluorescence, sections were incubated with fluorescently conjugated secondary antibodies (Molecular Probes, A11058, A21206) and counterstained with DAPI. For immunohistochemistry, sections were incubated with biotin-conjugated secondary antibodies (Vector, BA-1000) before incubation with RTU Horseradish Peroxidase Avidin (Vector) and colorization with DAB Substrate Chromogen System (Dako). Sections were counterstained with hemotoxylin. Quantification of Ki67 and CC3-positivity was performed using GIMP software v ViBE analysis of phospho-proteins. Cells at ~60% confluency were transfected with 5 nm of each sirna species using forward transfections and RNAiMAX transfection reagent (Invitrogen). Transfection conditions were optimized for each cell line. Cells were lysed in lysis buffer after 72 h and lysates were cleared by centrifugation. For phosphoprotein analysis, lysates were added in triplicate to 96-well plates. Fluorescein-conjugated antibody against pmek, perk, pakt or ps6 and a matched biotin-conjugated antibody against the same phospho-protein were then added to the well. The lysate-antibody solutions were agitated on a shaking platform to allow for formation of analyte-antibody sandwiches. Detection of analyte abundance was performed with the ViBE analyzer (Bioscale, Inc.) using acoustic membrane microparticle (AMMP) technology.
Chromatin Immunoprecipitation (ChIP)
Chromatin Immunoprecipitation (ChIP) Day 1 A) DNA shearing 1. Samples Dissect tissue (One Mouse OBs) of interest and transfer to an eppendorf containing 0.5 ml of dissecting media (on ice) or PBS but without
Protocol for Western Blotting
Protocol for Western Blotting Materials Materials used on Day 3 Protease inhibitor stock: 1 μg/μl pepstatin A in DMSO 200 μm leupeptin in OG Buffer 200 mm PMSF: Freshly made. Ex) 34.8 mg PMSF in 1 ml isopropanol
BUFFERS and MEDIAS Coomassie Blue Staining Solution Coomassie blue Destaining Solution DMEM Normal Cell Culture Media
BUFFERS and MEDIAS Coomassie Blue Staining Solution 2 g Coomassie Blue 2 L Methanol or Ethanol * 1.6 L 400 ml Glacial acetic acid *If you will be microwaving the gel in staining solution for rapid staining
Mir-X mirna First-Strand Synthesis Kit User Manual
User Manual Mir-X mirna First-Strand Synthesis Kit User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories, Inc.
Supplemental Information. McBrayer et al. Supplemental Data
1 Supplemental Information McBrayer et al. Supplemental Data 2 Figure S1. Glucose consumption rates of MM cell lines exceed that of normal PBMC. (A) Normal PBMC isolated from three healthy donors were
ACC (#3676), AMPK α1/2 (#2532), AMPKβ1/2 (#4150), Phospho-4E-BP1 Thr37/46. Cell Signaling. Ki-67 Clon MIB-1 from Dako. AntiBrdU (B2531), α Tubulin
Supplemental materials and methods Antibodies and reagents ACC (#3676), AMPK α1/2 (#2532), AMPKβ1/2 (#4150), Phospho-4E-BP1 Thr37/46 (#9459), pakt Ser473 (#4051), pampk Thr172 (#2535), pacc Ser79 (#3661),
HighPure Maxi Plasmid Kit
HighPure Maxi Plasmid Kit For purification of high pure plasmid DNA with high yields www.tiangen.com PP120109 HighPure Maxi Plasmid Kit Kit Contents Storage Cat.no. DP116 Contents RNaseA (100 mg/ml) Buffer
QUANTITATIVE RT-PCR. A = B (1+e) n. A=amplified products, B=input templates, n=cycle number, and e=amplification efficiency.
QUANTITATIVE RT-PCR Application: Quantitative RT-PCR is used to quantify mrna in both relative and absolute terms. It can be applied for the quantification of mrna expressed from endogenous genes, and
User Manual. CelluLyser Lysis and cdna Synthesis Kit. Version 1.4 Oct 2012 From cells to cdna in one tube
User Manual CelluLyser Lysis and cdna Synthesis Kit Version 1.4 Oct 2012 From cells to cdna in one tube CelluLyser Lysis and cdna Synthesis Kit Table of contents Introduction 4 Contents 5 Storage 5 Additionally
Application Guide... 2
Protocol for GenomePlex Whole Genome Amplification from Formalin-Fixed Parrafin-Embedded (FFPE) tissue Application Guide... 2 I. Description... 2 II. Product Components... 2 III. Materials to be Supplied
MEF Starter Nucleofector Kit
page 1 of 7 MEF Starter Nucleofector Kit for Mouse Embryonic Fibroblasts (MEF) MEF display significant phenotypic variations which depend on the strain, the genetic background of the mice they are isolated
First Strand cdna Synthesis
380PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 [email protected] A Geno Technology, Inc. (USA) brand name First Strand cdna Synthesis (Cat. # 786 812) think proteins! think G-Biosciences
Western Blot Analysis with Cell Samples Grown in Channel-µ-Slides
Western Blot Analysis with Cell Samples Grown in Channel-µ-Slides Polyacrylamide gel electrophoresis (PAGE) and subsequent analyses are common tools in biochemistry and molecular biology. This Application
Angelo Peschiaroli, N. Valerio Dorrello, Daniele Guardavaccaro, Monica Venere, Thanos Halazonetis, Nicholas E. Sherman, and Michele Pagano
Molecular Cell, Volume 23 Supplemental Data SCF βtrcp -Mediated Degradation of Claspin Regulates Recovery from the DNA Replication Checkpoint Response Angelo Peschiaroli, N. Valerio Dorrello, Daniele Guardavaccaro,
Hypoxyprobe -1 Plus Kit Kit contents:
Updated 2015 1 PRODUCT INSERT Hypoxyprobe, Inc 121 Middlesex Turnpike Burlington, MA 01803 USA www.hypoxyprobe.com Hypoxyprobe -1 Plus Kit Kit contents: Solid pimonidazole HCl (Hypoxyprobe -1) FITC conjugated
Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual
Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual F- 470S 20 cdna synthesis reactions (20 µl each) F- 470L 100 cdna synthesis reactions (20 µl each) Table of contents 1. Description...
Supplementary Figure 1.
Supplementary Figure 1. (A) MicroRNA 212 enhances IS from pancreatic β-cells. INS-1 832/3 β-cells were transfected with precursors for mirnas 212, 375, or negative control oligonucleotides. 48 hrs after
NimbleGen DNA Methylation Microarrays and Services
NimbleGen DNA Methylation Microarrays and Services Sample Preparation Instructions Outline This protocol describes the process for preparing samples for NimbleGen DNA Methylation microarrays using the
Description: Molecular Biology Services and DNA Sequencing
Description: Molecular Biology s and DNA Sequencing DNA Sequencing s Single Pass Sequencing Sequence data only, for plasmids or PCR products Plasmid DNA or PCR products Plasmid DNA: 20 100 ng/μl PCR Product:
Classic Immunoprecipitation
292PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 [email protected] A Geno Technology, Inc. (USA) brand name Classic Immunoprecipitation Utilizes Protein A/G Agarose for Antibody Binding (Cat.
GRS Plasmid Purification Kit Transfection Grade GK73.0002 (2 MaxiPreps)
1 GRS Plasmid Purification Kit Transfection Grade GK73.0002 (2 MaxiPreps) (FOR RESEARCH ONLY) Sample : Expected Yield : Endotoxin: Format : Operation Time : Elution Volume : 50-400 ml of cultured bacterial
In vitro analysis of pri-mirna processing. by Drosha-DGCR8 complex. (Narry Kim s lab)
In vitro analysis of pri-mirna processing by Drosha-DGCR8 complex (Narry Kim s lab) 1-1. Preparation of radiolabeled pri-mirna transcript The RNA substrate for a cropping reaction can be prepared by in
Anti-ATF6 α antibody, mouse monoclonal (1-7)
Anti-ATF6 α antibody, mouse monoclonal (1-7) 73-500 50 ug ATF6 (activating transcription factor 6) is an endoplasmic reticulum (ER) membrane-bound transcription factor activated in response to ER stress.
DNA Isolation Kit for Cells and Tissues
DNA Isolation Kit for Cells and Tissues for 10 isolations of 00 mg each for tissue or 5 x 10 7 cultured cells Cat. No. 11 81 770 001 Principle Starting material Application Time required Results Benefits
2.1.2 Characterization of antiviral effect of cytokine expression on HBV replication in transduced mouse hepatocytes line
i 1 INTRODUCTION 1.1 Human Hepatitis B virus (HBV) 1 1.1.1 Pathogenesis of Hepatitis B 1 1.1.2 Genome organization of HBV 3 1.1.3 Structure of HBV virion 5 1.1.4 HBV life cycle 5 1.1.5 Experimental models
Protein extraction from Tissues and Cultured Cells using Bioruptor Standard & Plus
Protein extraction from Tissues and Cultured Cells using Bioruptor Standard & Plus Introduction Protein extraction from tissues and cultured cells is the first step for many biochemical and analytical
MEF Nucleofector Kit 1 and 2
page 1 of 7 MEF Nucleofector Kit 1 and 2 for Mouse Embryonic Fibroblasts (MEF) MEF display significant phenotypic variations which depend on the strain, the genetic background of the they are isolated
PCR was carried out in a reaction volume of 20 µl using the ABI AmpliTaq GOLD kit (ABI,
Supplemental Text/Tables PCR Amplification and Sequencing PCR was carried out in a reaction volume of 20 µl using the ABI AmpliTaq GOLD kit (ABI, Foster City, CA). Each PCR reaction contained 20 ng genomic
How To Make A Tri Reagent
TRI Reagent For processing tissues, cells cultured in monolayer or cell pellets Catalog Number T9424 Store at room temperature. TECHNICAL BULLETIN Product Description TRI Reagent is a quick and convenient
pcas-guide System Validation in Genome Editing
pcas-guide System Validation in Genome Editing Tagging HSP60 with HA tag genome editing The latest tool in genome editing CRISPR/Cas9 allows for specific genome disruption and replacement in a flexible
Investigating the role of a Cryptosporidium parum apyrase in infection
Investigating the role of a Cryptosporidium parum apyrase in infection David Riccardi and Patricio Manque Abstract This project attempted to characterize the function of a Cryptosporidium parvum apyrase
Pure-IP Western Blot Detection Kit
Product Manual Pure-IP Western Blot Detection Kit Catalog Number PRB-5002 20 blots FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction The technique of immunoprecipitation (IP) is used
Laboratory Techniques I Oncology for Scientists I
Laboratory Techniques I Oncology for Scientists I September 9 th, 2015 Hayley Affronti, PhD Student [email protected] Dr. Sheila Figel too! When we first hit the lab there are so many things
MystiCq microrna cdna Synthesis Mix Catalog Number MIRRT Storage Temperature 20 C
microrna cdna Synthesis Mix Catalog Number MIRRT Storage Temperature 20 C Product Description The microrna cdna Synthesis Mix has been designed to easily convert micrornas into cdna templates for qpcr
TECHNICAL BULLETIN. HIS-Select Nickel Affinity Gel. Catalog Number P6611 Storage Temperature 2 8 C
HIS-Select Nickel Affinity Gel Catalog Number P6611 Storage Temperature 2 8 C TECHNICAL BULLETIN Product Description HIS-Select Nickel Affinity Gel is an immobilized metalion affinity chromatography (IMAC)
HiPerFect Transfection Reagent Handbook
Fifth Edition October 2010 HiPerFect Transfection Reagent Handbook For transfection of eukaryotic cells with sirna and mirna Sample & Assay Technologies QIAGEN Sample and Assay Technologies QIAGEN is the
SmartFlare RNA Detection Probes: Principles, protocols and troubleshooting
Technical Guide SmartFlare RNA Detection Probes: Principles, protocols and troubleshooting Principles of SmartFlare technology RNA detection traditionally requires transfection, laborious sample prep,
The RNAi Consortium (TRC) Broad Institute
TRC Laboratory Protocols Protocol Title: One Step PCR Preparation of Samples for Illumina Sequencing Current Revision Date: 11/10/2012 RNAi Platform,, [email protected] Brief Description: This
CHRISTIAN LAB WESTERN BLOT PROTOCOL
CHRISTIAN LAB WESTERN BLOT PROTOCOL There is actually 2 parts to a western blot: A. SDS-PAGE: Separates protein by size. Smaller proteins migrate faster through the gel than larger proteins. Size separation
sirna Duplexes & RNAi Explorer
P r o d u c t S p e c i f i c a t i o n s Guaranteed RNAi Explorer kit with Fl/Dabcyl Molecular Beacon Catalog No.:27-6402-01 Guaranteed RNAi Explorer kit with Fluorescein/Tamra TaqMan Catalog No.:27-6402-01
Instructions. Torpedo sirna. Material. Important Guidelines. Specifications. Quality Control
is a is a state of the art transfection reagent, specifically designed for the transfer of sirna and mirna into a variety of eukaryotic cell types. is a state of the art transfection reagent, specifically
Western Blot Protocol (updated on 05/20/14)
Western Blot Protocol (updated on 05/20/14) Required Solutions 10x PBS (1L) 80 g NaCl 2 g KCl 14.4 g Na 2 HPO 4 or 22 g Na 2 HPO 4 7H 2 O 2.4 g KH 2 PO 4 or 2 g KH 2 PO4 Adjust ph to 7.4 Autoclave PBST
hydrocortisone (5 mg/ml), EGF (10 µg/ml) and Heparin (5000 U/ml). Antibodies against the N-terminal peptide of MEK1 (MEK1-N) and against Flotillin 1
SUPPLEMENTARY METHODS Cells HUVEC (Human Umbilical Vein Endothelial Cells) were grown in complete Medium 199 (Gibco) supplemented with glutamax, 10% foetal calf serum, BBE (9 mg/ml), hydrocortisone (5
Transfection-Transfer of non-viral genetic material into eukaryotic cells. Infection/ Transduction- Transfer of viral genetic material into cells.
Transfection Key words: Transient transfection, Stable transfection, transfection methods, vector, plasmid, origin of replication, reporter gene/ protein, cloning site, promoter and enhancer, signal peptide,
Chromatin Immunoprecipitation
Chromatin Immunoprecipitation A) Prepare a yeast culture (see the Galactose Induction Protocol for details). 1) Start a small culture (e.g. 2 ml) in YEPD or selective media from a single colony. 2) Spin
TaqMan Fast Advanced Master Mix. Protocol
TaqMan Fast Advanced Master Mix Protocol For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in this document is subject to change without notice. APPLIED
Supporting Information
Supporting Information Kondo et al. 1.173/pnas.787415 SI Methods Conventional and Quantitative RT-PCR. Total RNA was extracted from cultured ES cells or ES-derived cells using the RNeasy Minikit (Qiagen).
FOR REFERENCE PURPOSES
BIOO LIFE SCIENCE PRODUCTS FOR REFERENCE PURPOSES This manual is for Reference Purposes Only. DO NOT use this protocol to run your assays. Periodically, optimizations and revisions are made to the kit
RT-PCR: Two-Step Protocol
RT-PCR: Two-Step Protocol We will provide both one-step and two-step protocols for RT-PCR. We recommend the twostep protocol for this class. In the one-step protocol, the components of RT and PCR are mixed
RevertAid Premium First Strand cdna Synthesis Kit
RevertAid Premium First Strand cdna Synthesis Kit #K1651, #K1652 CERTIFICATE OF ANALYSIS #K1651 Lot QUALITY CONTROL RT-PCR using 100 fg of control GAPDH RNA and GAPDH control primers generated a prominent
RNA Extraction and Quantification, Reverse Transcription, and Real-time PCR (q-pcr)
RNA Extraction and Quantification, Reverse Transcription, and Real-time Preparation of Samples Cells: o Remove media and wash cells 2X with cold PBS. (2 ml for 6 well plate or 3 ml for 6cm plate) Keep
The cell lines used in this study were obtained from the American Type Culture
Supplementary materials and methods Cell culture and drug treatments The cell lines used in this study were obtained from the American Type Culture Collection (ATCC) and grown as previously described.
Genomic DNA Clean & Concentrator Catalog Nos. D4010 & D4011
Page 0 INSTRUCTION MANUAL Catalog Nos. D4010 & D4011 Highlights Quick (5 minute) spin column recovery of large-sized DNA (e.g., genomic, mitochondrial, plasmid (BAC/PAC), viral, phage, (wga)dna, etc.)
Chapter 2 Antibodies. Contents. Introduction
Chapter 2 Antibodies Keywords Immunohistochemistry Antibody labeling Fluorescence microscopy Fluorescent immunocytochemistry Fluorescent immunohistochemistry Indirect immunocytochemistry Immunostaining
Mir-X mirna First-Strand Synthesis and SYBR qrt-pcr
User Manual Mir-X mirna First-Strand Synthesis and SYBR qrt-pcr User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories,
Especially developed for the transfection of mammalian cells with sirna or mirna
METAFECTENE SI Especially developed for the transfection of mammalian cells with sirna or mirna For ordering information, MSDS, publications and application notes see www.biontex.com Description Cat. No.
GASTRIC ORGANOID CULTURE PROTOCOL
GASTRIC ORGANOID CULTURE PROTOCOL THIS PROTOCOL PROVIDES THE PROCEDURE FOR SUBCULTURING NORMAL HUMAN GASTRIC ORGANOIDS WHICH WAS DERIVED FROM THE SUBMERGED METHOD AS DESCRIBED IN BARKER N, ET AL. LGR5+VE
OriGene Technologies, Inc. MicroRNA analysis: Detection, Perturbation, and Target Validation
OriGene Technologies, Inc. MicroRNA analysis: Detection, Perturbation, and Target Validation -Optimal strategies to a successful mirna research project Optimal strategies to a successful mirna research
NCL Method ITA-6. Leukocyte Proliferation Assay
NCL Method ITA-6 Leukocyte Proliferation Assay Nanotechnology Characterization Laboratory National Cancer Institute-Frederick SAIC-Frederick Frederick, MD 21702 (301) 846-6939 [email protected] December
岑 祥 股 份 有 限 公 司 技 術 專 員 費 軫 尹 20100803
技 術 專 員 費 軫 尹 20100803 Overview of presentation Basic Biology of RNA interference Application of sirna for gene function? How to study mirna? How to deliver sirna and mirna? New prospects on RNAi research
Real-time quantitative RT -PCR (Taqman)
Real-time quantitative RT -PCR (Taqman) Author: SC, Patti Lab, 3/03 This is performed as a 2-step reaction: 1. cdna synthesis from DNase 1-treated total RNA 2. PCR 1. cdna synthesis (Advantage RT-for-PCR
Running protein gels and detection of proteins
Running protein gels and detection of proteins 1. Protein concentration determination using the BIO RAD reagent This assay uses a colour change reaction to give a direct measurement of protein concentration.
Biological Stability and Activity of sirna in Ionic Liquids**
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Supporting Information Biological Stability and Activity of sirna in Ionic Liquids** Romiza R.
Notch 1 -dependent regulation of cell fate in colorectal cancer
Notch 1 -dependent regulation of cell fate in colorectal cancer Referees: PD Dr. Tobias Dick Prof. Dr. Wilfried Roth http://d-nb.info/1057851272 CONTENTS Summary 1 Zusammenfassung 2 1 INTRODUCTION 3 1.1
Amaxa 4D-Nucleofector Protocol for Mouse Embryonic Stem [ES] Cells For 4D-Nucleofector X Unit Transfection in suspension
For 4D-Nucleofector X Unit Transfection in suspension Cells derived from mouse blastocysts; round cells, growing in clumps s 1. This protocol is meant to provide an outline for the handling and the Nucleofection
Principles of Immunohistochemistry Queen s Laboratory For Molecular Pathology
Principles of Immunohistochemistry Queen s Laboratory For Molecular Pathology Table of Contents POLYCLONAL VERSUS MONOCLONAL ANTIBODIES...PAGE 3 DIRECT & INDIRECT ASSAYS.PAGE 4 LABELS..PAGE 5 DETECTION...PAGE
FastLine cell cdna Kit
1. FastLine cell cdna Kit For high-speed preparation of first-strand cdna directly from cultured cells without RNA purification www.tiangen.com RT100701 FastLine cell cdna Kit Cat. no. KR105 Kit Contents
Global MicroRNA Amplification Kit
Global MicroRNA Amplification Kit Store kit at -20 C on receipt (ver. 3-060901) A limited-use label license covers this product. By use of this product, you accept the terms and conditions outlined in
The F Box Protein Fbx6 Regulates Chk1 Stability and Cellular Sensitivity to Replication Stress
Molecular Cell, Volume 35 Supplemental Data The F Box Protein Fbx6 Regulates Chk1 Stability and Cellular Sensitivity to Replication Stress You-Wei Zhang, John Brognard, Chris Coughlin, Zhongsheng You,
Bacterial Transformation and Plasmid Purification. Chapter 5: Background
Bacterial Transformation and Plasmid Purification Chapter 5: Background History of Transformation and Plasmids Bacterial methods of DNA transfer Transformation: when bacteria take up DNA from their environment
Outline. 1. Experiment. 2. Sample analysis and storage. 3. Image analysis and presenting data. 4. Probemaker
Tips and tricks Note: this is just an informative document with general recommendations. Please contact [email protected] should you have any queries. Document last reviewed 2011-11-17 Outline 1. Experiment
ab185916 Hi-Fi cdna Synthesis Kit
ab185916 Hi-Fi cdna Synthesis Kit Instructions for Use For cdna synthesis from various RNA samples This product is for research use only and is not intended for diagnostic use. Version 1 Last Updated 1
Amaxa Mouse T Cell Nucleofector Kit
Amaxa Mouse T Cell Nucleofector Kit For T cells isolated from C57BL/6 & BALB/c mice Evaluated for murine T cells isolated from C57BL/6 & BALB/c mice This protocol is designed for murine lymphocytes or
Mouse ES Cell Nucleofector Kit
page 1 of 7 Mouse ES Cell Nucleofector Kit for Mouse Embryonic Stem Cells Cell type Origin Cells derived from mouse blastocysts. Morphology Round cells growing in clumps. Important remarks! 1. This protocol
WESTERN BLOTTING TIPS AND TROUBLESHOOTING GUIDE TROUBLESHOOTING GUIDE
WESTERN BLOTTING TIPS AND TROUBLESHOOTING GUIDE TIPS FOR SUCCESSFUL WESTERB BLOTS TROUBLESHOOTING GUIDE 1. Suboptimal protein transfer. This is the most common complaint with western blotting and could
Genolution Pharmaceuticals, Inc. Life Science and Molecular Diagnostic Products
Genolution Pharmaceuticals, Inc. Revolution through genes, And Solution through genes. Life Science and Molecular Diagnostic Products www.genolution1.com TEL; 02-3010-8670, 8672 Geno-Serum Hepatitis B
Fluorescein Isothiocyanate (FITC)- conjugated Antibodies
USER GUIDE Fluorescein Isothiocyanate (FITC)- conjugated Antibodies Catalog Numbers R933-25, R953-25, R963-25 Document Part Number 25-0376 Publication Number MAN0000194 Revision 2.0 For Research Use Only.
PreciseTM Whitepaper
Precise TM Whitepaper Introduction LIMITATIONS OF EXISTING RNA-SEQ METHODS Correctly designed gene expression studies require large numbers of samples, accurate results and low analysis costs. Analysis
User Manual/Hand book. qpcr mirna Arrays ABM catalog # MA003 (human) and MA004 (mouse)
User Manual/Hand book qpcr mirna Arrays ABM catalog # MA003 (human) and MA004 (mouse) Kit Components Cat. No. MA003...Human Whole Genome mirna qpcr Profiling Kit (-20 C) The following components are sufficient
PROTOCOL. Immunocytochemistry (ICC) MATERIALS AND EQUIPMENT REQUIRED
PROTOCOL Immunocytochemistry (ICC) 1850 Millrace Drive, Suite 3A Eugene, Oregon 97403 11-07 MATERIALS AND EQUIPMENT REQUIRED Materials: MitoSciences primary monoclonal antibody/antibodies Fluorophore-conjugated
TRI Reagent Solution. A. Product Description. RNA / DNA / Protein Isolation Reagent Part Number AM9738 100 ml
TRI Reagent Solution RNA / DNA / Protein Isolation Reagent Part Number AM9738 100 ml A. Product Description TRI Reagent * solution is a complete and ready-to-use reagent for the isolation of total RNA
AffinityScript QPCR cdna Synthesis Kit
AffinityScript QPCR cdna Synthesis Kit INSTRUCTION MANUAL Catalog #600559 Revision C.01 For In Vitro Use Only 600559-12 LIMITED PRODUCT WARRANTY This warranty limits our liability to replacement of this
Relative Quantification of mirna Target mrnas by Real-Time qpcr. 1 Introduction. Gene Expression Application Note No. 4
Gene Expression Application Note No. 4 Relative Quantification of mirna Target mrnas by Real-Time qpcr Ute Ernst, Jitao David Zhang, Anja Irsigler, Stefan Wiemann, Ulrich Tschulena Division: Molecular
PNA BRAF Mutation Detection Kit
- PNA BRAF Mutation Detection Kit Catalog Number KA2102 50 tests/kit Version: 01 Intended for research use only www.abnova.com Introduction and Background Intended use The PNA BRAF Mutation Detection Kit
How To Get A Cell Print
QUICK CELL CAPTURE AND CHARACTERIZATION GUIDE FOR CELLSEARCH CUSTOMERS CellSave EDTA Blood sample Rare cell capture Enumeration Single protein marker Cell capture for molecular characterization CELLSEARCH
APPLICATION FOCUS. Application Solutions for Western Blotting
APPLICATION FOCUS Application Solutions for Western Blotting WESTERN BLOTTING Companion Products Solutions for consistently better blotting. Companion products from Cell Signaling Technology (CST) are
Thermo Scientific Dharmacon sirna Libraries
Thermo Scientific Dharmacon sirna Libraries Scientific innovation in sirna potency, specificity and delivery Superior sirna in comprehensive collections for reliable screens Market leading products for
Manual for: sirna-trans Maximo Reagent
Manual for: sirna-trans Maximo Reagent Contact: [email protected]; www.geneon.net GeneON GmbH Germany GeneON GmbH / Protocol sirna-trans reagent vs. 1.3 / www.geneon.net / - 0 - sirna-trans reagent Instruction
DP419 RNAsimple Total RNA Kit. RNAprep pure Series. DP501 mircute mirna Isolation Kit. DP438 MagGene Viral DNA / RNA Kit. DP405 TRNzol Reagent
Overview of TIANGEN Products DP419 RNAsimple Total RNA Kit DP430 RNAprep pure Kit(For Cell/Bacteria) DP315/DP315-R TIANamp Virus DNA/RNA Kit DP431 RNAprep pure Kit (For Tissue) Silica-membrane Technology
Anti-V5 Antibody Anti-V5-HRP Antibody
Anti-V5 Antibody Anti-V5-HRP Antibody Catalog nos. R960-25, R961-25 Version F 073001 28-0140 www.invitrogen.com [email protected] ii Table of Contents Table of Contents...iii Overview...1 Western
TransIT -2020 Transfection Reagent
Quick Reference Protocol, MSDS and Certificate of Analysis available at mirusbio.com/5400 INTRODUCTION TransIT -2020 Transfection Reagent is a high-performance, animal-origin free, broad spectrum reagent
Transfection reagent for visualizing lipofection with DNA. For ordering information, MSDS, publications and application notes see www.biontex.
METAFECTENE FluoR Transfection reagent for visualizing lipofection with DNA For ordering information, MSDS, publications and application notes see www.biontex.com Description Cat. No. Size METAFECTENE
Approaches that can be used to study expression of specific proteins
Approaches that can be used to study expression of specific proteins Receptors and transporters Homogenate binding studies Receptor autoradiography Radiochemical Western blotting Immunohistochemistry/cytochemistry
RPCI 004 v.002 Staining Procedure For all Directly Conjugated Reagents (Whole Blood Method)
Immune Tolerance Network RPCI 004 v.002 Staining Procedure For all Directly Conjugated Reagents (Whole Blood Method) Author: Paul Wallace, Director, RPCI Laboratory of Flow Cytometry Approved by: Paul
Introduction To Real Time Quantitative PCR (qpcr)
Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors
Optimal Conditions for F(ab ) 2 Antibody Fragment Production from Mouse IgG2a
Optimal Conditions for F(ab ) 2 Antibody Fragment Production from Mouse IgG2a Ryan S. Stowers, 1 Jacqueline A. Callihan, 2 James D. Bryers 2 1 Department of Bioengineering, Clemson University, Clemson,
Proto col. GoClone Repor ter Construc ts: Sample Protocol for Adherent Cells. Tech support: 877-994-8240. Luciferase Assay System
Luciferase Assay System Proto col GoClone Repor ter Construc ts: Sample Protocol for Adherent Cells LightSwitch Luciferase Assay System GoClone Reporter Assay Workflow Step 1: Seed cells in plate format.
50 g 650 L. *Average yields will vary depending upon a number of factors including type of phage, growth conditions used and developmental stage.
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: [email protected] Phage DNA Isolation Kit Product # 46800, 46850 Product Insert
U.S. Patent No. 9,051,563 and other pending patents. Ver. 1.1.3
INSTRUCTION MANUAL Direct-zol RNA MiniPrep Catalog Nos. R050, R05, R05, & R053 Highlights Quick, spin column purification of high-quality (DNA-free) total RNA directly from TRIzol, TRI Reagent and other
