TOOLS sirna and mirna. User guide

Transcription

1 TOOLS sirna and mirna User guide

2 Introduction RNA interference (RNAi) is a powerful tool for suppression gene expression by causing the destruction of specific mrna molecules. Small Interfering RNAs (sirnas) are short, double-stranded RNA molecules that bind specific messenger RNA (mrna) molecules and decrease their activities by preventing an mrna from producing a protein. TOOLS sirna oligos undergo vigorous process monitoring and strict quality control, produce under ISO9000 quality standard system. Chemical Modified sirna exhibits greater longevity in cell culture and stability in cell culture and in serum, enhancing the ability for this to be used for in vivo applications and has much more extensional effective time than Standard sirna. TOOLS in vitro/vivo mirna mimics inhibitors are chemically-modified and optimized nucleic acids designed to specifically target the microrna (mirna) molecules in animals. Endogenous micrornas are small, regulatory RNAs that are expressed in animals and plants that affect the translation of target mrnas. The mature nucleotide, single-stranded mirnas specifically target a protein complex to regulate translation at the level of mrna. Specifications Products (1 OD) sirna mirna mimics mirna inhibitor nmol Molecular weight ~13300 ~13300 ~6500 weight 33 ug 33 ug 33 ug Concentration 20 um (20 pmol/ul) 20 um (20 pmol/ul) 20 um (20 pmol/ul) (when adding 125 ul H 2O) (when adding 125 ul H 2O) (when adding 250 ul H 2O) 1

3 Ordering information sirna In vitro sirna or chemically-modified sirna In vivo sirna or chemically-modified sirna Negative Control sirna FAM Negative Control sirna Positive Control sirna sirna set (Guaranteed >70% knock-down in mrna level) 3 x 1OD target sirna 1 x 0.5OD negative control sirna 1 x 0.5OD FAM labeled negative control sirna 1 x 0.5OD positive control sirna Chemically-modified sirna set(guaranteed >70% knock-down in mrna level) 3 x 1OD Chemically-modified target sirna 1 x 0.5OD negative control sirna 1 x 0.5OD FAM labeled negative control sirna 1 x 0.5OD positive control sirna 2OD/4OD/8OD 1OD 1OD 1OD mirna mimics & inhibitors In vitro mirna mimics In vitro mirna mimics negative control In vitro chemically-modified mirna inhibitor In vitro chemically-modified mirna inhibitor negative control In vivo chemically-modified mirna mimics In vivo chemically-modified mirna inhibitor In vivo mirna mimics & inhibitor negative control 2OD/4OD 2OD 2OD/4OD 2OD 2

4 sirna transfection guide: Cell Culture Before Transfection It is advised that before starting your transfection experiment, put your cells on your cell plate, then add proper culture medium, lastly incubate cells for 24 hrs to be 70%-90% by confluence. Transfection reagent: TOOLSoothFect transfection reagent (Cat.No. NFT-KA00) Culture vessel Surface Area (mm 2 /well) Cell Density Volume of plating Medium(ul/well) 96-well x x ul 48-well x x ul 24-well x x ul 12-well x x ml 6-well x x ml 35 mm x x ml 60 mm x x ml Culture vessel sirna Volume of plating Transfection reagent mediun (ul/well) 96-well 5 pmol 100ul 0.25 ul 24-well 20 pmol 500ul 1 ul 12-well 40 pmol 1ml 2 ul 6-well 100 pmol 2ml 5 ul 35 mm 100 pmol 2ml 5 ul 60 mm 600 pmol 5ml 10 ul mirna mimics or inhibitor transfection guide: mirna Culture Dish Transfection reagent (mimics or inhibitor) Cell density (cells/well) Final volume (per well) 96-well ul 3 pmol ml 24-well ul 15 pmol ml 12-well 1-3 ul 30 pmol ml 6-well 2-5 ul 75 pmol ml 3

5 In vivo sirna delivery guide: Delivery route (dissolve in vivo sirna in PBS or RNase free water or OptiMEM) Intravenous Intraperitoneal Intracranial Systemic delivery dosage: nmol/g body weight Mice (body weight 15-20g): 3-4 nmol (40-50ug) Rat (body weight g): nmol ( ug) A sirna dose of 5mg/kg/day is recommended as a starting point for experiments. In vivo mirna (mimics or inhibitor) delivery guide: Delivery route (dissolve in vivo mirna in PBS or normal saline:) Intravenous Intraperitoneal Intracranial 5-80ug/g body weight or 200nmol(3 times) Local delivery: 1-10nmol(0.5-4OD), volume: 30ul~100ul; TOOLS mirna modification example: hsa-mir-137 agomirs sense : 5' UUAUUGCUUAAGAAUACGCGUAG 3' antisense: 5' AsCsGCGUAUUCUUAAGCAAUAsAsUsUs-Chol- 3' Storage Store TOOLS sirna or mirna at 20 C 4

6 sirna or mirna FAQs : What is the best method of delivering sirnas into the cell? There are several methods that are used for delivering sirnas into cells including lipid-based transfection, electroporation, calcium phosphate co-precipitation, microinjection and vector delivery techniques. The choice between these methods is often a result of several factors including the ability of the cells to tolerate the delivery method, susceptibility to viral infection, and the growth properties of the cells. Although lipid-based transfection is one of the more commonly used methods for adherent cells, suspension cells are often more difficult to transfect and generally have higher rates of delivery with electroporation techniques. Is there a quick method for monitoring transfection efficiency? TOOLS has developed several options including a family of fluorescent-labeled sirnas and a novel RNA-based reagent known as sirna transfection Control. The uptake of sirnas can be visualized with the appropriate filters on a confocal microscope or by flow cytometry. Alternatively, fluorescent-labeled sirna is cytotoxic when successfully delivered into cells. Cells that have efficiently taken up this transfection control typically undergo apoptosis within 24 to 48 hours. This phenotypic outcome can easily be monitored using standard cell viability methods (e.g., alamarblue, MTT cytotoxicity, Trypan Blue dye exclusion, JC1 dye, or other appropriate assays). What is the best time-frame for monitoring sirna-dependent decreases in target mrna expression levels? In target protein levels? Generally, target mrna levels are decreased after 24 hours post-transfection following transfection of a gene-specific sirna duplex. However, maximal silencing may be reached at a later time point, so it is advisable to assay target mrna in a time-course study. In most cases, silencing will be maximal at 24 to 48 hours following transfection. Cellular target protein levels should be examined starting at 24 hours and assayed until a minimum level is noted, often 48 to 96 hours or greater. As always, it is important to verify transfection efficiency using an appropriate positive control. If there is no decrease in protein levels within this time frame, it may be necessary to perform a second sirna transfection, use a stabilized sirna, or develop a vector-based silencing cassette that can continuously produce the sirna for extended periods of time. 5