STUDY GUIDE UNIT 3 GENETICS (SB2) Cell Size Limitations 1. Why do cells divide?

Transcription

1 INTERPHASE STUDY GUIDE UNIT 3 GENETICS (SB2) Cell Size Limitations 1. Why do cells divide? Name: Date: Block: 2. How often do cells divide? Chromosome Structure 1. What is a chromosome? (i.e. what is it s structure, what does it contain within it, how is it formed???) 3. Draw and label a doubled chromosome. Be sure to label it. 2. What is meant by the term homologous chromosomes? a. When are homologues seen in Mitosis/Meiosis? The Cell Cycle 1. What is the cell cycle? 2. What type of cells are made during the cell cycle? 3. What is the advantage of the cell cycle? 4. Draw, label and describe EACH Stage of the cell cycle (including the subdivisions within Interphase) Stage/Phase G1 Description Drawing (Be sure to include labels of key components such as chromosomes, centromeres, spindle fibers, centrioles, chromatids, nuclear envelope, etc.) S G2

2 CYTOKINESIS TELOPHASE ANAPHASE METAPHASE PROPHASE

3 PROPHASE I Control of the Cell Cycle 1. WHAT controls the cell cycle? (name them and be sure you know what KIND OF MACROMOLECULE they are) 2. What is contact inhibition? a. Compare and contrast normal and abnormal cells with respect to contact inhibition. 3. What is cancer? a. What are the main types of cancer and what parts of the body do the effect? Type of Cancer Part of Body Effected Meiosis 4. What is Meiosis? 5. What type of cells are made during Meiosis? 6. What is the advantage of Meiosis? 7. Compare and contrast Meiosis in males vs. in females. 8. Draw, label & describe EACH Stage of Meiosis I (including the subdivisions in Interphase) Stage/Phase Description 1. What important event occurs during Prophase I? Drawing (Be sure to include labels of key components such as chromosomes, centromeres, spindle fibers, centrioles, chromatids, nuclear envelope, etc.) a. Describe the process 2. What does this important event contribute to the offspring?

4 PROPHASE II TELOPHASE I and CYTOKINESIS ANAPHASE I METAPHASE I 9. After Meiosis I what do you have? (i.e. how many & what kinds (diploid/haploid) of cells do you have?) 10. Draw, label and describe EACH Stage of Meiosis II (including the subdivisions within Interphase) Stage/Phase Description Drawing (Be sure to include labels of key components such as chromosomes, centromeres, spindle fibers, centrioles, chromatids, nuclear envelope, etc.)

5 TELOPHASE II and CYTOKINESIS ANAPHASE II METAPHASE II 11. After Meiosis II what do you have? (i.e. how many and what kinds diploid or haploid of cells do you have?) INHERITANCE 1. Define the following: Dominant Allele Trait Phenotype Genotype Recessive

6 Homozygous Heterozygous Polygenic inheritance Codominance Incomplete dominance Multiple Alleles Sex-Linked Trait Autosomal Monohybrid Dihybrid Be able to complete and interpret a punnett square for the following types of traits o o o Simple Mendelian Inheritance Incomplete Dominance Codominance o o Multiple Alleles Sex-linked traits SAMPLE PROBLEMS: 1.. R = Round r = flat G = Green g = yellow KEY: F = Freckles present f = no freckles present Use the information in the key below to write the PHENOTYPE for each GENOTYPE given Rr = GG = rr = Gg = Use the information in the key below to write the possible GENOTYPES for each PHENOTYPE given Freckles = Homozygous Round = Yellow = Heterozygous for Freckles =

7 2. MENDELIAN (COMPLETE DOMINANCE) INHERITANCE EXAMPLE PROBLEM In humans, free earlobes are dominant over attached earlobes. a. Create a key for your cross in the space provided below KEY: b. Show a cross between a male who is heterozygous for free earlobes with a female who has attached ear lobes. In the punnett square below: c. What are the phenotypes and genotypes of the offspring? d. In what percentage would EACH genotype and phenotype occur? 3. INCOMPLETE DOMINANCE EXAMPLE PROBLEM In a type of snapdragon flower, red and yellow petal colors are incompletely dominant to one another. They will blend in the HETEROZYGOUS organism to produce orange. Use R to represent the petal color alleles. a. Create a key for your cross in the space provided below KEY: b. Show a cross between a red snapdragon and an orange snapdragon in the punnett square below: c. What are the phenotypes and genotypes of the offspring? d. In what percentage would EACH genotype and phenotype occur? 4. CODOMINANCE EXAMPLE PROBLEM In a breed of rabbits, brown and white coat colors are codominant. BOTH brown and white fur will appear as spots in the HETEROZYGOUS organism, producing a rabbit with brown and white spots. a. Create a key for your cross in the space provided below KEY: b. Show a cross between a brown rabbit and a rabbit that is spotted (brown and white) in the punnett square below: c. What are the phenotypes and genotypes of the offspring? d. In what percentage would EACH genotype and phenotype occur?

8 5. MULTIPLE ALLELE EXAMPLE PROBLEM a. What are the two genotypes possible for a person who as type A blood? OR b. What genotype does a person with type AB blood have? c. What genotype does a person with type O blood have? d. What are the two genotypes possible for a person who as type B blood? OR e. A man with type AB blood is married to a woman with heterozygous type B blood. What blood types will their children have AND in what percentages? 6. SEX-LINKED TRAIT EXAMPLE PROBLEM For this scenario, let s assume that eye color is a SEX-LINKED trait and that blue eyes are recessive to green eyes (Use a the letter G to represent eye color and be sure you account for the father being MALE and the mother being FEMALE) a. Create a key for your cross in the space provided below KEY: b. Show a cross between a green eyed father and a blue eyed mother in the punnett square below: c. What are the phenotypes and genotypes of the offspring? d. In what percentage would EACH genotype and phenotype occur? 7. DIHYBRID CROSS EXAMPLE PROBLEM For this scenario, let s assume that Purple flowers were dominant over white flowers and green pods were dominant over yellow pods.

9 GENETIC MATERIAL 1. SIMILARITIES & DIFFERENCES BETWEEN DNA & RNA Complete the table below by using check marks to indicate to which molecule each characteristic applies DNA RNA Deoxyribonucleic acid Ribonucleic acid Ribose sugar present Deoxyribose sugar present Phosphate group present Adenine nucleotide Thymine nucleotide Uracil nucleotide present Guanine nucleotide Cytosine nucleotide Formed from nucleotides Double stranded Single stranded Remains in the nucleus Moves out of the nucleus Contains multiple types 2. Name the three main of RNA and describe their function: Type of RNA Function 3. Using the information above; complete the VenDiagram below comparing and contrasting DNA & RNA. On your test you will be asked to either complete a VenDiagram or write an essay comparing and contrasting them. 4. What are the three parts of a nucleotide? a. _P g (color brown below) b. _S (color purple below) c. _N b According to the above list color-code AND LABEL each of the three parts on the nucleotide picture to the below (see above for colors).

10 5. In DNA a. pairs with AND pairs with 6. In RNA a. pairs with AND pairs with DNA REPLICATION 1. What is the PURPOSE of DNA Replication? 2. When does DNA Replication occur? 3. Describe what is meant by semiconservative replication a. How did you witness it with your twizzler models? 4. Fill in the table below with the general enzymes involved in DNA Replication (in order) and their functions: Step # Enzyme Function(s) Complete the bow-tie below comparing and contrasting the Leading and Lagging strand in DNA Replication (HINT: Complete it much like you would a VenDiagram)

11 6. What is the end result of DNA Replication? GENE REGULATION 1. Define the following: exon intron start codon (AUG) stop codon (UAA,UAG, or UGA) PROTEIN SYNTHESIS 1. What is the PURPOSE of Protein Synthesis? When does Protein Synthesis occur? 2. Describe how protein synthesis leads to an organism having a specific trait? 3. Using the table below; describe the two steps of Protein synthesis answering the questions as you go Step # 1. Description of Process Location of Process If you were given the following DNA strands; complete the protein synthesis of each (use your genetic code dictionary & table that you were given it should be filed in your notebook) DNA strand #1 strand sequence TACGGAGTGCAGTCGAGGGCTGGCATT

12 DNA strand #2 TACATGCCCGGTTTAGCTATGGTAACT strand sequence 5. When comparing different organisms, you can see that they all have the same bases in DNA (A, T, G, and C) what accounts for the differences between the organisms? MUTATIONS 1. What is a Mutation? 2. Describe the four main types of mutations using the table below: Type of Mutation Cause(s) Example Insertion Trisomy Deletion Spontaneous KARYOTYPING 1. What is a karyotype? a. What is a karyotype USED FOR? b. What phase of Mitosis are chromosomes taken from for a karyotype?

13 2. When creating a karyotype, HOW are chromosomes ordered (i.e. discuss the size, numbers, and banding and how each contributes to the formation of the karyotype)? 3. What is the format for writing a karyotype analysis? 4. How can you determine if you have a male or a female karyotype? 5. What are some genetic conditions that can be seen in a karyotype? HOW can you identify them in a karyotype? 6. Write the karyotype analysis for each of the karyotypes below be sure do NAME the abnormality if it is a common one. KARYOTYPE #1 KARYOTYPE #2 KARYOTYPE #3 Karyotype Analysis: Diagnosis: Karyotype Analysis: Diagnosis: Karyotype Analysis: Diagnosis: GENETIC DISORDERS Also be sure you know the following disorders, their characteristics (symptoms) and HOW they are inherited: Achondroplasia Albinism Alzheimer s disease Colorblindness Cystic fibrosis Down Syndrome Edward s Syndrome Hemophilia Huntington s disease Klinefelter s Syndrome Phenylketonuria (PKU) Sickle-cell disease Tay-Sachs disease Turner Syndrome PEDIGREES Also be sure you know how to draw and INTERPRET a pedigree.

14 BIOTECHNOLOGY Also be sure you know the following concepts: CLONING: What is a clone? What is embryo twinning? What is somatic cell nuclear transfer? o How are the two alike and different? What are the steps (in order) for performing a somatic cell nuclear transfer clone experiment? What are the significance of using a somatic cell donor? A egg cell donor? Surrogate mother? Which one (somatic cell donor? A egg cell donor? Surrogate mother?) will the clone offspring resemble? o To what extent will he/she resemble the other cell? What are some medical reasons for cloning? What is the history behind cloning? o What was the first cloned fully grown animal? When was it cloned? What method was used to clone it? What is the link between clones and twins? (Be able to compare and contrast) Explain how a clone is not a carbon copy of the original organism. o Will the clone have the same hair color? Eye color? Behavior? DNA? Blood type? Bone marrow? What are some risks associated with cloning? Be able to write a well developed ethical commentary on a specific scenario related to cloning. GEL ELECTROPHORESIS: What is Gel Electrophoresis? What are the steps to performing a gel electrophoresis experiment? How are Gel Electrophoresis and DNA Fingerprinting connected? What is the significance of agarose? Describe it consistency as well. What is the significance of ethidium bromide? Describe how the DNA strands move with respect to the charges applied. Describe how the DNA strands move with respect to their individual sizes. Be able to label a gel with the positive and negative charges and draw arrows showing the migration direction of the DNA strands. DNA FINGERPRINTING: What is a DNA fingerprint? What are restriction enzymes? How are the essential to DNA fingerprinting? How do the bands result in a DNA fingerprint? o Which bands (size-wise) will be at the top (closest to the wells)? o Which bands (size-wise) will be at the bottom (farthest form the wells)? Given a DNA Fingerprint, be able to estimate the length of base pairs in a DNA sample (given a DNA standard in an adjacent well) Given a DNA Fingerprint, be able to ascertain the guilty suspect in a criminal investigation.