STUDY GUIDE UNIT 3 GENETICS (SB2) Cell Size Limitations 1. Why do cells divide?
|
|
- Shannon Curtis
- 7 years ago
- Views:
Transcription
1 INTERPHASE STUDY GUIDE UNIT 3 GENETICS (SB2) Cell Size Limitations 1. Why do cells divide? Name: Date: Block: 2. How often do cells divide? Chromosome Structure 1. What is a chromosome? (i.e. what is it s structure, what does it contain within it, how is it formed???) 3. Draw and label a doubled chromosome. Be sure to label it. 2. What is meant by the term homologous chromosomes? a. When are homologues seen in Mitosis/Meiosis? The Cell Cycle 1. What is the cell cycle? 2. What type of cells are made during the cell cycle? 3. What is the advantage of the cell cycle? 4. Draw, label and describe EACH Stage of the cell cycle (including the subdivisions within Interphase) Stage/Phase G1 Description Drawing (Be sure to include labels of key components such as chromosomes, centromeres, spindle fibers, centrioles, chromatids, nuclear envelope, etc.) S G2
2 CYTOKINESIS TELOPHASE ANAPHASE METAPHASE PROPHASE
3 PROPHASE I Control of the Cell Cycle 1. WHAT controls the cell cycle? (name them and be sure you know what KIND OF MACROMOLECULE they are) 2. What is contact inhibition? a. Compare and contrast normal and abnormal cells with respect to contact inhibition. 3. What is cancer? a. What are the main types of cancer and what parts of the body do the effect? Type of Cancer Part of Body Effected Meiosis 4. What is Meiosis? 5. What type of cells are made during Meiosis? 6. What is the advantage of Meiosis? 7. Compare and contrast Meiosis in males vs. in females. 8. Draw, label & describe EACH Stage of Meiosis I (including the subdivisions in Interphase) Stage/Phase Description 1. What important event occurs during Prophase I? Drawing (Be sure to include labels of key components such as chromosomes, centromeres, spindle fibers, centrioles, chromatids, nuclear envelope, etc.) a. Describe the process 2. What does this important event contribute to the offspring?
4 PROPHASE II TELOPHASE I and CYTOKINESIS ANAPHASE I METAPHASE I 9. After Meiosis I what do you have? (i.e. how many & what kinds (diploid/haploid) of cells do you have?) 10. Draw, label and describe EACH Stage of Meiosis II (including the subdivisions within Interphase) Stage/Phase Description Drawing (Be sure to include labels of key components such as chromosomes, centromeres, spindle fibers, centrioles, chromatids, nuclear envelope, etc.)
5 TELOPHASE II and CYTOKINESIS ANAPHASE II METAPHASE II 11. After Meiosis II what do you have? (i.e. how many and what kinds diploid or haploid of cells do you have?) INHERITANCE 1. Define the following: Dominant Allele Trait Phenotype Genotype Recessive
6 Homozygous Heterozygous Polygenic inheritance Codominance Incomplete dominance Multiple Alleles Sex-Linked Trait Autosomal Monohybrid Dihybrid Be able to complete and interpret a punnett square for the following types of traits o o o Simple Mendelian Inheritance Incomplete Dominance Codominance o o Multiple Alleles Sex-linked traits SAMPLE PROBLEMS: 1.. R = Round r = flat G = Green g = yellow KEY: F = Freckles present f = no freckles present Use the information in the key below to write the PHENOTYPE for each GENOTYPE given Rr = GG = rr = Gg = Use the information in the key below to write the possible GENOTYPES for each PHENOTYPE given Freckles = Homozygous Round = Yellow = Heterozygous for Freckles =
7 2. MENDELIAN (COMPLETE DOMINANCE) INHERITANCE EXAMPLE PROBLEM In humans, free earlobes are dominant over attached earlobes. a. Create a key for your cross in the space provided below KEY: b. Show a cross between a male who is heterozygous for free earlobes with a female who has attached ear lobes. In the punnett square below: c. What are the phenotypes and genotypes of the offspring? d. In what percentage would EACH genotype and phenotype occur? 3. INCOMPLETE DOMINANCE EXAMPLE PROBLEM In a type of snapdragon flower, red and yellow petal colors are incompletely dominant to one another. They will blend in the HETEROZYGOUS organism to produce orange. Use R to represent the petal color alleles. a. Create a key for your cross in the space provided below KEY: b. Show a cross between a red snapdragon and an orange snapdragon in the punnett square below: c. What are the phenotypes and genotypes of the offspring? d. In what percentage would EACH genotype and phenotype occur? 4. CODOMINANCE EXAMPLE PROBLEM In a breed of rabbits, brown and white coat colors are codominant. BOTH brown and white fur will appear as spots in the HETEROZYGOUS organism, producing a rabbit with brown and white spots. a. Create a key for your cross in the space provided below KEY: b. Show a cross between a brown rabbit and a rabbit that is spotted (brown and white) in the punnett square below: c. What are the phenotypes and genotypes of the offspring? d. In what percentage would EACH genotype and phenotype occur?
8 5. MULTIPLE ALLELE EXAMPLE PROBLEM a. What are the two genotypes possible for a person who as type A blood? OR b. What genotype does a person with type AB blood have? c. What genotype does a person with type O blood have? d. What are the two genotypes possible for a person who as type B blood? OR e. A man with type AB blood is married to a woman with heterozygous type B blood. What blood types will their children have AND in what percentages? 6. SEX-LINKED TRAIT EXAMPLE PROBLEM For this scenario, let s assume that eye color is a SEX-LINKED trait and that blue eyes are recessive to green eyes (Use a the letter G to represent eye color and be sure you account for the father being MALE and the mother being FEMALE) a. Create a key for your cross in the space provided below KEY: b. Show a cross between a green eyed father and a blue eyed mother in the punnett square below: c. What are the phenotypes and genotypes of the offspring? d. In what percentage would EACH genotype and phenotype occur? 7. DIHYBRID CROSS EXAMPLE PROBLEM For this scenario, let s assume that Purple flowers were dominant over white flowers and green pods were dominant over yellow pods.
9 GENETIC MATERIAL 1. SIMILARITIES & DIFFERENCES BETWEEN DNA & RNA Complete the table below by using check marks to indicate to which molecule each characteristic applies DNA RNA Deoxyribonucleic acid Ribonucleic acid Ribose sugar present Deoxyribose sugar present Phosphate group present Adenine nucleotide Thymine nucleotide Uracil nucleotide present Guanine nucleotide Cytosine nucleotide Formed from nucleotides Double stranded Single stranded Remains in the nucleus Moves out of the nucleus Contains multiple types 2. Name the three main of RNA and describe their function: Type of RNA Function 3. Using the information above; complete the VenDiagram below comparing and contrasting DNA & RNA. On your test you will be asked to either complete a VenDiagram or write an essay comparing and contrasting them. 4. What are the three parts of a nucleotide? a. _P g (color brown below) b. _S (color purple below) c. _N b According to the above list color-code AND LABEL each of the three parts on the nucleotide picture to the below (see above for colors).
10 5. In DNA a. pairs with AND pairs with 6. In RNA a. pairs with AND pairs with DNA REPLICATION 1. What is the PURPOSE of DNA Replication? 2. When does DNA Replication occur? 3. Describe what is meant by semiconservative replication a. How did you witness it with your twizzler models? 4. Fill in the table below with the general enzymes involved in DNA Replication (in order) and their functions: Step # Enzyme Function(s) Complete the bow-tie below comparing and contrasting the Leading and Lagging strand in DNA Replication (HINT: Complete it much like you would a VenDiagram)
11 6. What is the end result of DNA Replication? GENE REGULATION 1. Define the following: exon intron start codon (AUG) stop codon (UAA,UAG, or UGA) PROTEIN SYNTHESIS 1. What is the PURPOSE of Protein Synthesis? When does Protein Synthesis occur? 2. Describe how protein synthesis leads to an organism having a specific trait? 3. Using the table below; describe the two steps of Protein synthesis answering the questions as you go Step # 1. Description of Process Location of Process If you were given the following DNA strands; complete the protein synthesis of each (use your genetic code dictionary & table that you were given it should be filed in your notebook) DNA strand #1 strand sequence TACGGAGTGCAGTCGAGGGCTGGCATT
12 DNA strand #2 TACATGCCCGGTTTAGCTATGGTAACT strand sequence 5. When comparing different organisms, you can see that they all have the same bases in DNA (A, T, G, and C) what accounts for the differences between the organisms? MUTATIONS 1. What is a Mutation? 2. Describe the four main types of mutations using the table below: Type of Mutation Cause(s) Example Insertion Trisomy Deletion Spontaneous KARYOTYPING 1. What is a karyotype? a. What is a karyotype USED FOR? b. What phase of Mitosis are chromosomes taken from for a karyotype?
13 2. When creating a karyotype, HOW are chromosomes ordered (i.e. discuss the size, numbers, and banding and how each contributes to the formation of the karyotype)? 3. What is the format for writing a karyotype analysis? 4. How can you determine if you have a male or a female karyotype? 5. What are some genetic conditions that can be seen in a karyotype? HOW can you identify them in a karyotype? 6. Write the karyotype analysis for each of the karyotypes below be sure do NAME the abnormality if it is a common one. KARYOTYPE #1 KARYOTYPE #2 KARYOTYPE #3 Karyotype Analysis: Diagnosis: Karyotype Analysis: Diagnosis: Karyotype Analysis: Diagnosis: GENETIC DISORDERS Also be sure you know the following disorders, their characteristics (symptoms) and HOW they are inherited: Achondroplasia Albinism Alzheimer s disease Colorblindness Cystic fibrosis Down Syndrome Edward s Syndrome Hemophilia Huntington s disease Klinefelter s Syndrome Phenylketonuria (PKU) Sickle-cell disease Tay-Sachs disease Turner Syndrome PEDIGREES Also be sure you know how to draw and INTERPRET a pedigree.
14 BIOTECHNOLOGY Also be sure you know the following concepts: CLONING: What is a clone? What is embryo twinning? What is somatic cell nuclear transfer? o How are the two alike and different? What are the steps (in order) for performing a somatic cell nuclear transfer clone experiment? What are the significance of using a somatic cell donor? A egg cell donor? Surrogate mother? Which one (somatic cell donor? A egg cell donor? Surrogate mother?) will the clone offspring resemble? o To what extent will he/she resemble the other cell? What are some medical reasons for cloning? What is the history behind cloning? o What was the first cloned fully grown animal? When was it cloned? What method was used to clone it? What is the link between clones and twins? (Be able to compare and contrast) Explain how a clone is not a carbon copy of the original organism. o Will the clone have the same hair color? Eye color? Behavior? DNA? Blood type? Bone marrow? What are some risks associated with cloning? Be able to write a well developed ethical commentary on a specific scenario related to cloning. GEL ELECTROPHORESIS: What is Gel Electrophoresis? What are the steps to performing a gel electrophoresis experiment? How are Gel Electrophoresis and DNA Fingerprinting connected? What is the significance of agarose? Describe it consistency as well. What is the significance of ethidium bromide? Describe how the DNA strands move with respect to the charges applied. Describe how the DNA strands move with respect to their individual sizes. Be able to label a gel with the positive and negative charges and draw arrows showing the migration direction of the DNA strands. DNA FINGERPRINTING: What is a DNA fingerprint? What are restriction enzymes? How are the essential to DNA fingerprinting? How do the bands result in a DNA fingerprint? o Which bands (size-wise) will be at the top (closest to the wells)? o Which bands (size-wise) will be at the bottom (farthest form the wells)? Given a DNA Fingerprint, be able to estimate the length of base pairs in a DNA sample (given a DNA standard in an adjacent well) Given a DNA Fingerprint, be able to ascertain the guilty suspect in a criminal investigation.
Biology Final Exam Study Guide: Semester 2
Biology Final Exam Study Guide: Semester 2 Questions 1. Scientific method: What does each of these entail? Investigation and Experimentation Problem Hypothesis Methods Results/Data Discussion/Conclusion
More informationBio EOC Topics for Cell Reproduction: Bio EOC Questions for Cell Reproduction:
Bio EOC Topics for Cell Reproduction: Asexual vs. sexual reproduction Mitosis steps, diagrams, purpose o Interphase, Prophase, Metaphase, Anaphase, Telophase, Cytokinesis Meiosis steps, diagrams, purpose
More informationBiology 1406 Exam 4 Notes Cell Division and Genetics Ch. 8, 9
Biology 1406 Exam 4 Notes Cell Division and Genetics Ch. 8, 9 Ch. 8 Cell Division Cells divide to produce new cells must pass genetic information to new cells - What process of DNA allows this? Two types
More informationBioSci 2200 General Genetics Problem Set 1 Answer Key Introduction and Mitosis/ Meiosis
BioSci 2200 General Genetics Problem Set 1 Answer Key Introduction and Mitosis/ Meiosis Introduction - Fields of Genetics To answer the following question, review the three traditional subdivisions of
More informationHeredity - Patterns of Inheritance
Heredity - Patterns of Inheritance Genes and Alleles A. Genes 1. A sequence of nucleotides that codes for a special functional product a. Transfer RNA b. Enzyme c. Structural protein d. Pigments 2. Genes
More informationGenetics Module B, Anchor 3
Genetics Module B, Anchor 3 Key Concepts: - An individual s characteristics are determines by factors that are passed from one parental generation to the next. - During gamete formation, the alleles for
More informationBioBoot Camp Genetics
BioBoot Camp Genetics BIO.B.1.2.1 Describe how the process of DNA replication results in the transmission and/or conservation of genetic information DNA Replication is the process of DNA being copied before
More informationHeredity. Sarah crosses a homozygous white flower and a homozygous purple flower. The cross results in all purple flowers.
Heredity 1. Sarah is doing an experiment on pea plants. She is studying the color of the pea plants. Sarah has noticed that many pea plants have purple flowers and many have white flowers. Sarah crosses
More informationGenetics Test Biology I
Genetics Test Biology I Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Avery s experiments showed that bacteria are transformed by a. RNA. c. proteins.
More information12.1 The Role of DNA in Heredity
12.1 The Role of DNA in Heredity Only in the last 50 years have scientists understood the role of DNA in heredity. That understanding began with the discovery of DNA s structure. In 1952, Rosalind Franklin
More informationTest Two Study Guide
Test Two Study Guide 1. Describe what is happening inside a cell during the following phases (pictures may help but try to use words): Interphase: : Consists of G1 / S / G2. Growing stage, cell doubles
More informationCCR Biology - Chapter 7 Practice Test - Summer 2012
Name: Class: Date: CCR Biology - Chapter 7 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. A person who has a disorder caused
More informationHuman Blood Types: Codominance and Multiple Alleles. Codominance: both alleles in the heterozygous genotype express themselves fully
Human Blood Types: Codominance and Multiple Alleles Codominance: both alleles in the heterozygous genotype express themselves fully Multiple alleles: three or more alleles for a trait are found in the
More informationBiology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA
Page 1 of 5 Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA Genetics Exercise: Understanding how meiosis affects genetic inheritance and DNA patterns
More informationThe correct answer is c A. Answer a is incorrect. The white-eye gene must be recessive since heterozygous females have red eyes.
1. Why is the white-eye phenotype always observed in males carrying the white-eye allele? a. Because the trait is dominant b. Because the trait is recessive c. Because the allele is located on the X chromosome
More informationCell Growth and Reproduction Module B, Anchor 1
Cell Growth and Reproduction Module B, Anchor 1 Key Concepts: - The larger a cell becomes, the more demands the cell places on its DNA. In addition, a larger cell is less efficient in moving nutrients
More informationGENETIC CROSSES. Monohybrid Crosses
GENETIC CROSSES Monohybrid Crosses Objectives Explain the difference between genotype and phenotype Explain the difference between homozygous and heterozygous Explain how probability is used to predict
More information5. The cells of a multicellular organism, other than gametes and the germ cells from which it develops, are known as
1. True or false? The chi square statistical test is used to determine how well the observed genetic data agree with the expectations derived from a hypothesis. True 2. True or false? Chromosomes in prokaryotic
More informationChapter 13: Meiosis and Sexual Life Cycles
Name Period Chapter 13: Meiosis and Sexual Life Cycles Concept 13.1 Offspring acquire genes from parents by inheriting chromosomes 1. Let s begin with a review of several terms that you may already know.
More informationName: Class: Date: ID: A
Name: Class: _ Date: _ Meiosis Quiz 1. (1 point) A kidney cell is an example of which type of cell? a. sex cell b. germ cell c. somatic cell d. haploid cell 2. (1 point) How many chromosomes are in a human
More informationwww.njctl.org PSI Biology Mitosis & Meiosis
Mitosis and Meiosis Mitosis Classwork 1. Identify two differences between meiosis and mitosis. 2. Provide an example of a type of cell in the human body that would undergo mitosis. 3. Does cell division
More informationChapter 13: Meiosis and Sexual Life Cycles
Name Period Concept 13.1 Offspring acquire genes from parents by inheriting chromosomes 1. Let s begin with a review of several terms that you may already know. Define: gene locus gamete male gamete female
More informationCHROMOSOMES AND INHERITANCE
SECTION 12-1 REVIEW CHROMOSOMES AND INHERITANCE VOCABULARY REVIEW Distinguish between the terms in each of the following pairs of terms. 1. sex chromosome, autosome 2. germ-cell mutation, somatic-cell
More informationAppendix C DNA Replication & Mitosis
K.Muma Bio 6 Appendix C DNA Replication & Mitosis Study Objectives: Appendix C: DNA replication and Mitosis 1. Describe the structure of DNA and where it is found. 2. Explain complimentary base pairing:
More informationName: 4. A typical phenotypic ratio for a dihybrid cross is a) 9:1 b) 3:4 c) 9:3:3:1 d) 1:2:1:2:1 e) 6:3:3:6
Name: Multiple-choice section Choose the answer which best completes each of the following statements or answers the following questions and so make your tutor happy! 1. Which of the following conclusions
More informationGenetics Part 1: Inheritance of Traits
Genetics Part 1: Inheritance of Traits Genetics is the study of how traits are passed from parents to offspring. Offspring usually show some traits of each parent. For a long time, scientists did not understand
More informationMendelian and Non-Mendelian Heredity Grade Ten
Ohio Standards Connection: Life Sciences Benchmark C Explain the genetic mechanisms and molecular basis of inheritance. Indicator 6 Explain that a unit of hereditary information is called a gene, and genes
More informationsomatic cell egg genotype gamete polar body phenotype homologous chromosome trait dominant autosome genetics recessive
CHAPTER 6 MEIOSIS AND MENDEL Vocabulary Practice somatic cell egg genotype gamete polar body phenotype homologous chromosome trait dominant autosome genetics recessive CHAPTER 6 Meiosis and Mendel sex
More informationGenetic Mutations. Indicator 4.8: Compare the consequences of mutations in body cells with those in gametes.
Genetic Mutations Indicator 4.8: Compare the consequences of mutations in body cells with those in gametes. Agenda Warm UP: What is a mutation? Body cell? Gamete? Notes on Mutations Karyotype Web Activity
More informationA trait is a variation of a particular character (e.g. color, height). Traits are passed from parents to offspring through genes.
1 Biology Chapter 10 Study Guide Trait A trait is a variation of a particular character (e.g. color, height). Traits are passed from parents to offspring through genes. Genes Genes are located on chromosomes
More information1. When new cells are formed through the process of mitosis, the number of chromosomes in the new cells
Cell Growth and Reproduction 1. When new cells are formed through the process of mitosis, the number of chromosomes in the new cells A. is half of that of the parent cell. B. remains the same as in the
More informationList, describe, diagram, and identify the stages of meiosis.
Meiosis and Sexual Life Cycles In this topic we will examine a second type of cell division used by eukaryotic cells: meiosis. In addition, we will see how the 2 types of eukaryotic cell division, mitosis
More informationName Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in
DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results
More information4.2 Meiosis. Meiosis is a reduction division. Assessment statements. The process of meiosis
4.2 Meiosis Assessment statements State that meiosis is a reduction division of a diploid nucleus to form haploid nuclei. Define homologous chromosomes. Outline the process of meiosis, including pairing
More informationChapter 9 Patterns of Inheritance
Bio 100 Patterns of Inheritance 1 Chapter 9 Patterns of Inheritance Modern genetics began with Gregor Mendel s quantitative experiments with pea plants History of Heredity Blending theory of heredity -
More informationMCAS Biology. Review Packet
MCAS Biology Review Packet 1 Name Class Date 1. Define organic. THE CHEMISTRY OF LIFE 2. All living things are made up of 6 essential elements: SPONCH. Name the six elements of life. S N P C O H 3. Elements
More informationMeiosis is a special form of cell division.
Page 1 of 6 KEY CONCEPT Meiosis is a special form of cell division. BEFORE, you learned Mitosis produces two genetically identical cells In sexual reproduction, offspring inherit traits from both parents
More informationCell Division CELL DIVISION. Mitosis. Designation of Number of Chromosomes. Homologous Chromosomes. Meiosis
Cell Division CELL DIVISION Anatomy and Physiology Text and Laboratory Workbook, Stephen G. Davenport, Copyright 2006, All Rights Reserved, no part of this publication can be used for any commercial purpose.
More informationCHROMOSOME STRUCTURE CHROMOSOME NUMBERS
CHROMOSOME STRUCTURE 1. During nuclear division, the DNA (as chromatin) in a Eukaryotic cell's nucleus is coiled into very tight compact structures called chromosomes. These are rod-shaped structures made
More informationBio 101 Section 001: Practice Questions for First Exam
Do the Practice Exam under exam conditions. Time yourself! MULTIPLE CHOICE: 1. The substrate fits in the of an enzyme: (A) allosteric site (B) active site (C) reaction groove (D) Golgi body (E) inhibitor
More informationProblems 1-6: In tomato fruit, red flesh color is dominant over yellow flesh color, Use R for the Red allele and r for the yellow allele.
Genetics Problems Name ANSWER KEY Problems 1-6: In tomato fruit, red flesh color is dominant over yellow flesh color, Use R for the Red allele and r for the yellow allele. 1. What would be the genotype
More informationLAB 8 EUKARYOTIC CELL DIVISION: MITOSIS AND MEIOSIS
LAB 8 EUKARYOTIC CELL DIVISION: MITOSIS AND MEIOSIS Los Angeles Mission College Biology 3 Name: Date: INTRODUCTION BINARY FISSION: Prokaryotic cells (bacteria) reproduce asexually by binary fission. Bacterial
More informationMitosis, Meiosis and Fertilization 1
Mitosis, Meiosis and Fertilization 1 I. Introduction When you fall and scrape the skin off your hands or knees, how does your body make new skin cells to replace the skin cells that were scraped off? How
More informationDNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!
DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other
More informationDNA Determines Your Appearance!
DNA Determines Your Appearance! Summary DNA contains all the information needed to build your body. Did you know that your DNA determines things such as your eye color, hair color, height, and even the
More informationTerms: The following terms are presented in this lesson (shown in bold italics and on PowerPoint Slides 2 and 3):
Unit B: Understanding Animal Reproduction Lesson 4: Understanding Genetics Student Learning Objectives: Instruction in this lesson should result in students achieving the following objectives: 1. Explain
More informationMendelian inheritance and the
Mendelian inheritance and the most common genetic diseases Cornelia Schubert, MD, University of Goettingen, Dept. Human Genetics EUPRIM-Net course Genetics, Immunology and Breeding Mangement German Primate
More informationLAB : PAPER PET GENETICS. male (hat) female (hair bow) Skin color green or orange Eyes round or square Nose triangle or oval Teeth pointed or square
Period Date LAB : PAPER PET GENETICS 1. Given the list of characteristics below, you will create an imaginary pet and then breed it to review the concepts of genetics. Your pet will have the following
More informationAnswer: 2. Uracil. Answer: 2. hydrogen bonds. Adenine, Cytosine and Guanine are found in both RNA and DNA.
Answer: 2. Uracil Adenine, Cytosine and Guanine are found in both RNA and DNA. Thymine is found only in DNA; Uracil takes its (Thymine) place in RNA molecules. Answer: 2. hydrogen bonds The complementary
More informationFrom DNA to Protein
Nucleus Control center of the cell contains the genetic library encoded in the sequences of nucleotides in molecules of DNA code for the amino acid sequences of all proteins determines which specific proteins
More information1 Mutation and Genetic Change
CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds
More informationName Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.
13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both
More informationB2 5 Inheritrance Genetic Crosses
B2 5 Inheritrance Genetic Crosses 65 minutes 65 marks Page of 55 Q. A woman gives birth to triplets. Two of the triplets are boys and the third is a girl. The triplets developed from two egg cells released
More informationSample Questions for Exam 3
Sample Questions for Exam 3 1. All of the following occur during prometaphase of mitosis in animal cells except a. the centrioles move toward opposite poles. b. the nucleolus can no longer be seen. c.
More information7A The Origin of Modern Genetics
Life Science Chapter 7 Genetics of Organisms 7A The Origin of Modern Genetics Genetics the study of inheritance (the study of how traits are inherited through the interactions of alleles) Heredity: the
More informationProtein Synthesis. Page 41 Page 44 Page 47 Page 42 Page 45 Page 48 Page 43 Page 46 Page 49. Page 41. DNA RNA Protein. Vocabulary
Protein Synthesis Vocabulary Transcription Translation Translocation Chromosomal mutation Deoxyribonucleic acid Frame shift mutation Gene expression Mutation Point mutation Page 41 Page 41 Page 44 Page
More informationDNA. Discovery of the DNA double helix
DNA Replication DNA Discovery of the DNA double helix A. 1950 s B. Rosalind Franklin - X-ray photo of DNA. C. Watson and Crick - described the DNA molecule from Franklin s X-ray. What is DNA? Question:
More informationLecture 2: Mitosis and meiosis
Lecture 2: Mitosis and meiosis 1. Chromosomes 2. Diploid life cycle 3. Cell cycle 4. Mitosis 5. Meiosis 6. Parallel behavior of genes and chromosomes Basic morphology of chromosomes telomere short arm
More informationBasic Concepts Recombinant DNA Use with Chapter 13, Section 13.2
Name Date lass Master 19 Basic oncepts Recombinant DN Use with hapter, Section.2 Formation of Recombinant DN ut leavage Splicing opyright lencoe/mcraw-hill, a division of he Mcraw-Hill ompanies, Inc. Bacterial
More informationCell Division Mitosis and the Cell Cycle
Cell Division Mitosis and the Cell Cycle A Chromosome and Sister Chromatids Key Points About Chromosome Structure A chromosome consists of DNA that is wrapped around proteins (histones) and condensed Each
More informationLecture 7 Mitosis & Meiosis
Lecture 7 Mitosis & Meiosis Cell Division Essential for body growth and tissue repair Interphase G 1 phase Primary cell growth phase S phase DNA replication G 2 phase Microtubule synthesis Mitosis Nuclear
More informationSexual Reproduction. The specialized cells that are required for sexual reproduction are known as. And come from the process of: GAMETES
Sexual Reproduction Sexual Reproduction We know all about asexual reproduction 1. Only one parent required. 2. Offspring are identical to parents. 3. The cells that produce the offspring are not usually
More informationChapter 3. Chapter Outline. Chapter Outline 9/11/10. Heredity and Evolu4on
Chapter 3 Heredity and Evolu4on Chapter Outline The Cell DNA Structure and Function Cell Division: Mitosis and Meiosis The Genetic Principles Discovered by Mendel Mendelian Inheritance in Humans Misconceptions
More information1. Why is mitosis alone insufficient for the life cycle of sexually reproducing eukaryotes?
Chapter 13: Meiosis and Sexual Life Cycles 1. Why is mitosis alone insufficient for the life cycle of sexually reproducing eukaryotes? 2. Define: gamete zygote meiosis homologous chromosomes diploid haploid
More informationThymine = orange Adenine = dark green Guanine = purple Cytosine = yellow Uracil = brown
1 DNA Coloring - Transcription & Translation Transcription RNA, Ribonucleic Acid is very similar to DNA. RNA normally exists as a single strand (and not the double stranded double helix of DNA). It contains
More information2 18. If a boy s father has haemophilia and his mother has one gene for haemophilia. What is the chance that the boy will inherit the disease? 1. 0% 2
1 GENETICS 1. Mendel is considered to be lucky to discover the laws of inheritance because 1. He meticulously analyzed his data statistically 2. He maintained pedigree records of various generations he
More informationAcademic Nucleic Acids and Protein Synthesis Test
Academic Nucleic Acids and Protein Synthesis Test Multiple Choice Identify the letter of the choice that best completes the statement or answers the question. 1. Each organism has a unique combination
More informationSaffiyah Y. Manboard Biology Instructor Seagull Alternative High School Saffiyah.manboard@browardschools.com
The Effect of Discovery Learning through Biotechnology on the Knowledge and Perception of Sickle Cell Anemia and It s Genetics on Lower Income Students Saffiyah Y. Manboard Biology Instructor Seagull Alternative
More informationDNA, RNA, Protein synthesis, and Mutations. Chapters 12-13.3
DNA, RNA, Protein synthesis, and Mutations Chapters 12-13.3 1A)Identify the components of DNA and explain its role in heredity. DNA s Role in heredity: Contains the genetic information of a cell that can
More informationGenetics 1. Defective enzyme that does not make melanin. Very pale skin and hair color (albino)
Genetics 1 We all know that children tend to resemble their parents. Parents and their children tend to have similar appearance because children inherit genes from their parents and these genes influence
More informationGenetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )
Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins
More informationThis fact sheet describes how genes affect our health when they follow a well understood pattern of genetic inheritance known as autosomal recessive.
11111 This fact sheet describes how genes affect our health when they follow a well understood pattern of genetic inheritance known as autosomal recessive. In summary Genes contain the instructions for
More informationBio 102 Practice Problems Genetic Code and Mutation
Bio 102 Practice Problems Genetic Code and Mutation Multiple choice: Unless otherwise directed, circle the one best answer: 1. Beadle and Tatum mutagenized Neurospora to find strains that required arginine
More informationGenetic Technology. Name: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question.
Name: Class: Date: Genetic Technology Multiple Choice Identify the choice that best completes the statement or answers the question. 1. An application of using DNA technology to help environmental scientists
More informationChromosomes, Mapping, and the Meiosis Inheritance Connection
Chromosomes, Mapping, and the Meiosis Inheritance Connection Carl Correns 1900 Chapter 13 First suggests central role for chromosomes Rediscovery of Mendel s work Walter Sutton 1902 Chromosomal theory
More informationThe Somatic Cell Cycle
The Somatic Cell Cycle Maternal chromosome Diploid Zygote Diploid Zygote Paternal chromosome MITOSIS MITOSIS Maternal chromosome Diploid organism Diploid organism Paternal chromosome Int terpha ase The
More informationChapter 3. Cell Division. Laboratory Activities Activity 3.1: Mock Mitosis Activity 3.2: Mitosis in Onion Cells Activity 3.
Chapter 3 Cell Division Laboratory Activities Activity 3.1: Mock Mitosis Activity 3.2: Mitosis in Onion Cells Activity 3.3: Mock Meiosis Goals Following this exercise students should be able to Recognize
More informationMCB41: Second Midterm Spring 2009
MCB41: Second Midterm Spring 2009 Before you start, print your name and student identification number (S.I.D) at the top of each page. There are 7 pages including this page. You will have 50 minutes for
More informationChapter 12: The Cell Cycle
Name Period Chapter 12: The Cell Cycle Overview: 1. What are the three key roles of cell division? State each role, and give an example. Key Role Example 2. What is meant by the cell cycle? Concept 12.1
More informationPhenotypes and Genotypes of Single Crosses
GENETICS PROBLEM PACKET- Gifted NAME PER Phenotypes and Genotypes of Single Crosses Use these characteristics about plants to answer the following questions. Round seed is dominant over wrinkled seed Yellow
More informationCHROMOSOMES Dr. Fern Tsien, Dept. of Genetics, LSUHSC, NO, LA
CHROMOSOMES Dr. Fern Tsien, Dept. of Genetics, LSUHSC, NO, LA Cytogenetics is the study of chromosomes and their structure, inheritance, and abnormalities. Chromosome abnormalities occur in approximately:
More informationCell Division and Mitosis DNA. Sexual Reproduction and Meiosis. 2. Meiosis occurs in the reproductive organs, producing four haploid sex cells.
ell Division and Mitosis 1. he life cycle of a cell has two parts growth and development, and cell division. 2. In mitosis, the nucleus divides to form two identical nuclei. Mitosis occurs in four continuous
More informationIncomplete Dominance and Codominance
Name: Date: Period: Incomplete Dominance and Codominance 1. In Japanese four o'clock plants red (R) color is incompletely dominant over white (r) flowers, and the heterozygous condition (Rr) results in
More informationChapter 4 Pedigree Analysis in Human Genetics. Chapter 4 Human Heredity by Michael Cummings 2006 Brooks/Cole-Thomson Learning
Chapter 4 Pedigree Analysis in Human Genetics Mendelian Inheritance in Humans Pigmentation Gene and Albinism Fig. 3.14 Two Genes Fig. 3.15 The Inheritance of Human Traits Difficulties Long generation time
More informationXII. Biology, Grade 10
XII. Biology, Grade 10 Grade 10 Biology Pilot Test The spring 2004 Grade 10 MCAS Biology Test was based on learning standards in the Biology content strand of the Massachusetts Science and Technology/Engineering
More information17. A testcross A.is used to determine if an organism that is displaying a recessive trait is heterozygous or homozygous for that trait. B.
ch04 Student: 1. Which of the following does not inactivate an X chromosome? A. Mammals B. Drosophila C. C. elegans D. Humans 2. Who originally identified a highly condensed structure in the interphase
More informationSexual Reproduction. and Meiosis. Sexual Reproduction
Sexual Reproduction and Meiosis Describe the stages of meiosis and how sex cells are produced. Explain why meiosis is needed for sexual reproduction. Name the cells that are involved in fertilization.
More informationForensic DNA Testing Terminology
Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.
More informationGene mutation and molecular medicine Chapter 15
Gene mutation and molecular medicine Chapter 15 Lecture Objectives What Are Mutations? How Are DNA Molecules and Mutations Analyzed? How Do Defective Proteins Lead to Diseases? What DNA Changes Lead to
More informationHow Cancer Begins???????? Chithra Manikandan Nov 2009
Cancer Cancer is one of the most common diseases in the developed world: 1 in 4 deaths are due to cancer 1 in 17 deaths are due to lung cancer Lung cancer is the most common cancer in men Breast cancer
More informationBIO 184 Page 1 Spring 2013 NAME VERSION 1 EXAM 3: KEY. Instructions: PRINT your Name and Exam version Number on your Scantron
BIO 184 Page 1 Spring 2013 EXAM 3: KEY Instructions: PRINT your Name and Exam version Number on your Scantron Example: PAULA SMITH, EXAM 2 VERSION 1 Write your name CLEARLY at the top of every page of
More informationAP Biology PowerPoint Notes Chapter 11 & 12 Patterns of Heredity and Human Genetics
AP Biology PowerPoint Notes Chapter 11 & 12 Patterns of Heredity and Human Genetics Mendelism and Genotype Genotype must be considered an integrated whole of all the genes because genes often work together
More informationCELL DIVISION. STAGES OF MITOTIC DIVISION (Diag. C1)
1 CELL DIVISION Cell division is the process by which cells replicate in order to replace cell loss, repair tissue damage and reproduce the organism. Two types of cell division are encountered in the Eukaryotic
More informationAS Biology Unit 2 Key Terms and Definitions. Make sure you use these terms when answering exam questions!
AS Biology Unit 2 Key Terms and Definitions Make sure you use these terms when answering exam questions! Chapter 7 Variation 7.1 Random Sampling Sampling a population to eliminate bias e.g. grid square
More information14.3 Studying the Human Genome
14.3 Studying the Human Genome Lesson Objectives Summarize the methods of DNA analysis. State the goals of the Human Genome Project and explain what we have learned so far. Lesson Summary Manipulating
More informationInfluence of Sex on Genetics. Chapter Six
Influence of Sex on Genetics Chapter Six Humans 23 Autosomes Chromosomal abnormalities very severe Often fatal All have at least one X Deletion of X chromosome is fatal Males = heterogametic sex XY Females
More informationA and B are not absolutely linked. They could be far enough apart on the chromosome that they assort independently.
Name Section 7.014 Problem Set 5 Please print out this problem set and record your answers on the printed copy. Answers to this problem set are to be turned in to the box outside 68-120 by 5:00pm on Friday
More informationTwo copies of each autosomal gene affect phenotype.
SECTION 7.1 CHROMOSOMES AND PHENOTYPE Study Guide KEY CONCEPT The chromosomes on which genes are located can affect the expression of traits. VOCABULARY carrier sex-linked gene X chromosome inactivation
More informationPractice Problems 4. (a) 19. (b) 36. (c) 17
Chapter 10 Practice Problems Practice Problems 4 1. The diploid chromosome number in a variety of chrysanthemum is 18. What would you call varieties with the following chromosome numbers? (a) 19 (b) 36
More informationGenetics with a Smile
Teacher Notes Materials Needed: Two coins (penny, poker chip, etc.) per student - One marked F for female and one marked M for male Copies of student worksheets - Genetics with a Smile, Smiley Face Traits,
More information