PROTEIN SYNTHESIS MAKES SENSE!

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "PROTEIN SYNTHESIS MAKES SENSE!"

Transcription

1 PROTEIN SYNTHESIS MAKES SENSE! Anita Gordon Modified by: Marianne Dobrovolny Purpose: To help students understand the role of DNA, mrna, trna, and amino acids in the process of protein synthesis. This activity can also be used to introduce the concept of mutations. Introduction: Students will use the steps of transcription and translation to assemble a protein that forms a sentence. Members of groups will use the handout to work through each step of the process. Group sizes of 2 or 3 work best. Nucleus: A table (or the floor) in the middle of the room which holds the DNA code cards. There are 20 different double strands of DNA. The bold stand represents the template strand and is the one that will be used during transcription. None of the DNA cards can leave the nucleus. Students will try to take them to their desks; emphasize why they must transcribe them in the nucleus. The first step is unzipping (un-velcro) the double strand of DNA. They must copy the bold DNA template onto the top strand in the nucleus on their handout. This strand should be labeled Template DNA. The students must transcribe the RNA code from the template stand of DNA onto the bottom strand in the nucleus on their handout. This strand should be labeled mrna and the process should be labeled Transcription. This entire process should be done while in the area of the nucleus, because DNA cannot leave the nucleus. Tell them to record the number that is on the DNA card it makes checking for accuracy easier later. Ribosome: The student desks or tables are the ribosomes, this is where they will decode the mrna codons to know which trna they need to find the correct amino acids (words). The mrna molecule should be copied onto the ribosome at the bottom of the handout. The dotted arrow represents the mrna molecule leaving the nucleus and combining with a ribosome. Using the mrna, they determine the correct anticodon for each on the trna s above the strand. trna: After they have identified the trna anticodons, anticodon cards are distributed around the perimeter of the room. Each anticodon card has a word on the back. When assembled in the correct order the sentence will read: Start sentence (some silly) Stop. If the anticodon cards are clustered with all those beginning with the same letter in the same part of the room, students can find the cards quicker. Report Your Protein: Student groups will read their sentence to the teacher. (It is easiest for you to check if they tell you the number of the DNA card.) If it is not correct, they have to go back and begin again to determine when their mutation occurred. WATCH OUT FOR MUTATIONS!!! If students incorrectly transcribe the DNA or mrna, then a mutation will occur and the sentence will not make sense or not be complete. Materials: 20 DNA template cards 64 Anticodon cards Students need paper and pencil Follow up worksheet to check for understanding of the actual process Acknowledgement: This lab has been adapted from a presentation at the 1993 NABT convention in Boston by Bert and Lynn Marie Wartski, Biology with Junk: Protein Synthesis and Words. 1

2 Teacher Preparation: Print the DNA strands on cardstock. Cut the double strand into two pieces. Cut close to the template DNA and leave room above the complementary strand of DNA as shown by the dotted line on DNA strand 1. Once you have laminated the cards, place pecies of Velcro on the extra space on the complementary strand. Position the other side of the Velcro on the template strand so that the nitrogen bases of the two strand lay right next to each other. Make trna cards with words on back. Make sure the right words on are the back of each anticodon card. They are made to be run front and back. Prepare copies on the handout. 20 Sentences: 1. Who let the dogs out? 11. Education is the door to the future. 2. Designer jeans genes are made from DNA. 12. Who made up the code? 3. Are we having fun yet? 13. Sad movies make me cry. 4. Rock music is the best. 14. We are all in this together! 5. Chocolate chip cookies are the best! 15. We must be informed every day. 6. Biology is the best subject. 16. Rock and roll music is the best! 7. Drink water every day. 17. Biology is all around me. 8. I love rock and roll music. 18. Read a little every day. 9. Mutations make new traits. 19. DNA is the code of life. 10. Biology is so much fun. 20. DNA must be read for life. Anticodons and the words to write on the back of each one: AUC = STOP CCG = IS CGC = WATER UAC = START CCU = SUBJECT CGG = EVERY AAA = WHO CGA = DRINK CGU = DAY AAC = FROM AAG = MUTATIONS AAU = SAD ACG = HAVING ACC = CHIP ACU = CRY ACA = DESIGNER AGA = THE AGG = ARE AGU = BEATLES AGC = BEST AUA = ROCK UAG = OUT AUU = UP CAA = YET CAC = JEANS GENES CAG = MAKE CAU = TRAITS CCA = CHOCOLATE CCC = BIOLOGY CUA = I CUC = LOVE CUG = ROLL CUU = MUSIC GAA = ALL GAC = MADE GAG = DOGS GAU = AND GCA = SO GCC = MUCH GCG = FUN GCU = EDUCATION GGA = DOOR GGC = TO GGG = FUTURE GGU = COOKIES GUA = A GUC = NEW GUG = MOVIES GUU = LET UAA = WE AUG = IN UAU = THIS UCA = TOGETHER UCC = MUST UCG = BE UCU = INFORMED UGA = AROUND UGC = ME UGG = READ UGU = LITTLE UUA = DNA UUC = CODE UUG = FOR UUU = LIFE Acknowledgement: This lab has been adapted from a presentation at the 1993 NABT convention in Boston by Bert and Lynn Marie Wartski, Biology with Junk: Protein Synthesis and Words. 2

3 DNA template cards: 1. TAC AAA GTT AGA GAG TAG ATC ATG TTT CAA TCT CTC ATC TAG 2. TAC ACA CAC AGG GAC AAC TTA ATC ATG TGT GTG TCC CTG TTG AAT TAG 3. TAC AGG TAA ACG GCG CAA ATC ATG TCC ATT TGC CGC GTT TAG 4. TAC ATA CTT CCG AGA AGC ATC ATG TAT GAA GGC TCA TCG TAG 5. TAC CCA ACC GGT AGG AGA AGC ATC ATG GGT TGG CCA TCC TCT TCG TAG 6. TAC CCC CCG AGA AGC CCT ATC ATG GGG GGC TCT TCG GGA TAG 7. TAC CGA CGC CGG CGT ATC ATG GCA GCG GCC GCA TAG 8. TAC CTA CTC ATA GAT CTG CTT ATC ATG GAT GAG TAT CTA GAC GAA TAG 9. TAC AAG CAG GTC CAT ATC ATG TTC GTC CAG GTA TAG 10. TAC CCC CCG GCA GCC GCG ATC ATG GGG GGC CGT CGG CGC TAG 11. TAC GCT CCG AGA GGA GGC AGA GGG ATC ATG CGA GGC TCT CCT CCG TCT CCC TAG 12. TAC AAA GAC ATT AGA TTC ATC ATG TTT CTG TAA TCT AAG TAG 13. TAC AAT GTG CAG TGC ACT ATC ATG TTA CAC GTC ACG TGA TAG 14. TAC TAA AGG GAA ATG TAT TCA ATC ATG ATT TCC CTT TAC ATA AGT TAG 15. TAC TAA TCC TCG TCT CGG CGT ATC ATG ATT AGG AGC AGA GCC GCA TAG 16. TAC ATA GAT CTG CTT CCG AGA AGC ATC ATG TAT CTA GAC GAA GGC TCT TCG TAG 17. TAC CCC CCG GAA TGA TGC ATC ATG GGG GGC CTT ACT ACG TAG 18. TAC TGG GTA TGT CGG CGT ATC ATG ACC CAT ACA GCC GCA TAG 19. TAC TTA CCG AGA TTC TTG TTT ATC ATG AAT GGC TCT AAG AAC AAA TAG 20. TAC TTA TCC TCG TGG TTG TTT ATC ATG AAT AGG AGC ACC AAC AAA TAG Acknowledgement: This lab has been adapted from a presentation at the 1993 NABT convention in Boston by Bert and Lynn Marie Wartski, Biology with Junk: Protein Synthesis and Words. 3

4 AUC ACG UAC ACA AAA AGU AAC UAG

5 FROM OUT WHO BEATLES START DESIGNER STOP HAVING

6 CAC GAU CCA GCG CUC GGC GAA GUA

7 ALL A LOVE TO CHOCOLATE FUN JEANS GENES AND

8 GUU UUA UAU UUU UCG CCG UGC CCU

9 ME SUBJECT BE IS THIS LIFE LET DNA

10 CGA AGC AAG AUU ACC CAG AGA CCC

11 THE BIOLOGY CHIP MAKE MUTATIONS UP DRINK BEST

12 CUG GGG GAC GUC GCA UAA GCU UCA

13 EDUCATION TOGETHER SO WE MADE NEW ROLL FUTURE

14 UCU CGG UGG CGU UUC AAU CGC ACU

15 WATER CRY CODE SAD READ DAY INFORMED EVERY

16 AGG CUA AUA CUU CAA GAG CAU GCC

17 TRAITS MUCH YET DOGS ROCK MUSIC ARE I

18 GGA UCC GGU UGA GUG UGU AUG UUG

19 IN FOR MOVIES LITTLE COOKIES AROUND DOOR MUST

20 1. TAC AAA GTT AGA GAG TAG ATC ATG TTT CAA TCT CTC ATC TAG 2. TAC ACA CAC AGG GAC AAC TTA ATC ATG TGT GTG TCC CTG TTG AAT TAG 3. TAC AGG TAA ACG GCG CAA ATC ATG TCC ATT TGC CGC GTT TAG

21 4. TAC ATA CTT CCG AGA AGC ATC ATG TAT GAA GGC TCT TCG TAG 5. TAC CCA ACC GGT AGG AGA AGC ATC ATG GGT TGG CCA TCC TCT TCG TAG 6. TAC CCC CCG AGA AGC CCT ATC ATG GGG GGC TCT TCG GGA TAG

22 7. TAC CGA CGC CGG CGT ATC ATG GCT GCG GCC GCA TAG 8. TAC CTA CTC ATA GAT CTG CTT ATC ATG GAT GAGTAT CTA GAC GAA TAG 9. TAC AAG CAG GTC CAT ATC ATG TTC GTC CAG GTA TAG

23 10. TAC CCC CCG GCA GCC GCG ATC ATG GGG GGC CGT CGG CGC TAG 11. TAC GCT CCG AGA GGA GGC AGA GGG ATC ATG CGA GGC TCT CCT CCG TCT CCC TAG 12. TAC AAA GAC ATT AGA TTC ATC ATG TTT CTG TAA TCT AAG TAG

24 13. TAC AAT GTG CAG TGC ACT ATC ATG TTA CAC GTC ACG TGA TAG 14. TAC TAA AGG GAA ATG TAT TCA ATC ATG ATT TCC CTT TAC ATA AGT TAG 15. TAC TAA TCC TCG TCT CGG CGT ATC ATG ATT AGGAGC AGA GCC GCA TAG

25 16. TAC ATA GAT CTG CTT CCG AGA AGC ATC ATG TAT CTA GAC GAA GGCTCT TCG TAG 17. TAC CCC CCG GAA TGA TGC ATC ATG GGG GGC CTT ACT ACG TAG 18. TAC TGG GTA TGT CGG CGT ATC ATG ACC CAT ACA GCC GCA TAG

26 19. TAC TTA CCG AGA TTC TTG TTT ATC ATG AAT GGC TCT AAG AAC AAATAG 20. TAC TTA TCC TCG TGG TTG TTT ATC ATG AAT AGGAGC ACC AAC AAA TAG

(http://genomes.urv.es/caical) TUTORIAL. (July 2006)

(http://genomes.urv.es/caical) TUTORIAL. (July 2006) (http://genomes.urv.es/caical) TUTORIAL (July 2006) CAIcal manual 2 Table of contents Introduction... 3 Required inputs... 5 SECTION A Calculation of parameters... 8 SECTION B CAI calculation for FASTA

More information

Hands on Simulation of Mutation

Hands on Simulation of Mutation Hands on Simulation of Mutation Charlotte K. Omoto P.O. Box 644236 Washington State University Pullman, WA 99164-4236 omoto@wsu.edu ABSTRACT This exercise is a hands-on simulation of mutations and their

More information

Gene Finding CMSC 423

Gene Finding CMSC 423 Gene Finding CMSC 423 Finding Signals in DNA We just have a long string of A, C, G, Ts. How can we find the signals encoded in it? Suppose you encountered a language you didn t know. How would you decipher

More information

DNA and Protein Synthesis Grade 10

DNA and Protein Synthesis Grade 10 Ohio Standards Connection: Life Sciences Benchmark C Explain the genetic mechanisms and molecular basis of inheritance. Indicator 5 Illustrate the relationship of the structure and function of DNA to protein

More information

Gene Finding. Slides by Carl Kingsford

Gene Finding. Slides by Carl Kingsford Gene Finding Slides by Carl Kingsford Genome of the Cow a sequence of 2.86 billion letters enough letters to fill a million pages of a typical book. TATGGAGCCAGGTGCCTGGGGCAACAAGACTGTGGTCACTGAATTCATCCTTCTTGGTCTAACAGAGAACATAG

More information

Protein Synthesis Simulation

Protein Synthesis Simulation Protein Synthesis Simulation Name(s) Date Period Benchmark: SC.912.L.16.5 as AA: Explain the basic processes of transcription and translation, and how they result in the expression of genes. (Assessed

More information

Section 1 Workbook (unit 2) ANSWERS

Section 1 Workbook (unit 2) ANSWERS Section 1 Workbook (unit 2) ANSWERS Complete the following table: nucleotide DNA RN Name: B5. Describe DNA replication 1) Label each base given in the diagram below and describe the 4 primary characteristics

More information

Mutation. Mutation provides raw material to evolution. Different kinds of mutations have different effects

Mutation. Mutation provides raw material to evolution. Different kinds of mutations have different effects Mutation Mutation provides raw material to evolution Different kinds of mutations have different effects Mutational Processes Point mutation single nucleotide changes coding changes (missense mutations)

More information

GENEWIZ, Inc. DNA Sequencing Service Details for USC Norris Comprehensive Cancer Center DNA Core

GENEWIZ, Inc. DNA Sequencing Service Details for USC Norris Comprehensive Cancer Center DNA Core DNA Sequencing Services Pre-Mixed o Provide template and primer, mixed into the same tube* Pre-Defined o Provide template and primer in separate tubes* Custom o Full-service for samples with unknown concentration

More information

Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein

Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein Assignment 3 Michele Owens Vocabulary Gene: A sequence of DNA that instructs a cell to produce a particular protein Promoter a control sequence near the start of a gene Coding sequence the sequence of

More information

(A) Microarray analysis was performed on ATM and MDM isolated from 4 obese donors.

(A) Microarray analysis was performed on ATM and MDM isolated from 4 obese donors. Legends of supplemental figures and tables Figure 1: Overview of study design and results. (A) Microarray analysis was performed on ATM and MDM isolated from 4 obese donors. After raw data gene expression

More information

Mutations and Genetic Variability. 1. What is occurring in the diagram below?

Mutations and Genetic Variability. 1. What is occurring in the diagram below? Mutations and Genetic Variability 1. What is occurring in the diagram below? A. Sister chromatids are separating. B. Alleles are independently assorting. C. Genes are replicating. D. Segments of DNA are

More information

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet 1 UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet Exam in: MBV4010 Arbeidsmetoder i molekylærbiologi og biokjemi I MBV4010 Methods in molecular biology and biochemistry I Day of exam:

More information

Molecular Facts and Figures

Molecular Facts and Figures Nucleic Acids Molecular Facts and Figures DNA/RNA bases: DNA and RNA are composed of four bases each. In DNA the four are Adenine (A), Thymidine (T), Cytosine (C), and Guanine (G). In RNA the four are

More information

DNA pol RNA pol ARS trna Ribosome DNA mrna Protein Transcription Translation Replication A B Acceptor stem D-loop T C loop Anticodon loop Variable loop Relative trna gene copy number 0.0 0.2 0.4

More information

Table S1. Related to Figure 4

Table S1. Related to Figure 4 Table S1. Related to Figure 4 Final Diagnosis Age PMD Control Control 61 15 Control 67 6 Control 68 10 Control 49 15 AR-PD PD 62 15 PD 65 4 PD 52 18 PD 68 10 AR-PD cingulate cortex used for immunoblot

More information

http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets

http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets by Louise Brown Jasko John Anthony Campbell Jack Dennis Cassidy Michael Nickelsburg Stephen Prentis Rohm Objectives: 1) Using plastic beads, construct

More information

10 µg lyophilized plasmid DNA (store lyophilized plasmid at 20 C)

10 µg lyophilized plasmid DNA (store lyophilized plasmid at 20 C) TECHNICAL DATA SHEET BIOLUMINESCENCE RESONANCE ENERGY TRANSFER RENILLA LUCIFERASE FUSION PROTEIN EXPRESSION VECTOR Product: prluc-c Vectors Catalog number: Description: Amount: The prluc-c vectors contain

More information

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet 1 UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet Exam in: MBV4010 Arbeidsmetoder i molekylærbiologi og biokjemi I MBV4010 Methods in molecular biology and biochemistry I Day of exam:.

More information

Introduction to Perl Programming Input/Output, Regular Expressions, String Manipulation. Beginning Perl, Chap 4 6. Example 1

Introduction to Perl Programming Input/Output, Regular Expressions, String Manipulation. Beginning Perl, Chap 4 6. Example 1 Introduction to Perl Programming Input/Output, Regular Expressions, String Manipulation Beginning Perl, Chap 4 6 Example 1 #!/usr/bin/perl -w use strict; # version 1: my @nt = ('A', 'C', 'G', 'T'); for

More information

Biological One-way Functions

Biological One-way Functions Biological One-way Functions Qinghai Gao, Xiaowen Zhang 2, Michael Anshel 3 gaoj@farmingdale.edu zhangx@mail.csi.cuny.edu csmma@cs.ccny.cuny.edu Dept. Security System, Farmingdale State College / SUNY,

More information

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled Biology 101 Chapter 14 Name: Fill-in-the-Blanks Which base follows the next in a strand of DNA is referred to. as the base (1) Sequence. The region of DNA that calls for the assembly of specific amino

More information

DNA Sample preparation and Submission Guidelines

DNA Sample preparation and Submission Guidelines DNA Sample preparation and Submission Guidelines Requirements: Please submit samples in 1.5ml microcentrifuge tubes. Fill all the required information in the Eurofins DNA sequencing order form and send

More information

The p53 MUTATION HANDBOOK

The p53 MUTATION HANDBOOK The p MUTATION HANDBOOK Version 1. /7 Thierry Soussi Christophe Béroud, Dalil Hamroun Jean Michel Rubio Nevado http://p/free.fr The p Mutation HandBook By T Soussi, J.M. Rubio-Nevado, D. Hamroun and C.

More information

Supplementary Online Material for Morris et al. sirna-induced transcriptional gene

Supplementary Online Material for Morris et al. sirna-induced transcriptional gene Supplementary Online Material for Morris et al. sirna-induced transcriptional gene silencing in human cells. Materials and Methods Lentiviral vector and sirnas. FIV vector pve-gfpwp was prepared as described

More information

MUTATION PRESSURE AND NATURAL SELECTION AFFECT PATTERN OF CODON USAGE BIAS IN MITOCHONDRIAL ATPASE 6 AND ATPASE 8 GENES IN DIFFERENT MAMMALIAN SPECIES

MUTATION PRESSURE AND NATURAL SELECTION AFFECT PATTERN OF CODON USAGE BIAS IN MITOCHONDRIAL ATPASE 6 AND ATPASE 8 GENES IN DIFFERENT MAMMALIAN SPECIES , pp.-068-075. Available online at http://www.bioinfopublication.org/jouarchive.php?opt=&jouid=bpj0000220 MUTATION PRESSURE AND NATURAL SELECTION AFFECT PATTERN OF CODON USAGE BIAS IN MITOCHONDRIAL ATPASE

More information

Provincial Exam Questions. 9. Give one role of each of the following nucleic acids in the production of an enzyme.

Provincial Exam Questions. 9. Give one role of each of the following nucleic acids in the production of an enzyme. Provincial Exam Questions Unit: Cell Biology: Protein Synthesis (B7 & B8) 2010 Jan 3. Describe the process of translation. (4 marks) 2009 Sample 8. What is the role of ribosomes in protein synthesis? A.

More information

Codon usage bias is correlated with gene expression levels in the fission yeast Schizosaccharomyces pombe

Codon usage bias is correlated with gene expression levels in the fission yeast Schizosaccharomyces pombe Codon usage bias is correlated with gene expression levels Blackwell Y Hiraoka usage Publishing et al. bias in fission Inc yeast in the fission yeast Schizosaccharomyces pombe Yasushi Hiraoka 1,2,3, *,

More information

Hiding Data in DNA. 1 Introduction

Hiding Data in DNA. 1 Introduction Hiding Data in DNA Boris Shimanovsky *, Jessica Feng +, and Miodrag Potkonjak + * XAP Corporation + Dept. Computer Science, Univ. of California, Los Angeles Abstract. Just like disk or RAM, DNA and RNA

More information

Synonymous Codon Usage in Lactococcus lactis: Mutational Bias Versus Translational Selection

Synonymous Codon Usage in Lactococcus lactis: Mutational Bias Versus Translational Selection Journal of Biomolecular Structure & Dynamics, ISSN 0739-1102 Volume 21, Issue Number 4, (2004) Adenine Press (2004) Abstract Synonymous Codon Usage in Lactococcus lactis: Mutational Bias Versus Translational

More information

Synonymous Codon Usage Bias in Porcine Epidemic Diarrhea Virus

Synonymous Codon Usage Bias in Porcine Epidemic Diarrhea Virus Synonymous Codon Usage Bias in Porcine Epidemic Diarrhea Virus Cao, H.W. and Zhang, H.* College of Biological Science and Technology, HeiLongJiang BaYi Agricultural University, DaQing 163319, China. *

More information

Gene Synthesis 191. Mutagenesis 194. Gene Cloning 196. AccuGeneBlock Service 198. Gene Synthesis FAQs 201. User Protocol 204

Gene Synthesis 191. Mutagenesis 194. Gene Cloning 196. AccuGeneBlock Service 198. Gene Synthesis FAQs 201. User Protocol 204 Gene Synthesis 191 Mutagenesis 194 Gene Cloning 196 AccuGeneBlock Service 198 Gene Synthesis FAQs 201 User Protocol 204 Gene Synthesis Overview Gene synthesis is the most cost-effective way to enhance

More information

2006 7.012 Problem Set 3 KEY

2006 7.012 Problem Set 3 KEY 2006 7.012 Problem Set 3 KEY Due before 5 PM on FRIDAY, October 13, 2006. Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. Which reaction is catalyzed by each

More information

Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation

Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation BDGP Resources Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation For recovery of sequences flanking PZ, PlacW and PEP elements E. Jay Rehm Berkeley Drosophila Genome Project I.

More information

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing 38. Informationsgespräch der Blutspendezentralefür Wien, Niederösterreich und Burgenland Österreichisches Rotes Kreuz 22. November 2014, Parkhotel Schönbrunn Die Zukunft hat

More information

Supplementary Information. Binding region and interaction properties of sulfoquinovosylacylglycerol (SQAG) with human

Supplementary Information. Binding region and interaction properties of sulfoquinovosylacylglycerol (SQAG) with human Supplementary Information Binding region and interaction properties of sulfoquinovosylacylglycerol (SQAG) with human vascular endothelial growth factor 165 revealed by biosensor based assays Yoichi Takakusagi

More information

Gene and Chromosome Mutation Worksheet (reference pgs. 239-240 in Modern Biology textbook)

Gene and Chromosome Mutation Worksheet (reference pgs. 239-240 in Modern Biology textbook) Name Date Per Look at the diagrams, then answer the questions. Gene Mutations affect a single gene by changing its base sequence, resulting in an incorrect, or nonfunctional, protein being made. (a) A

More information

Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University

Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University Egypt Interpretation of sequence results An overview on

More information

Insulin mrna to Protein Kit

Insulin mrna to Protein Kit Insulin mrna to Protein Kit A 3DMD Paper BioInformatics and Mini-Toober Folding Activity Teacher Key and Teacher Notes www. Insulin mrna to Protein Kit Contents Becoming Familiar with the Data... 3 Identifying

More information

SERVICES CATALOGUE WITH SUBMISSION GUIDELINES

SERVICES CATALOGUE WITH SUBMISSION GUIDELINES SERVICES CATALOGUE WITH SUBMISSION GUIDELINES 3921 Montgomery Road Cincinnati, Ohio 45212 513-841-2428 www.agctsequencing.com CONTENTS Welcome Dye Terminator Sequencing DNA Sequencing Services - Full Service

More information

Inverse PCR and Sequencing of P-element, piggybac and Minos Insertion Sites in the Drosophila Gene Disruption Project

Inverse PCR and Sequencing of P-element, piggybac and Minos Insertion Sites in the Drosophila Gene Disruption Project Inverse PCR and Sequencing of P-element, piggybac and Minos Insertion Sites in the Drosophila Gene Disruption Project Protocol for recovery of sequences flanking insertions in the Drosophila Gene Disruption

More information

pcas-guide System Validation in Genome Editing

pcas-guide System Validation in Genome Editing pcas-guide System Validation in Genome Editing Tagging HSP60 with HA tag genome editing The latest tool in genome editing CRISPR/Cas9 allows for specific genome disruption and replacement in a flexible

More information

ANALYSIS OF A CIRCULAR CODE MODEL

ANALYSIS OF A CIRCULAR CODE MODEL ANALYSIS OF A CIRCULAR CODE MODEL Jérôme Lacan and Chrstan J. Mchel * Laboratore d Informatque de Franche-Comté UNIVERSITE DE FRANCHE-COMTE IUT de Belfort-Montbélard 4 Place Tharradn - BP 747 5 Montbélard

More information

UNIT (12) MOLECULES OF LIFE: NUCLEIC ACIDS

UNIT (12) MOLECULES OF LIFE: NUCLEIC ACIDS UIT (12) MLECULE F LIFE: UCLEIC ACID ucleic acids are extremely large molecules that were first isolated from the nuclei of cells. Two kinds of nucleic acids are found in cells: RA (ribonucleic acid) is

More information

FDC-Specific Functions of p55tnfr and IKK2

FDC-Specific Functions of p55tnfr and IKK2 Supplemental Data FDC-Specific Functions of p55tnfr and IKK2 in the Development of FDC Networks and of Antibody Responses Panayiotis Victoratos, Jacques Lagnel, Sotiria Tzima, Marat B. Alimzhanov, Klaus

More information

PRACTICE TEST QUESTIONS

PRACTICE TEST QUESTIONS PART A: MULTIPLE CHOICE QUESTIONS PRACTICE TEST QUESTIONS DNA & PROTEIN SYNTHESIS B 1. One of the functions of DNA is to A. secrete vacuoles. B. make copies of itself. C. join amino acids to each other.

More information

Molecular analyses of EGFR: mutation and amplification detection

Molecular analyses of EGFR: mutation and amplification detection Molecular analyses of EGFR: mutation and amplification detection Petra Nederlof, Moleculaire Pathologie NKI Amsterdam Henrique Ruijter, Ivon Tielen, Lucie Boerrigter, Aafke Ariaens Outline presentation

More information

Analysis of synonymous codon usage bias and nucleotide and amino acid composition in 13 species of Flaviviridae

Analysis of synonymous codon usage bias and nucleotide and amino acid composition in 13 species of Flaviviridae Journal of Cell and Molecular Research (2011) 3 (1), 1-11 Analysis of synonymous codon usage bias and nucleotide and amino acid composition in 13 species of Flaviviridae Fatemeh Moosavi 1, Hassan Mohabatkar

More information

Blue Heron, Your Gene Synthesis Partner

Blue Heron, Your Gene Synthesis Partner Blue Heron, Your Gene Synthesis Partner You Design it We Build it Simple to Complex Sequences Codon Optimization Any species Variants Single or pooled clone libraries Antibody Affinity Optimization Whole

More information

Module 6: Digital DNA

Module 6: Digital DNA Module 6: Digital DNA Representation and processing of digital information in the form of DNA is essential to life in all organisms, no matter how large or tiny. Computing tools and computational thinking

More information

Supplemental Data. Short Article. PPARγ Activation Primes Human Monocytes. into Alternative M2 Macrophages. with Anti-inflammatory Properties

Supplemental Data. Short Article. PPARγ Activation Primes Human Monocytes. into Alternative M2 Macrophages. with Anti-inflammatory Properties Cell Metabolism, Volume 6 Supplemental Data Short Article PPARγ Activation Primes Human Monocytes into Alternative M2 Macrophages with Anti-inflammatory Properties M. Amine Bouhlel, Bruno Derudas, Elena

More information

Chapter 9. Applications of probability. 9.1 The genetic code

Chapter 9. Applications of probability. 9.1 The genetic code Chapter 9 Applications of probability In this chapter we use the tools of elementary probability to investigate problems of several kinds. First, we study the language of life by focusing on the universal

More information

SEAC 2012 Medical Director Potpourri BANNER. WILLIAM PENN. YOUR COMPANY FOR LIFE

SEAC 2012 Medical Director Potpourri BANNER. WILLIAM PENN. YOUR COMPANY FOR LIFE SEAC 2012 Medical Director Potpourri BANNER. WILLIAM PENN. YOUR COMPANY FOR LIFE SEAC ML ENGMAN, MD Vice President and Chief Medical Director BANNER. WILLIAM PENN. YOUR COMPANY FOR LIFE UNDERWRITING SLEEP

More information

Analysis of BRCA1 and BRCA2 mutations in Brazilian breast cancer patients with positive family history

Analysis of BRCA1 and BRCA2 mutations in Brazilian breast cancer patients with positive family history ORIGINAL ARTICLE Rozany Mucha Dufloth Sílvia Carvalho Juliana Karina Heinrich Júlia Yoriko Shinzato César Cabello dos Santos Luiz Carlos Zeferino Fernando Schmitt Analysis of BRCA1 and BRCA2 mutations

More information

Part ONE. a. Assuming each of the four bases occurs with equal probability, how many bits of information does a nucleotide contain?

Part ONE. a. Assuming each of the four bases occurs with equal probability, how many bits of information does a nucleotide contain? Networked Systems, COMPGZ01, 2012 Answer TWO questions from Part ONE on the answer booklet containing lined writing paper, and answer ALL questions in Part TWO on the multiple-choice question answer sheet.

More information

On the evolution of codon usage bias

On the evolution of codon usage bias University of Tennessee, Knoxville Trace: Tennessee Research and Creative Exchange Doctoral Dissertations Graduate School 5-2011 On the evolution of codon usage bias Premal R. Shah allmaya@gmail.com Recommended

More information

Marine Biology DEC 2004; 146(1) : 53-64 http://dx.doi.org/10.1007/s00227-004-1423-6 Copyright 2004 Springer

Marine Biology DEC 2004; 146(1) : 53-64 http://dx.doi.org/10.1007/s00227-004-1423-6 Copyright 2004 Springer Marine Biology DEC 2004; 146(1) : 53-64 http://dx.doi.org/10.1007/s00227-004-1423-6 Copyright 2004 Springer Archimer http://www.ifremer.fr/docelec/ Archive Institutionnelle de l Ifremer The original publication

More information

Y-chromosome haplotype distribution in Han Chinese populations and modern human origin in East Asians

Y-chromosome haplotype distribution in Han Chinese populations and modern human origin in East Asians Vol. 44 No. 3 SCIENCE IN CHINA (Series C) June 2001 Y-chromosome haplotype distribution in Han Chinese populations and modern human origin in East Asians KE Yuehai ( `º) 1, SU Bing (3 Á) 1 3, XIAO Junhua

More information

Title : Parallel DNA Synthesis : Two PCR product from one DNA template

Title : Parallel DNA Synthesis : Two PCR product from one DNA template Title : Parallel DNA Synthesis : Two PCR product from one DNA template Bhardwaj Vikash 1 and Sharma Kulbhushan 2 1 Email: vikashbhardwaj@ gmail.com 1 Current address: Government College Sector 14 Gurgaon,

More information

13.2 Ribosomes & Protein Synthesis

13.2 Ribosomes & Protein Synthesis 13.2 Ribosomes & Protein Synthesis Introduction: *A specific sequence of bases in DNA carries the directions for forming a polypeptide, a chain of amino acids (there are 20 different types of amino acid).

More information

From DNA to Protein

From DNA to Protein Nucleus Control center of the cell contains the genetic library encoded in the sequences of nucleotides in molecules of DNA code for the amino acid sequences of all proteins determines which specific proteins

More information

pcmv6-neo Vector Application Guide Contents

pcmv6-neo Vector Application Guide Contents pcmv6-neo Vector Application Guide Contents Package Contents and Storage Conditions... 2 Product Description... 2 Introduction... 2 Production and Quality Assurance... 2 Methods... 3 Other required reagents...

More information

Cloning, sequencing, and expression of H.a. YNRI and H.a. YNII, encoding nitrate and nitrite reductases in the yeast Hansenula anomala

Cloning, sequencing, and expression of H.a. YNRI and H.a. YNII, encoding nitrate and nitrite reductases in the yeast Hansenula anomala Cloning, sequencing, and expression of H.a. YNRI and H.a. YNII, encoding nitrate and nitrite reductases in the yeast Hansenula anomala -'Pablo García-Lugo 1t, Celedonio González l, Germán Perdomo l, Nélida

More information

Analysis of Synonymous Codon Usage Bias in Chlamydia

Analysis of Synonymous Codon Usage Bias in Chlamydia ISSN 1672-9145 Acta Biochimica et Biophysica Sinica 2005, 37(1): 1 10 CN 31-1940/Q Analysis of Synonymous Codon Usage Bias in Chlamydia Hui LÜ, Wei-Ming ZHAO*, Yan ZHENG, Hong WANG, Mei QI, and Xiu-Ping

More information

The making of The Genoma Music

The making of The Genoma Music 242 Summary Key words Resumen Palabras clave The making of The Genoma Music Aurora Sánchez Sousa 1, Fernando Baquero 1 and Cesar Nombela 2 1 Department of Microbiology, Ramón y Cajal Hospital, and 2 Department

More information

Keywords: synonymous codon usage, mutational bias, multivariate statistical analysis, optimal codons. ABSTRACT

Keywords: synonymous codon usage, mutational bias, multivariate statistical analysis, optimal codons. ABSTRACT Statistical Analysis of codon usage in extremely halophilic bacterium, Salinibacter ruber DSM 13855 Sanjukta RK 1, Farooqi MS 1*, Sharma N 1, Rai N 2, Mishra DC 1, Rai A 1, Singh DP 3 and Chaturvedi KK

More information

ANALYSIS OF GROWTH HORMONE IN TENCH (TINCA TINCA) ANALÝZA RŮSTOVÉHO HORMONU LÍNA OBECNÉHO (TINCA TINCA)

ANALYSIS OF GROWTH HORMONE IN TENCH (TINCA TINCA) ANALÝZA RŮSTOVÉHO HORMONU LÍNA OBECNÉHO (TINCA TINCA) ANALYSIS OF GROWTH HORMONE IN TENCH (TINCA TINCA) ANALÝZA RŮSTOVÉHO HORMONU LÍNA OBECNÉHO (TINCA TINCA) Zrůstová J., Bílek K., Baránek V., Knoll A. Ústav morfologie, fyziologie a genetiky zvířat, Agronomická

More information

From Gene to Protein Transcription and Translation i

From Gene to Protein Transcription and Translation i From Gene to Protein Transcription and Translation i How do the genes in our DNA influence our characteristics? For example, how can a gene determine whether a person is an albino with very pale skin and

More information

Codon Usage Bias and Determining Forces in Taenia solium Genome

Codon Usage Bias and Determining Forces in Taenia solium Genome ISSN (Print) 23-41 ISSN (Online) 1738-6 ORIGINAL ARTICLE Korean J Parasitol Vol. 53, No. 6: 689-697, December 215 http://dx.doi.org/1.3347/kjp.215.53.6.689 Codon Usage Bias and Determining Forces in Taenia

More information

ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes

ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes Page 1 of 22 Introduction Indiana students enrolled in Biology I participated in the ISTEP+: Biology I Graduation Examination

More information

The DNA-"Wave Biocomputer"

The DNA-Wave Biocomputer The DNA-"Wave Biocomputer" Peter P. Gariaev (Pjotr Garjajev)*, Boris I. Birshtein*, Alexander M. Iarochenko*, Peter J. Marcer**, George G. Tertishny*, Katherine A. Leonova*, Uwe Kaempf ***. * Institute

More information

Molecular Genetics. RNA, Transcription, & Protein Synthesis

Molecular Genetics. RNA, Transcription, & Protein Synthesis Molecular Genetics RNA, Transcription, & Protein Synthesis Section 1 RNA AND TRANSCRIPTION Objectives Describe the primary functions of RNA Identify how RNA differs from DNA Describe the structure and

More information

Biopython Tutorial and Cookbook

Biopython Tutorial and Cookbook Biopython Tutorial and Cookbook Jeff Chang, Brad Chapman, Iddo Friedberg, Thomas Hamelryck, Michiel de Hoon, Peter Cock Last Update September 2008 Contents 1 Introduction 5 1.1 What is Biopython?.........................................

More information

Drosophila NK-homeobox genes

Drosophila NK-homeobox genes Proc. Natl. Acad. Sci. USA Vol. 86, pp. 7716-7720, October 1989 Biochemistry Drosophila NK-homeobox genes (NK-1, NK-2,, and DNA clones/chromosome locations of genes) YONGSOK KIM AND MARSHALL NIRENBERG

More information

Molecular chaperones involved in preprotein. targeting to plant organelles

Molecular chaperones involved in preprotein. targeting to plant organelles Molecular chaperones involved in preprotein targeting to plant organelles Dissertation der Fakultät für Biologie der Ludwig-Maximilians-Universität München vorgelegt von Christine Fellerer München 29.

More information

Significance of sarcomere gene mutation in patients with dilated cardiomyopathy

Significance of sarcomere gene mutation in patients with dilated cardiomyopathy Significance of sarcomere gene mutation in patients with dilated cardiomyopathy Y.D. Li 1 *, Y.T. Ji 1 *, X.H. Zhou 1, H.L. Li 2, H.T. Zhang 3, Y. Zhang 1, J.X. Li 1, Q. Xing 1, J.H. Zhang 1, Y.F. Hong

More information

der Strukturbiologie

der Strukturbiologie Einführung Aspekte der in Thermodynamik die Bioinformatik in der Strukturbiologie Wintersemester 2012/13 16:00-16:45 Hörsaal N100 B3 Peter Güntert Literatur Jean-Michel Claverie, Cedric Notredame: Bioinformatics

More information

Bio 102 Practice Problems Genetic Code and Mutation

Bio 102 Practice Problems Genetic Code and Mutation Bio 102 Practice Problems Genetic Code and Mutation Multiple choice: Unless otherwise directed, circle the one best answer: 1. Choose the one best answer: Beadle and Tatum mutagenized Neurospora to find

More information

Transcription and Translation of DNA

Transcription and Translation of DNA Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes

More information

Transmembrane Signaling in Chimeras of the E. coli Chemotaxis Receptors and Bacterial Class III Adenylyl Cyclases

Transmembrane Signaling in Chimeras of the E. coli Chemotaxis Receptors and Bacterial Class III Adenylyl Cyclases Transmembrane Signaling in Chimeras of the E. coli Chemotaxis Receptors and Bacterial Class III Adenylyl Cyclases Dissertation der Mathematisch-Naturwissenschaftlichen Fakultät der Eberhard Karls Universität

More information

Thymine = orange Adenine = dark green Guanine = purple Cytosine = yellow Uracil = brown

Thymine = orange Adenine = dark green Guanine = purple Cytosine = yellow Uracil = brown 1 DNA Coloring - Transcription & Translation Transcription RNA, Ribonucleic Acid is very similar to DNA. RNA normally exists as a single strand (and not the double stranded double helix of DNA). It contains

More information

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes

More information

The University of the State of New York REGENTS HIGH SCHOOL EXAMINATION LIVING ENVIRONMENT. Tuesday, January 25, 2011 9:15 a.m. to 12:15 p.m.

The University of the State of New York REGENTS HIGH SCHOOL EXAMINATION LIVING ENVIRONMENT. Tuesday, January 25, 2011 9:15 a.m. to 12:15 p.m. LIVING ENVIRONMENT The University of the State of New York REGENTS HIGH SCHOOL EXAMINATION LIVING ENVIRONMENT Tuesday, January 25, 2011 9:15 a.m. to 12:15 p.m., only Student Name School Name Notice...

More information

Ribosomal Protein Synthesis

Ribosomal Protein Synthesis 1 1 Ribosomal Protein Synthesis Prof. Dr. Wolfgang Wintermeyer 1, Prof. Dr. Marina V. Rodnina 2 1 Institut f r Molekularbiologie, Universit t Witten/Herdecke, Stockumer Stra e 10, 58448 Witten, Germany;

More information

Characterization of cdna clones of the family of trypsin/a-amylase inhibitors (CM-proteins) in barley {Hordeum vulgare L.)

Characterization of cdna clones of the family of trypsin/a-amylase inhibitors (CM-proteins) in barley {Hordeum vulgare L.) Characterization of cdna clones of the family of trypsin/a-amylase inhibitors (CM-proteins) in barley {Hordeum vulgare L.) J. Paz-Ares, F. Ponz, P. Rodríguez-Palenzuela, A. Lázaro, C. Hernández-Lucas,

More information

Protein Synthesis. Page 41 Page 44 Page 47 Page 42 Page 45 Page 48 Page 43 Page 46 Page 49. Page 41. DNA RNA Protein. Vocabulary

Protein Synthesis. Page 41 Page 44 Page 47 Page 42 Page 45 Page 48 Page 43 Page 46 Page 49. Page 41. DNA RNA Protein. Vocabulary Protein Synthesis Vocabulary Transcription Translation Translocation Chromosomal mutation Deoxyribonucleic acid Frame shift mutation Gene expression Mutation Point mutation Page 41 Page 41 Page 44 Page

More information

Heraeus Sepatech, Kendro Laboratory Products GmbH, Berlin. Becton Dickinson,Heidelberg. Biozym, Hessisch Oldendorf. Eppendorf, Hamburg

Heraeus Sepatech, Kendro Laboratory Products GmbH, Berlin. Becton Dickinson,Heidelberg. Biozym, Hessisch Oldendorf. Eppendorf, Hamburg 13 4. MATERIALS 4.1 Laboratory apparatus Biofuge A Centrifuge 5804R FACScan Gel electrophoresis chamber GPR Centrifuge Heraeus CO-AUTO-ZERO Light Cycler Microscope Motopipet Neubauer Cell Chamber PCR cycler

More information

were demonstrated to be, respectively, the catalytic and regulatory subunits of protein phosphatase 2A (PP2A) (29).

were demonstrated to be, respectively, the catalytic and regulatory subunits of protein phosphatase 2A (PP2A) (29). JOURNAL OF VIROLOGY, Feb. 1992, p. 886-893 0022-538X/92/020886-08$02.00/0 Copyright C) 1992, American Society for Microbiology Vol. 66, No. 2 The Third Subunit of Protein Phosphatase 2A (PP2A), a 55- Kilodalton

More information

Six Homeoproteins and a Iinc-RNA at the Fast MYH Locus Lock Fast Myofiber Terminal Phenotype

Six Homeoproteins and a Iinc-RNA at the Fast MYH Locus Lock Fast Myofiber Terminal Phenotype Six Homeoproteins and a Iinc-RNA at the Fast MYH Locus Lock Fast Myofiber Terminal Phenotype Iori Sakakibara 1,2,3, Marc Santolini 4, Arnaud Ferry 2,5, Vincent Hakim 4, Pascal Maire 1,2,3 * 1 INSERM U1016,

More information

NimbleGen SeqCap EZ Library SR User s Guide Version 3.0

NimbleGen SeqCap EZ Library SR User s Guide Version 3.0 NimbleGen SeqCap EZ Library SR User s Guide Version 3.0 For life science research only. Not for use in diagnostic procedures. Copyright 2011 Roche NimbleGen, Inc. All Rights Reserved. Editions Version

More information

DISSERTATIONES MEDICINAE UNIVERSITATIS TARTUENSIS 108

DISSERTATIONES MEDICINAE UNIVERSITATIS TARTUENSIS 108 DISSERTATIONES MEDICINAE UNIVERSITATIS TARTUENSIS 108 DISSERTATIONES MEDICINAE UNIVERSITATIS TARTUENSIS 108 THE INTERLEUKIN-10 FAMILY CYTOKINES GENE POLYMORPHISMS IN PLAQUE PSORIASIS KÜLLI KINGO TARTU

More information

Impaired insulin and insulin-like growth factor expression and signaling mechanisms in Alzheimer s disease is this type 3 diabetes?

Impaired insulin and insulin-like growth factor expression and signaling mechanisms in Alzheimer s disease is this type 3 diabetes? Journal of Alzheimer s Disease 7 (2005) 63 80 63 IOS Press Impaired insulin and insulin-like growth factor expression and signaling mechanisms in Alzheimer s disease is this type 3 diabetes? Eric Steen,

More information

Five-minute cloning of Taq polymerase-amplified PCR products

Five-minute cloning of Taq polymerase-amplified PCR products TOPO TA Cloning Version R 8 April 2004 25-0184 TOPO TA Cloning Five-minute cloning of Taq polymerase-amplified PCR products Catalog nos. K4500-01, K4500-40, K4510-20, K4520-01, K4520-40, K4550-01, K4550-40,

More information

All commonly-used expression vectors used in the Jia Lab contain the following multiple cloning site: BamHI EcoRI SmaI SalI XhoI_ NotI

All commonly-used expression vectors used in the Jia Lab contain the following multiple cloning site: BamHI EcoRI SmaI SalI XhoI_ NotI 2. Primer Design 2.1 Multiple Cloning Sites All commonly-used expression vectors used in the Jia Lab contain the following multiple cloning site: BamHI EcoRI SmaI SalI XhoI NotI XXX XXX GGA TCC CCG AAT

More information

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,

More information

N-terminal Regulatory Domains of Phosphodiesterases 1, 4, 5 and 10 examined with an Adenylyl Cyclase as a Reporter

N-terminal Regulatory Domains of Phosphodiesterases 1, 4, 5 and 10 examined with an Adenylyl Cyclase as a Reporter N-terminal Regulatory Domains of Phosphodiesterases 1, 4, 5 and 10 examined with an Adenylyl Cyclase as a Reporter Dissertation der Mathematisch-Naturwissenschaftlichen Fakultät der Eberhard Karls Universität

More information

2. The term gene is coined by 1) Johanson 2) T H Morgan 3) G.J.Mendel 4) Carl Correns

2. The term gene is coined by 1) Johanson 2) T H Morgan 3) G.J.Mendel 4) Carl Correns MOLECULAR BIOLOGY GENE AND GENE CONCEPT 1. Generally a gene is 1) a part of DNA 2) a protein 3) DNA + protein 4) a part of RNA 2. The term gene is coined by 1) Johanson 2) T H Morgan 3) G.J.Mendel 4) Carl

More information

Sean Carroll.

Sean Carroll. Sean Carroll http://www.molbio.wisc.edu/carroll/teaching.html sbcarrol@wisc.edu 1 Suggestions for doing well Come to class! Read the assignment before lecture Stay current with problems Seek help if needed

More information

Modeling DNA Replication and Protein Synthesis

Modeling DNA Replication and Protein Synthesis Skills Practice Lab Modeling DNA Replication and Protein Synthesis OBJECTIVES Construct and analyze a model of DNA. Use a model to simulate the process of replication. Use a model to simulate the process

More information