Lecture 5. GENETICS OF PROKARYOTES
|
|
|
- Simon Osborne
- 7 years ago
- Views:
Transcription
1 Lecture 5. GENETICS OF PROKARYOTES 1. Basic concepts 2. The prokaryotic genome 3. The pan-genome 4. Genetic interchange and recombination 4.1. Recombination 4.2. Transformation 4.3. Conjugation 4.4. Transduction 5. Transposable elements 6. Genetic manipulation of microorganisms ( Genetic engineering )
2 1. BASIC CONCEPTS Genome: molecule/s storing the genetic information (DNA in all cells; DNA and/or RNA in viruses) Gene: the basic unit of genetic information. A fragment of DNA or RNA, including regulatory sequences, coding for a protein or RNA. Regulatory sequences 5 3 Coding sequence (ORF: open reading frame) Expression: transcription (when the gene product is a rrna or trna) or transcription and translation (when the gene product is a protein; implies mrna) Replication Transcription DNA RNA PROTEIN Translation Reverse transcription GENETIC CODE Replication
3 2. THE PROKARYOTIC GENOME Chromosome: carries genes essential for survival Plasmid/s: non essential* genes. Selectve advantages Chromosome Plasmids
4 2. THE PROKARYOTIC GENOME 2.1. CHROMOSOME Number: normally, only one Copy number: Size: 0.5 Mb 10 Mb Structure: cccdna (with some exceptions) supercoiled Packaging: basic proteins, cations, etc. Plasmid Regulatory non-coding sequences (11%) Protein coding sequences (87%) RNA coding sequences (0.8%) Non-coding sequences (0.7%) Chromosome Escherichia coli chromosome
5
6 2. THE PROKARYOTIC GENOME 2.1. CHROMOSOME OPERON REGULON Only one promoter. Co-transcription of several genes. Polycistronic RNA One regulatory molecule Co-expression of several operons
7 2. THE PROKARYOTIC GENOME 2.2. PLASMIDS Circular (normally) DNA molecules Chromosome-independent replication Genes non-essential* for growths Size range from 1 Kb to 1 Mb (megaplasmids) High/low copy number Incompatibility groups Curation: plasmid loss (induced or spontaneous) Plasmid Plasmid types: Cryptic Conjugative Chromosome Resistance Metabolic Virulence Plasmids R Episome Engineered
8 2. THE PROKARYOTIC GENOME 2.2. PLASMIDS ROLLING CIRCLE REPLICATION
9 3. THE PAN-GENOME Core genome vs. Accessory genome (strain and environmental sequences)
10 GENETIC VARIABILITY GENETIC VARIABILITY Eukaryotes: Prokaryotes: Individual level (mutation and recombination) Population level (sexual reproduction) Individual level (mutation and recombination) Population level (HGT: horizontal gene transfer or LGT: lateral GT)
11 These mechanisms transfer DNA to receptor cells. This DNA will stay if it recombines with the receptor genome
12 4.1. RECOMBINATION Together with point mutations, this is a mechanisms of generating genetic diversity Transfer of DNA between different molecules. Homologous recombination requieres large straches of homologous sequences (>100pb)
13 4.1. RECOMBINATION Barrier to the recombination: restriction-modification systems Exogenous DNA Methylase Restriction enzyme CH 3 Methylated Chromosomic DNA CH 3
14 4.1. RECOMBINATION RESTRICTION ENZYMES
15 4.1. TRANSFORMATION
16 4.1. TRANSFORMATION Definition? Competent cells Viral DNA: transfection DNA binding proteins Autolysines Nucleases DNA carrier proteins
17 4.1. TRANSFORMATION Natural or recombinant plasmid (Genetic Engineering)
18 4.1. CONJUGATION
19 4.1. CONJUGATION DNasa
20 4.1. CONJUGATION Conjugative plasmids [e.g.: plasmid F (factor F)] F+ F- F+ F+
21 4.1. CONJUGATION Integration into the genome (episomes) Plasmid F Chromosome Plasmid F INtegrated plasmid F bbe
22 4.1. CONJUGATION
23 4.1. CONJUGATION
24 4.1. CONJUGATION From Hfr to F- From F to F- 2 recombinat cells 2 cells with F
25 4.4. TRANDSUCTION DNase
26 4.4. TRANDSUCTION LYTIC vs LYSOGENIC CYCLES Virulent phages Always lysis Temperate phages Integration/Lysis
27 4.4. TRANSDUCTION GENERALIZED TRANSDUCTION Defective phage Transduced cell
28 SPECIALIZED TRANSDUCTION
29 4.4. TRANSDUCTION Gene Transfer Agents (GTAs)
30 5. TRANSPOSABLE ELEMENTS DNA fragments that can move and integrate in a new genomic region (transposition) Insertion sequences Transposons Replicative transposons
31 5. TRANSPOSABLE ELEMENTS CUT AND PASTE Genomic region A (with a mobile element) Genomic region B (without a mobile element) Transposable element Transposable element Genomic region A (without a mobile element) Genomic region B (with a mobile element) COPY AND PASTE Genomic region A (with a mobile element) Genomic region B (without a mobile element) Transposable element Transposable element Genomic region A (with a mobile element) Genomic region B (with a mobile element)
32 5. TRANSPOSABLE ELEMENTS Gene expression inactivation 5 P Over-expression 3 No effect 5 3
33 6. GENETIC MANIPULATION OF MICROORGANISMS 6.1. GENE CLONING Restriction enzymes / Taq polimerase Restriction enzymes DNA ligases bb Transformation
34 6. GENETIC MANIPULATION OF MICROORGANISMS 6.2. CLONING VECTORS BBE
35 6. GENETIC MANIPULATION OF MICROORGANISMS 6.2. CLONING VECTORS
36 6. GENETIC MANIPULATION OF MICROORGANISMS 6.3. METAGENOMICS
Milestones of bacterial genetic research:
Milestones of bacterial genetic research: 1944 Avery's pneumococcal transformation experiment shows that DNA is the hereditary material 1946 Lederberg & Tatum describes bacterial conjugation using biochemical
Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.
13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both
Recombinant DNA Technology
Recombinant DNA Technology Dates in the Development of Gene Cloning: 1965 - plasmids 1967 - ligase 1970 - restriction endonucleases 1972 - first experiments in gene splicing 1974 - worldwide moratorium
Transfection-Transfer of non-viral genetic material into eukaryotic cells. Infection/ Transduction- Transfer of viral genetic material into cells.
Transfection Key words: Transient transfection, Stable transfection, transfection methods, vector, plasmid, origin of replication, reporter gene/ protein, cloning site, promoter and enhancer, signal peptide,
Recombinant DNA and Biotechnology
Recombinant DNA and Biotechnology Chapter 18 Lecture Objectives What Is Recombinant DNA? How Are New Genes Inserted into Cells? What Sources of DNA Are Used in Cloning? What Other Tools Are Used to Study
Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation
Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna
The sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized:
Module 3F Protein Synthesis So far in this unit, we have examined: How genes are transmitted from one generation to the next Where genes are located What genes are made of How genes are replicated How
Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )
Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins
restriction enzymes 350 Home R. Ward: Spring 2001
restriction enzymes 350 Home Restriction Enzymes (endonucleases): molecular scissors that cut DNA Properties of widely used Type II restriction enzymes: recognize a single sequence of bases in dsdna, usually
How To Understand How Gene Expression Is Regulated
What makes cells different from each other? How do cells respond to information from environment? Regulation of: - Transcription - prokaryotes - eukaryotes - mrna splicing - mrna localisation and translation
Structure and Function of DNA
Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four
Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College
Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology
1 Mutation and Genetic Change
CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds
Biotechnology: DNA Technology & Genomics
Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 The BIG Questions How can we use our knowledge of DNA to: diagnose disease or defect? cure disease or defect? change/improve organisms? What
Gene Cloning. Reference. T.A. Brown, Gene Cloning, Chapman and Hall. S.B. Primrose, Molecular Biotechnology, Blackwell
Gene Cloning 2004 Seungwook Kim Chem. & Bio. Eng. Reference T.A. Brown, Gene Cloning, Chapman and Hall S.B. Primrose, Molecular Biotechnology, Blackwell Why Gene Cloning is Important? A century ago, Gregor
VIRUSES. Basic virus structure. Obligate intracellular parasites. Enveloped Viruses. Classification of Viruses. Viruses. Heyer 1
Viruses VIRUSES Viruses are small packages of genes Consist of protein coat around nucleic acids ( or RNA) Viruses measured in nanometers (nm). Require electron microscopy. Obligate intracellular parasites
CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA
CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA INTRODUCTION DNA : DNA is deoxyribose nucleic acid. It is made up of a base consisting of sugar, phosphate and one nitrogen base.the
AP BIOLOGY 2007 SCORING GUIDELINES
AP BIOLOGY 2007 SCORING GUIDELINES Question 4 A bacterial plasmid is 100 kb in length. The plasmid DNA was digested to completion with two restriction enzymes in three separate treatments: EcoRI, HaeIII,
Module 3 Questions. 7. Chemotaxis is an example of signal transduction. Explain, with the use of diagrams.
Module 3 Questions Section 1. Essay and Short Answers. Use diagrams wherever possible 1. With the use of a diagram, provide an overview of the general regulation strategies available to a bacterial cell.
4. DNA replication Pages: 979-984 Difficulty: 2 Ans: C Which one of the following statements about enzymes that interact with DNA is true?
Chapter 25 DNA Metabolism Multiple Choice Questions 1. DNA replication Page: 977 Difficulty: 2 Ans: C The Meselson-Stahl experiment established that: A) DNA polymerase has a crucial role in DNA synthesis.
Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION. Professor Bharat Patel Office: Science 2, 2.36 Email: b.patel@griffith.edu.
Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION Professor Bharat Patel Office: Science 2, 2.36 Email: b.patel@griffith.edu.au What is Gene Expression & Gene Regulation? 1. Gene Expression
The world of non-coding RNA. Espen Enerly
The world of non-coding RNA Espen Enerly ncrna in general Different groups Small RNAs Outline mirnas and sirnas Speculations Common for all ncrna Per def.: never translated Not spurious transcripts Always/often
Genetics 301 Sample Final Examination Spring 2003
Genetics 301 Sample Final Examination Spring 2003 50 Multiple Choice Questions-(Choose the best answer) 1. A cross between two true breeding lines one with dark blue flowers and one with bright white flowers
Compiled and/or written by Amy B. Vento and David R. Gillum
Fact Sheet Describing Recombinant DNA and Elements Utilizing Recombinant DNA Such as Plasmids and Viral Vectors, and the Application of Recombinant DNA Techniques in Molecular Biology Compiled and/or written
Bacterial Transformation and Plasmid Purification. Chapter 5: Background
Bacterial Transformation and Plasmid Purification Chapter 5: Background History of Transformation and Plasmids Bacterial methods of DNA transfer Transformation: when bacteria take up DNA from their environment
DNA CLONING. DNA segment has been developed: polymerase chain reaction PCR. Viral DNA-s bacteriophage λ, filamentous bacteriophages
DNA CLONING - What is cloning? The isolation of discrete pieces of DNA from their host organism and their amplification through propagation in the same or a different host More recently an alternitive,
DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!
DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other
Transmission of genetic variation: conjugation. Transmission of genetic variation: conjugation
Transmission of genetic variation: conjugation Transmission of genetic variation: conjugation Bacterial Conjugation is genetic recombination in which there is a transfer of DNA from a living donor bacterium
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS
European Medicines Agency
European Medicines Agency July 1996 CPMP/ICH/139/95 ICH Topic Q 5 B Quality of Biotechnological Products: Analysis of the Expression Construct in Cell Lines Used for Production of r-dna Derived Protein
Biological Sciences Initiative. Human Genome
Biological Sciences Initiative HHMI Human Genome Introduction In 2000, researchers from around the world published a draft sequence of the entire genome. 20 labs from 6 countries worked on the sequence.
2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three
Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,
BACTERIAL GENETICS. Sridhar Rao P.N www.microrao.com
BACTERIAL GENETICS Genetics is the study of genes including the structure of genetic materials, what information is stored in the genes, how the genes are expressed and how the genetic information is transferred.
Genetic Engineering and Biotechnology
1 So, what is biotechnology?? The use of living organisms to carry out defined chemical processes for industrial or commercial application. The office of Technology Assessment of the U.S. Congress defines
Expression and Purification of Recombinant Protein in bacteria and Yeast. Presented By: Puspa pandey, Mohit sachdeva & Ming yu
Expression and Purification of Recombinant Protein in bacteria and Yeast Presented By: Puspa pandey, Mohit sachdeva & Ming yu DNA Vectors Molecular carriers which carry fragments of DNA into host cell.
GENE REGULATION. Teacher Packet
AP * BIOLOGY GENE REGULATION Teacher Packet AP* is a trademark of the College Entrance Examination Board. The College Entrance Examination Board was not involved in the production of this material. Pictures
Bio 102 Practice Problems Recombinant DNA and Biotechnology
Bio 102 Practice Problems Recombinant DNA and Biotechnology Multiple choice: Unless otherwise directed, circle the one best answer: 1. Which of the following DNA sequences could be the recognition site
From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains
Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes
Gene Transcription in Prokaryotes
Gene Transcription in Prokaryotes Operons: in prokaryotes, genes that encode protein participating in a common pathway are organized together. This group of genes, arranged in tandem, is called an OPERON.
Central Dogma. Lecture 10. Discussing DNA replication. DNA Replication. DNA mutation and repair. Transcription
Central Dogma transcription translation DNA RNA Protein replication Discussing DNA replication (Nucleus of eukaryote, cytoplasm of prokaryote) Recall Replication is semi-conservative and bidirectional
Sample Questions for Exam 3
Sample Questions for Exam 3 1. All of the following occur during prometaphase of mitosis in animal cells except a. the centrioles move toward opposite poles. b. the nucleolus can no longer be seen. c.
Bacterial and Phage Genetic Switches
Bacterial and Phage Genetic Switches Prof. C. J. Dorman Department of Microbiology, Moyne Institute of Preventive Medicine, Trinity College, Dublin. Lecture 1 The genetic switch controlling the lytic-lysogen
a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled
Biology 101 Chapter 14 Name: Fill-in-the-Blanks Which base follows the next in a strand of DNA is referred to. as the base (1) Sequence. The region of DNA that calls for the assembly of specific amino
DNA (genetic information in genes) RNA (copies of genes) proteins (functional molecules) directionality along the backbone 5 (phosphate) to 3 (OH)
DNA, RNA, replication, translation, and transcription Overview Recall the central dogma of biology: DNA (genetic information in genes) RNA (copies of genes) proteins (functional molecules) DNA structure
Complex multicellular organisms are produced by cells that switch genes on and off during development.
Home Control of Gene Expression Gene Regulation Is Necessary? By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection favoring
AP Biology TEST #5 - Chapters 11-14, 16 - REVIEW SHEET
NAME: AP Biology TEST #5 - Chapters 11-14, 16 - REVIEW SHEET 1. Griffith's experiments showing the transformation of R strain pneumococcus bacteria to S strain pneumococcus bacteria in the presence of
CCR Biology - Chapter 9 Practice Test - Summer 2012
Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible
The Steps. 1. Transcription. 2. Transferal. 3. Translation
Protein Synthesis Protein synthesis is simply the "making of proteins." Although the term itself is easy to understand, the multiple steps that a cell in a plant or animal must go through are not. In order
Chapter 18 Regulation of Gene Expression
Chapter 18 Regulation of Gene Expression 18.1. Gene Regulation Is Necessary By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection
Genetics Test Biology I
Genetics Test Biology I Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Avery s experiments showed that bacteria are transformed by a. RNA. c. proteins.
GenBank, Entrez, & FASTA
GenBank, Entrez, & FASTA Nucleotide Sequence Databases First generation GenBank is a representative example started as sort of a museum to preserve knowledge of a sequence from first discovery great repositories,
HCS604.03 Exercise 1 Dr. Jones Spring 2005. Recombinant DNA (Molecular Cloning) exercise:
HCS604.03 Exercise 1 Dr. Jones Spring 2005 Recombinant DNA (Molecular Cloning) exercise: The purpose of this exercise is to learn techniques used to create recombinant DNA or clone genes. You will clone
The E. coli Insulin Factory
The E. coli Insulin Factory BACKGROUND Bacteria have not only their normal DNA, they also have pieces of circular DNA called plasmids. Plasmids are a wonderfully ally for biologists who desire to get bacteria
Gene mutation and molecular medicine Chapter 15
Gene mutation and molecular medicine Chapter 15 Lecture Objectives What Are Mutations? How Are DNA Molecules and Mutations Analyzed? How Do Defective Proteins Lead to Diseases? What DNA Changes Lead to
Control of Gene Expression
Home Gene Regulation Is Necessary? Control of Gene Expression By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection favoring
Microbial Genetics (Chapter 8) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College. Eastern Campus
Microbial Genetics (Chapter 8) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology An Introduction
BCH401G Lecture 39 Andres
BCH401G Lecture 39 Andres Lecture Summary: Ribosome: Understand its role in translation and differences between translation in prokaryotes and eukaryotes. Translation: Understand the chemistry of this
Viruses. Viral components: Capsid. Chapter 10: Viruses. Viral components: Nucleic Acid. Viral components: Envelope
Viruses Chapter 10: Viruses Lecture Exam #3 Wednesday, November 22 nd (This lecture WILL be on Exam #3) Dr. Amy Rogers Office Hours: MW 9-10 AM Too small to see with a light microscope Visible with electron
13.4 Gene Regulation and Expression
13.4 Gene Regulation and Expression Lesson Objectives Describe gene regulation in prokaryotes. Explain how most eukaryotic genes are regulated. Relate gene regulation to development in multicellular organisms.
13.2 Ribosomes & Protein Synthesis
13.2 Ribosomes & Protein Synthesis Introduction: *A specific sequence of bases in DNA carries the directions for forming a polypeptide, a chain of amino acids (there are 20 different types of amino acid).
Protein Expression. A Practical Approach J. HIGGIN S
Protein Expression A Practical Approach S. J. HIGGIN S B. D. HAMES List of contributors Abbreviations xv Xvi i 1. Protein expression in mammalian cell s Marlies Otter-Nilsson and Tommy Nilsso n 1. Introduction
Gene Regulation -- The Lac Operon
Gene Regulation -- The Lac Operon Specific proteins are present in different tissues and some appear only at certain times during development. All cells of a higher organism have the full set of genes:
Restriction Endonucleases
Nucleic Acids and Molecular Biology 14 Restriction Endonucleases Bearbeitet von Alfred Pingoud 1. Auflage 2004. Buch. xxvi, 443 S. Hardcover ISBN 978 3 540 20502 9 Format (B x L): 15,5 x 23,5 cm Gewicht:
Chapter 6 DNA Replication
Chapter 6 DNA Replication Each strand of the DNA double helix contains a sequence of nucleotides that is exactly complementary to the nucleotide sequence of its partner strand. Each strand can therefore
1.5 page 3 DNA Replication S. Preston 1
AS Unit 1: Basic Biochemistry and Cell Organisation Name: Date: Topic 1.5 Nucleic Acids and their functions Page 3 l. DNA Replication 1. Go through PowerPoint 2. Read notes p2 and then watch the animation
BioBoot Camp Genetics
BioBoot Camp Genetics BIO.B.1.2.1 Describe how the process of DNA replication results in the transmission and/or conservation of genetic information DNA Replication is the process of DNA being copied before
DNA Replication in Prokaryotes
OpenStax-CNX module: m44488 1 DNA Replication in Prokaryotes OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section,
somatic cell egg genotype gamete polar body phenotype homologous chromosome trait dominant autosome genetics recessive
CHAPTER 6 MEIOSIS AND MENDEL Vocabulary Practice somatic cell egg genotype gamete polar body phenotype homologous chromosome trait dominant autosome genetics recessive CHAPTER 6 Meiosis and Mendel sex
Gene Switches Teacher Information
STO-143 Gene Switches Teacher Information Summary Kit contains How do bacteria turn on and turn off genes? Students model the action of the lac operon that regulates the expression of genes essential for
Introduction to Genome Annotation
Introduction to Genome Annotation AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT
DNA, RNA, Protein synthesis, and Mutations. Chapters 12-13.3
DNA, RNA, Protein synthesis, and Mutations Chapters 12-13.3 1A)Identify the components of DNA and explain its role in heredity. DNA s Role in heredity: Contains the genetic information of a cell that can
Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in
DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results
Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology
Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,
Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources
Appendix 2 Molecular Biology Core Curriculum Websites and Other Resources Chapter 1 - The Molecular Basis of Cancer 1. Inside Cancer http://www.insidecancer.org/ From the Dolan DNA Learning Center Cold
AP BIOLOGY 2009 SCORING GUIDELINES
AP BIOLOGY 2009 SCORING GUIDELINES Question 4 The flow of genetic information from DNA to protein in eukaryotic cells is called the central dogma of biology. (a) Explain the role of each of the following
2.1.2 Characterization of antiviral effect of cytokine expression on HBV replication in transduced mouse hepatocytes line
i 1 INTRODUCTION 1.1 Human Hepatitis B virus (HBV) 1 1.1.1 Pathogenesis of Hepatitis B 1 1.1.2 Genome organization of HBV 3 1.1.3 Structure of HBV virion 5 1.1.4 HBV life cycle 5 1.1.5 Experimental models
Basic Concepts Recombinant DNA Use with Chapter 13, Section 13.2
Name Date lass Master 19 Basic oncepts Recombinant DN Use with hapter, Section.2 Formation of Recombinant DN ut leavage Splicing opyright lencoe/mcraw-hill, a division of he Mcraw-Hill ompanies, Inc. Bacterial
Translation Study Guide
Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to
NO CALCULATORS OR CELL PHONES ALLOWED
Biol 205 Exam 1 TEST FORM A Spring 2008 NAME Fill out both sides of the Scantron Sheet. On Side 2 be sure to indicate that you have TEST FORM A The answers to Part I should be placed on the SCANTRON SHEET.
Genetic Technology. Name: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question.
Name: Class: Date: Genetic Technology Multiple Choice Identify the choice that best completes the statement or answers the question. 1. An application of using DNA technology to help environmental scientists
Lecture 8. Protein Trafficking/Targeting. Protein targeting is necessary for proteins that are destined to work outside the cytoplasm.
Protein Trafficking/Targeting (8.1) Lecture 8 Protein Trafficking/Targeting Protein targeting is necessary for proteins that are destined to work outside the cytoplasm. Protein targeting is more complex
Gymnázium, Brno, Slovanské nám. 7, WORKBOOK - Biology WORKBOOK. http://agb.gymnaslo.cz
WORKBOOK http://agb.gymnaslo.cz Biology Subject: Teacher: Iva Kubištová Student:.. School year:../ This material was prepared with using http://biologygmh.com/ Topics: 1. 2. 3. 4. 5. 6. Viruses and Bacteria
E. coli plasmid and gene profiling using Next Generation Sequencing
E. coli plasmid and gene profiling using Next Generation Sequencing Jeroen F. J. Laros Leiden Genome Technology Center Department of Human Genetics Center for Human and Clinical Genetics Introduction General
Viral Infection: Receptors
Viral Infection: Receptors Receptors: Identification of receptors has come from expressing the gene for the receptor in a cell to which a virus does not normally bind -OR- By blocking virus attachment
Horizontal Gene Transfer and Its Part in the Reorganisation of Genetics during the LUCA Epoch
Life 2013, 3, 518-523; doi:10.3390/life3040518 Editorial OPEN ACCESS life ISSN 2075-1729 www.mdpi.com/journal/life Horizontal Gene Transfer and Its Part in the Reorganisation of Genetics during the LUCA
GENE CLONING AND RECOMBINANT DNA TECHNOLOGY
GENE CLONING AND RECOMBINANT DNA TECHNOLOGY What is recombinant DNA? DNA from 2 different sources (often from 2 different species) are combined together in vitro. Recombinant DNA forms the basis of cloning.
A and B are not absolutely linked. They could be far enough apart on the chromosome that they assort independently.
Name Section 7.014 Problem Set 5 Please print out this problem set and record your answers on the printed copy. Answers to this problem set are to be turned in to the box outside 68-120 by 5:00pm on Friday
Given these characteristics of life, which of the following objects is considered a living organism? W. X. Y. Z.
Cell Structure and Organization 1. All living things must possess certain characteristics. They are all composed of one or more cells. They can grow, reproduce, and pass their genes on to their offspring.
Basic attributes of genetic processes (replication, transcription, translation)
411-3 2008 Lecture notes I. First general topic in the course will be mutation (in broadest sense, any change to an organismʼs genetic material). Intimately intertwined with this is the process of DNA
Protein Synthesis How Genes Become Constituent Molecules
Protein Synthesis Protein Synthesis How Genes Become Constituent Molecules Mendel and The Idea of Gene What is a Chromosome? A chromosome is a molecule of DNA 50% 50% 1. True 2. False True False Protein
Genetic Variation and Molecular Evolution
1 Genetic Variation and Molecular Evolution Werner Arber Biozentrum, University of Basel, Klingelbergstrasse 70, Basel, Switzerland 1 Introduction 3 2 Principles of Molecular Evolution 4 2.1 Evolutionary
Chapter 18: Applications of Immunology
Chapter 18: Applications of Immunology 1. Vaccinations 2. Monoclonal vs Polyclonal Ab 3. Diagnostic Immunology 1. Vaccinations What is Vaccination? A method of inducing artificial immunity by exposing
AP BIOLOGY 2010 SCORING GUIDELINES (Form B)
AP BIOLOGY 2010 SCORING GUIDELINES (Form B) Question 2 Certain human genetic conditions, such as sickle cell anemia, result from single base-pair mutations in DNA. (a) Explain how a single base-pair mutation
Molecular Genetics. RNA, Transcription, & Protein Synthesis
Molecular Genetics RNA, Transcription, & Protein Synthesis Section 1 RNA AND TRANSCRIPTION Objectives Describe the primary functions of RNA Identify how RNA differs from DNA Describe the structure and
Genetics Module B, Anchor 3
Genetics Module B, Anchor 3 Key Concepts: - An individual s characteristics are determines by factors that are passed from one parental generation to the next. - During gamete formation, the alleles for
Localised Sex, Contingency and Mutator Genes. Bacterial Genetics as a Metaphor for Computing Systems
Localised Sex, Contingency and Mutator Genes Bacterial Genetics as a Metaphor for Computing Systems Outline Living Systems as metaphors Evolutionary mechanisms Mutation Sex and Localized sex Contingent
Molecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION
Molecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION Susan Carson Heather B. Miller D.Scott Witherow ELSEVIER AMSTERDAM BOSTON HEIDELBERG LONDON NEW YORK OXFORD PARIS SAN DIEGO SAN
Control of Gene Expression
Control of Gene Expression (Learning Objectives) Explain the role of gene expression is differentiation of function of cells which leads to the emergence of different tissues, organs, and organ systems
Organelle Speed Dating Game Instructions and answers for teachers
Organelle Speed Dating Game Instructions and answers for teachers These instructions should accompany the OCR resources GCSE (9 1) Combined Science 21 st Century Science B Organelle Speed Dating Game learner
RNA & Protein Synthesis
RNA & Protein Synthesis Genes send messages to cellular machinery RNA Plays a major role in process Process has three phases (Genetic) Transcription (Genetic) Translation Protein Synthesis RNA Synthesis