Lecture 5. GENETICS OF PROKARYOTES

Size: px
Start display at page:

Download "Lecture 5. GENETICS OF PROKARYOTES"

Transcription

1 Lecture 5. GENETICS OF PROKARYOTES 1. Basic concepts 2. The prokaryotic genome 3. The pan-genome 4. Genetic interchange and recombination 4.1. Recombination 4.2. Transformation 4.3. Conjugation 4.4. Transduction 5. Transposable elements 6. Genetic manipulation of microorganisms ( Genetic engineering )

2 1. BASIC CONCEPTS Genome: molecule/s storing the genetic information (DNA in all cells; DNA and/or RNA in viruses) Gene: the basic unit of genetic information. A fragment of DNA or RNA, including regulatory sequences, coding for a protein or RNA. Regulatory sequences 5 3 Coding sequence (ORF: open reading frame) Expression: transcription (when the gene product is a rrna or trna) or transcription and translation (when the gene product is a protein; implies mrna) Replication Transcription DNA RNA PROTEIN Translation Reverse transcription GENETIC CODE Replication

3 2. THE PROKARYOTIC GENOME Chromosome: carries genes essential for survival Plasmid/s: non essential* genes. Selectve advantages Chromosome Plasmids

4 2. THE PROKARYOTIC GENOME 2.1. CHROMOSOME Number: normally, only one Copy number: Size: 0.5 Mb 10 Mb Structure: cccdna (with some exceptions) supercoiled Packaging: basic proteins, cations, etc. Plasmid Regulatory non-coding sequences (11%) Protein coding sequences (87%) RNA coding sequences (0.8%) Non-coding sequences (0.7%) Chromosome Escherichia coli chromosome

5

6 2. THE PROKARYOTIC GENOME 2.1. CHROMOSOME OPERON REGULON Only one promoter. Co-transcription of several genes. Polycistronic RNA One regulatory molecule Co-expression of several operons

7 2. THE PROKARYOTIC GENOME 2.2. PLASMIDS Circular (normally) DNA molecules Chromosome-independent replication Genes non-essential* for growths Size range from 1 Kb to 1 Mb (megaplasmids) High/low copy number Incompatibility groups Curation: plasmid loss (induced or spontaneous) Plasmid Plasmid types: Cryptic Conjugative Chromosome Resistance Metabolic Virulence Plasmids R Episome Engineered

8 2. THE PROKARYOTIC GENOME 2.2. PLASMIDS ROLLING CIRCLE REPLICATION

9 3. THE PAN-GENOME Core genome vs. Accessory genome (strain and environmental sequences)

10 GENETIC VARIABILITY GENETIC VARIABILITY Eukaryotes: Prokaryotes: Individual level (mutation and recombination) Population level (sexual reproduction) Individual level (mutation and recombination) Population level (HGT: horizontal gene transfer or LGT: lateral GT)

11 These mechanisms transfer DNA to receptor cells. This DNA will stay if it recombines with the receptor genome

12 4.1. RECOMBINATION Together with point mutations, this is a mechanisms of generating genetic diversity Transfer of DNA between different molecules. Homologous recombination requieres large straches of homologous sequences (>100pb)

13 4.1. RECOMBINATION Barrier to the recombination: restriction-modification systems Exogenous DNA Methylase Restriction enzyme CH 3 Methylated Chromosomic DNA CH 3

14 4.1. RECOMBINATION RESTRICTION ENZYMES

15 4.1. TRANSFORMATION

16 4.1. TRANSFORMATION Definition? Competent cells Viral DNA: transfection DNA binding proteins Autolysines Nucleases DNA carrier proteins

17 4.1. TRANSFORMATION Natural or recombinant plasmid (Genetic Engineering)

18 4.1. CONJUGATION

19 4.1. CONJUGATION DNasa

20 4.1. CONJUGATION Conjugative plasmids [e.g.: plasmid F (factor F)] F+ F- F+ F+

21 4.1. CONJUGATION Integration into the genome (episomes) Plasmid F Chromosome Plasmid F INtegrated plasmid F bbe

22 4.1. CONJUGATION

23 4.1. CONJUGATION

24 4.1. CONJUGATION From Hfr to F- From F to F- 2 recombinat cells 2 cells with F

25 4.4. TRANDSUCTION DNase

26 4.4. TRANDSUCTION LYTIC vs LYSOGENIC CYCLES Virulent phages Always lysis Temperate phages Integration/Lysis

27 4.4. TRANSDUCTION GENERALIZED TRANSDUCTION Defective phage Transduced cell

28 SPECIALIZED TRANSDUCTION

29 4.4. TRANSDUCTION Gene Transfer Agents (GTAs)

30 5. TRANSPOSABLE ELEMENTS DNA fragments that can move and integrate in a new genomic region (transposition) Insertion sequences Transposons Replicative transposons

31 5. TRANSPOSABLE ELEMENTS CUT AND PASTE Genomic region A (with a mobile element) Genomic region B (without a mobile element) Transposable element Transposable element Genomic region A (without a mobile element) Genomic region B (with a mobile element) COPY AND PASTE Genomic region A (with a mobile element) Genomic region B (without a mobile element) Transposable element Transposable element Genomic region A (with a mobile element) Genomic region B (with a mobile element)

32 5. TRANSPOSABLE ELEMENTS Gene expression inactivation 5 P Over-expression 3 No effect 5 3

33 6. GENETIC MANIPULATION OF MICROORGANISMS 6.1. GENE CLONING Restriction enzymes / Taq polimerase Restriction enzymes DNA ligases bb Transformation

34 6. GENETIC MANIPULATION OF MICROORGANISMS 6.2. CLONING VECTORS BBE

35 6. GENETIC MANIPULATION OF MICROORGANISMS 6.2. CLONING VECTORS

36 6. GENETIC MANIPULATION OF MICROORGANISMS 6.3. METAGENOMICS

Milestones of bacterial genetic research:

Milestones of bacterial genetic research: Milestones of bacterial genetic research: 1944 Avery's pneumococcal transformation experiment shows that DNA is the hereditary material 1946 Lederberg & Tatum describes bacterial conjugation using biochemical

More information

Chapter 9. Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA

Chapter 9. Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA Chapter 9 Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA Q&A Interferons are species specific, so that interferons to be used in humans must be produced in human cells. Can you think

More information

30. Genetics and recombination in bacteria Lecture Outline 11/16/05. The Bacterial Genome and Its Replication The bacterial chromosome

30. Genetics and recombination in bacteria Lecture Outline 11/16/05. The Bacterial Genome and Its Replication The bacterial chromosome 30. Genetics and recombination in bacteria Lecture Outline 11/16/05 Replication in bacteria Types of recombination in bacteria Transduction by phage Conjugation ( mating ) F+ plasmids Hfr s Transformation

More information

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d. 13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both

More information

AP Biology Review Packet 4: Viruses, Bacteria and Expression & DNA Technology

AP Biology Review Packet 4: Viruses, Bacteria and Expression & DNA Technology AP Biology Review Packet 4: Viruses, Bacteria and Expression & DNA Technology 3A1- DNA, and in some cases RNA, is the primary source of heritable information. 3B1- Gene Regulation results in differential

More information

Recombinant DNA Technology

Recombinant DNA Technology Recombinant DNA Technology Dates in the Development of Gene Cloning: 1965 - plasmids 1967 - ligase 1970 - restriction endonucleases 1972 - first experiments in gene splicing 1974 - worldwide moratorium

More information

Transfection-Transfer of non-viral genetic material into eukaryotic cells. Infection/ Transduction- Transfer of viral genetic material into cells.

Transfection-Transfer of non-viral genetic material into eukaryotic cells. Infection/ Transduction- Transfer of viral genetic material into cells. Transfection Key words: Transient transfection, Stable transfection, transfection methods, vector, plasmid, origin of replication, reporter gene/ protein, cloning site, promoter and enhancer, signal peptide,

More information

Recombinant DNA and Biotechnology

Recombinant DNA and Biotechnology Recombinant DNA and Biotechnology Chapter 18 Lecture Objectives What Is Recombinant DNA? How Are New Genes Inserted into Cells? What Sources of DNA Are Used in Cloning? What Other Tools Are Used to Study

More information

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna

More information

The sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized:

The sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized: Module 3F Protein Synthesis So far in this unit, we have examined: How genes are transmitted from one generation to the next Where genes are located What genes are made of How genes are replicated How

More information

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins

More information

restriction enzymes 350 Home R. Ward: Spring 2001

restriction enzymes 350 Home R. Ward: Spring 2001 restriction enzymes 350 Home Restriction Enzymes (endonucleases): molecular scissors that cut DNA Properties of widely used Type II restriction enzymes: recognize a single sequence of bases in dsdna, usually

More information

Microbial Genetics. Chapter 8. Structure and Function of the Genetic Material. Genotype and Phenotype. DNA and Chromosomes.

Microbial Genetics. Chapter 8. Structure and Function of the Genetic Material. Genotype and Phenotype. DNA and Chromosomes. Chapter 8 Microbial Genetics Structure and Function of the Genetic Material Chromosomes are cellular structures made up of genes that carry hereditary information. Genetics is the study of how genes carry

More information

Chapter 20: Biotechnology: DNA Technology & Genomics

Chapter 20: Biotechnology: DNA Technology & Genomics Biotechnology Chapter 20: Biotechnology: DNA Technology & Genomics The BIG Questions How can we use our knowledge of DNA to: o Diagnose disease or defect? o Cure disease or defect? o Change/improve organisms?

More information

Antibiotic susceptibility

Antibiotic susceptibility Antibiotic susceptibility Antibiotic: natural chemicals produced by bacteria, fungi, actinomycetes, plants or animals, and either inhibits or kills other microbes and/or cells Chemotherapeutic agent: A

More information

Structure and Function of DNA

Structure and Function of DNA Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four

More information

What makes cells different from each other? How do cells respond to information from environment?

What makes cells different from each other? How do cells respond to information from environment? What makes cells different from each other? How do cells respond to information from environment? Regulation of: - Transcription - prokaryotes - eukaryotes - mrna splicing - mrna localisation and translation

More information

1 Mutation and Genetic Change

1 Mutation and Genetic Change CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds

More information

Chapter 29. DNA as the Genetic Material. Recombination of DNA. BCH 4054 Chapter 29 Lecture Notes. Slide 1. Slide 2. Slide 3. Chapter 29, Page 1

Chapter 29. DNA as the Genetic Material. Recombination of DNA. BCH 4054 Chapter 29 Lecture Notes. Slide 1. Slide 2. Slide 3. Chapter 29, Page 1 BCH 4054 Chapter 29 Lecture Notes 1 Chapter 29 DNA: Genetic Information, Recombination, and Mutation 2 DNA as the Genetic Material Griffith Experiment on pneumococcal transformation (Fig 29.1) Avery, MacLeod

More information

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology

More information

Gene Cloning and DNA Analysis: An Introduction

Gene Cloning and DNA Analysis: An Introduction Gene Cloning and DNA Analysis: An Introduction Brown, Terry A. ISBN-13: 9781405111218 Table of Contents PART 1 THE BASIC PRINCIPLES OF GENE CLONING AND DNA ANALYSIS. Chapter 1 Why Gene Cloning and DNA

More information

Biotechnology: DNA Technology & Genomics

Biotechnology: DNA Technology & Genomics Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 The BIG Questions How can we use our knowledge of DNA to: diagnose disease or defect? cure disease or defect? change/improve organisms? What

More information

Gene Cloning. Reference. T.A. Brown, Gene Cloning, Chapman and Hall. S.B. Primrose, Molecular Biotechnology, Blackwell

Gene Cloning. Reference. T.A. Brown, Gene Cloning, Chapman and Hall. S.B. Primrose, Molecular Biotechnology, Blackwell Gene Cloning 2004 Seungwook Kim Chem. & Bio. Eng. Reference T.A. Brown, Gene Cloning, Chapman and Hall S.B. Primrose, Molecular Biotechnology, Blackwell Why Gene Cloning is Important? A century ago, Gregor

More information

VIRUSES. Basic virus structure. Obligate intracellular parasites. Enveloped Viruses. Classification of Viruses. Viruses. Heyer 1

VIRUSES. Basic virus structure. Obligate intracellular parasites. Enveloped Viruses. Classification of Viruses. Viruses. Heyer 1 Viruses VIRUSES Viruses are small packages of genes Consist of protein coat around nucleic acids ( or RNA) Viruses measured in nanometers (nm). Require electron microscopy. Obligate intracellular parasites

More information

CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA

CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA INTRODUCTION DNA : DNA is deoxyribose nucleic acid. It is made up of a base consisting of sugar, phosphate and one nitrogen base.the

More information

Biotechnology and Recombinant DNA

Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA Recombinant DNA procedures - an overview Biotechnology: The use of microorganisms, cells, or cell components to make a product. Foods, antibiotics, vitamins, enzymes Recombinant

More information

AP BIOLOGY 2007 SCORING GUIDELINES

AP BIOLOGY 2007 SCORING GUIDELINES AP BIOLOGY 2007 SCORING GUIDELINES Question 4 A bacterial plasmid is 100 kb in length. The plasmid DNA was digested to completion with two restriction enzymes in three separate treatments: EcoRI, HaeIII,

More information

Module 3 Questions. 7. Chemotaxis is an example of signal transduction. Explain, with the use of diagrams.

Module 3 Questions. 7. Chemotaxis is an example of signal transduction. Explain, with the use of diagrams. Module 3 Questions Section 1. Essay and Short Answers. Use diagrams wherever possible 1. With the use of a diagram, provide an overview of the general regulation strategies available to a bacterial cell.

More information

4. DNA replication Pages: 979-984 Difficulty: 2 Ans: C Which one of the following statements about enzymes that interact with DNA is true?

4. DNA replication Pages: 979-984 Difficulty: 2 Ans: C Which one of the following statements about enzymes that interact with DNA is true? Chapter 25 DNA Metabolism Multiple Choice Questions 1. DNA replication Page: 977 Difficulty: 2 Ans: C The Meselson-Stahl experiment established that: A) DNA polymerase has a crucial role in DNA synthesis.

More information

11/19/2008. Gene analysis. Sequencing PCR. Northern-blot RT PCR. Western-blot Sequencing. in situ hybridization. Southern-blot

11/19/2008. Gene analysis. Sequencing PCR. Northern-blot RT PCR. Western-blot Sequencing. in situ hybridization. Southern-blot Recombinant technology Gene analysis Sequencing PCR RNA Northern-blot RT PCR Protein Western-blot Sequencing Southern-blot in situ hybridization in situ hybridization Function analysis Histochemical analysis

More information

Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION. Professor Bharat Patel Office: Science 2, 2.36 Email: b.patel@griffith.edu.

Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION. Professor Bharat Patel Office: Science 2, 2.36 Email: b.patel@griffith.edu. Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION Professor Bharat Patel Office: Science 2, 2.36 Email: b.patel@griffith.edu.au What is Gene Expression & Gene Regulation? 1. Gene Expression

More information

Microbiology / Active Lecture Questions Chapter 9 Biotechnology & Recombinant DNA 1 Chapter 9 Biotechnology & Recombinant DNA

Microbiology / Active Lecture Questions Chapter 9 Biotechnology & Recombinant DNA 1 Chapter 9 Biotechnology & Recombinant DNA 1 2 Restriction enzymes were first discovered with the observation that a. DNA is restricted to the nucleus. b. phage DNA is destroyed in a host cell. c. foreign DNA is kept out of a cell. d. foreign DNA

More information

The world of non-coding RNA. Espen Enerly

The world of non-coding RNA. Espen Enerly The world of non-coding RNA Espen Enerly ncrna in general Different groups Small RNAs Outline mirnas and sirnas Speculations Common for all ncrna Per def.: never translated Not spurious transcripts Always/often

More information

Genetics 301 Sample Final Examination Spring 2003

Genetics 301 Sample Final Examination Spring 2003 Genetics 301 Sample Final Examination Spring 2003 50 Multiple Choice Questions-(Choose the best answer) 1. A cross between two true breeding lines one with dark blue flowers and one with bright white flowers

More information

Compiled and/or written by Amy B. Vento and David R. Gillum

Compiled and/or written by Amy B. Vento and David R. Gillum Fact Sheet Describing Recombinant DNA and Elements Utilizing Recombinant DNA Such as Plasmids and Viral Vectors, and the Application of Recombinant DNA Techniques in Molecular Biology Compiled and/or written

More information

Bacterial Transformation and Plasmid Purification. Chapter 5: Background

Bacterial Transformation and Plasmid Purification. Chapter 5: Background Bacterial Transformation and Plasmid Purification Chapter 5: Background History of Transformation and Plasmids Bacterial methods of DNA transfer Transformation: when bacteria take up DNA from their environment

More information

Biotechnology Test Test

Biotechnology Test Test Log In Sign Up Biotechnology Test Test 15 Matching Questions Regenerate Test 1. Plasmid 2. PCR Process 3. humulin 4. pluripotent 5. polymerase chain reaction (PCR) a b Is much smaller than the human genome,

More information

DNA CLONING. DNA segment has been developed: polymerase chain reaction PCR. Viral DNA-s bacteriophage λ, filamentous bacteriophages

DNA CLONING. DNA segment has been developed: polymerase chain reaction PCR. Viral DNA-s bacteriophage λ, filamentous bacteriophages DNA CLONING - What is cloning? The isolation of discrete pieces of DNA from their host organism and their amplification through propagation in the same or a different host More recently an alternitive,

More information

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!! DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other

More information

What happened? Conjugation requires Plasmids. Lateral Gene Transfer #3: Conjugation. Chapter 8: Conjugation, Plasmids. Auxotrophic strains of E.

What happened? Conjugation requires Plasmids. Lateral Gene Transfer #3: Conjugation. Chapter 8: Conjugation, Plasmids. Auxotrophic strains of E. Chapter 8:, Plasmids Dr. Amy Rogers Office Hours: Mondays & Wednesdays 9-10 AM Sequoia 530 Lateral Gene Transfer #3: Transfer of DNA by direct contact between two living bacteria Contact is made, and DNA

More information

rbs/atg Transcription Translation

rbs/atg Transcription Translation (6) 1. Compare and contrast operon vs gene fusions: (a) Draw a simple diagram showing each type of fusion with transcription and translation start and stop sites the mrna transcript expected the expected

More information

Transmission of genetic variation: conjugation. Transmission of genetic variation: conjugation

Transmission of genetic variation: conjugation. Transmission of genetic variation: conjugation Transmission of genetic variation: conjugation Transmission of genetic variation: conjugation Bacterial Conjugation is genetic recombination in which there is a transfer of DNA from a living donor bacterium

More information

INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B

INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS

More information

Biological Sciences Initiative. Human Genome

Biological Sciences Initiative. Human Genome Biological Sciences Initiative HHMI Human Genome Introduction In 2000, researchers from around the world published a draft sequence of the entire genome. 20 labs from 6 countries worked on the sequence.

More information

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,

More information

European Medicines Agency

European Medicines Agency European Medicines Agency July 1996 CPMP/ICH/139/95 ICH Topic Q 5 B Quality of Biotechnological Products: Analysis of the Expression Construct in Cell Lines Used for Production of r-dna Derived Protein

More information

BACTERIAL GENETICS. Sridhar Rao P.N www.microrao.com

BACTERIAL GENETICS. Sridhar Rao P.N www.microrao.com BACTERIAL GENETICS Genetics is the study of genes including the structure of genetic materials, what information is stored in the genes, how the genes are expressed and how the genetic information is transferred.

More information

Genetic Engineering and Biotechnology

Genetic Engineering and Biotechnology 1 So, what is biotechnology?? The use of living organisms to carry out defined chemical processes for industrial or commercial application. The office of Technology Assessment of the U.S. Congress defines

More information

Expression and Purification of Recombinant Protein in bacteria and Yeast. Presented By: Puspa pandey, Mohit sachdeva & Ming yu

Expression and Purification of Recombinant Protein in bacteria and Yeast. Presented By: Puspa pandey, Mohit sachdeva & Ming yu Expression and Purification of Recombinant Protein in bacteria and Yeast Presented By: Puspa pandey, Mohit sachdeva & Ming yu DNA Vectors Molecular carriers which carry fragments of DNA into host cell.

More information

Bacterial Genetics Ch 18, 19

Bacterial Genetics Ch 18, 19 Bacterial Genetics Ch 18, 19 1 Genomics First genome sequenced = human mitochondra = 16, 159 base pairs 2 Mitochondrial DNA 37 genes 2 rrnas 22 trnas 13 polypeptides 3 Bacterial Genomics Chapter 10, page

More information

Bio 102 Practice Problems Recombinant DNA and Biotechnology

Bio 102 Practice Problems Recombinant DNA and Biotechnology Bio 102 Practice Problems Recombinant DNA and Biotechnology Multiple choice: Unless otherwise directed, circle the one best answer: 1. Which of the following DNA sequences could be the recognition site

More information

DNA & Protein Synthesis Exam

DNA & Protein Synthesis Exam DNA & Protein Synthesis Exam DO NOT WRITE ON EXAM EXAM # VER. B Multiple choice Directions: Answer the following questions based on the following diagram. (1pt. each) 5. The above nucleotide is purine

More information

GENE REGULATION. Teacher Packet

GENE REGULATION. Teacher Packet AP * BIOLOGY GENE REGULATION Teacher Packet AP* is a trademark of the College Entrance Examination Board. The College Entrance Examination Board was not involved in the production of this material. Pictures

More information

Professors: The topics in this course are divided into four sections:

Professors: The topics in this course are divided into four sections: Professors: Biochemistry, Cell & Molecular Biology II Course Description, Learning Objectives, and Grading Policy Note: This is the second in a series of three integrated courses in biochemistry, cell

More information

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes

More information

(ii) They are smaller than bacteria, and this can pass through bacteriological filter.

(ii) They are smaller than bacteria, and this can pass through bacteriological filter. Viruses Definition: Obligate intracellular parasite composed of: Nucleic acid - either DNA or RNA & Protein coat. Characteristics of viruses Viruses are the most primitive cellular and non-cytoplasmic

More information

The vast majority of RNA functions are concerned with protein synthesis.

The vast majority of RNA functions are concerned with protein synthesis. RNA Structure, Function, and Synthesis RNA RNA differs from DNA in both structural and functional respects. RNA has two major structural differences: each of the ribose rings contains a 2 -hydroxyl, and

More information

Sample Questions for Exam 3

Sample Questions for Exam 3 Sample Questions for Exam 3 1. All of the following occur during prometaphase of mitosis in animal cells except a. the centrioles move toward opposite poles. b. the nucleolus can no longer be seen. c.

More information

Gene Transcription in Prokaryotes

Gene Transcription in Prokaryotes Gene Transcription in Prokaryotes Operons: in prokaryotes, genes that encode protein participating in a common pathway are organized together. This group of genes, arranged in tandem, is called an OPERON.

More information

Central Dogma. Lecture 10. Discussing DNA replication. DNA Replication. DNA mutation and repair. Transcription

Central Dogma. Lecture 10. Discussing DNA replication. DNA Replication. DNA mutation and repair. Transcription Central Dogma transcription translation DNA RNA Protein replication Discussing DNA replication (Nucleus of eukaryote, cytoplasm of prokaryote) Recall Replication is semi-conservative and bidirectional

More information

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled Biology 101 Chapter 14 Name: Fill-in-the-Blanks Which base follows the next in a strand of DNA is referred to. as the base (1) Sequence. The region of DNA that calls for the assembly of specific amino

More information

Name Class Date. KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype. frameshift mutation

Name Class Date. KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype. frameshift mutation Unit 7 Study Guide Section 8.7: Mutations KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype. VOCABULARY mutation point mutation frameshift mutation mutagen MAIN IDEA: Some mutations

More information

Bacterial and Phage Genetic Switches

Bacterial and Phage Genetic Switches Bacterial and Phage Genetic Switches Prof. C. J. Dorman Department of Microbiology, Moyne Institute of Preventive Medicine, Trinity College, Dublin. Lecture 1 The genetic switch controlling the lytic-lysogen

More information

DNA (genetic information in genes) RNA (copies of genes) proteins (functional molecules) directionality along the backbone 5 (phosphate) to 3 (OH)

DNA (genetic information in genes) RNA (copies of genes) proteins (functional molecules) directionality along the backbone 5 (phosphate) to 3 (OH) DNA, RNA, replication, translation, and transcription Overview Recall the central dogma of biology: DNA (genetic information in genes) RNA (copies of genes) proteins (functional molecules) DNA structure

More information

Complex multicellular organisms are produced by cells that switch genes on and off during development.

Complex multicellular organisms are produced by cells that switch genes on and off during development. Home Control of Gene Expression Gene Regulation Is Necessary? By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection favoring

More information

AP Biology TEST #5 - Chapters 11-14, 16 - REVIEW SHEET

AP Biology TEST #5 - Chapters 11-14, 16 - REVIEW SHEET NAME: AP Biology TEST #5 - Chapters 11-14, 16 - REVIEW SHEET 1. Griffith's experiments showing the transformation of R strain pneumococcus bacteria to S strain pneumococcus bacteria in the presence of

More information

Single celled organisms

Single celled organisms Single celled organisms Single Celled Organisms Some organisms, unlike plants and animals, consist of only one cell. These organisms are said to be unicellular An amoeba is another name given to an organism

More information

CCR Biology - Chapter 9 Practice Test - Summer 2012

CCR Biology - Chapter 9 Practice Test - Summer 2012 Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible

More information

The Steps. 1. Transcription. 2. Transferal. 3. Translation

The Steps. 1. Transcription. 2. Transferal. 3. Translation Protein Synthesis Protein synthesis is simply the "making of proteins." Although the term itself is easy to understand, the multiple steps that a cell in a plant or animal must go through are not. In order

More information

Lecture 36: Basics of DNA Cloning-II

Lecture 36: Basics of DNA Cloning-II Lecture 36: Basics of DNA Cloning-II Note: Before starting this lecture students should have completed Lecture 35 Sequential steps involved in DNA cloning using plasmid DNA as vector: Molecular cloning

More information

The E. coli Insulin Factory

The E. coli Insulin Factory The E. coli Insulin Factory BACKGROUND Bacteria have not only their normal DNA, they also have pieces of circular DNA called plasmids. Plasmids are a wonderfully ally for biologists who desire to get bacteria

More information

Chapter 18 Regulation of Gene Expression

Chapter 18 Regulation of Gene Expression Chapter 18 Regulation of Gene Expression 18.1. Gene Regulation Is Necessary By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection

More information

HCS604.03 Exercise 1 Dr. Jones Spring 2005. Recombinant DNA (Molecular Cloning) exercise:

HCS604.03 Exercise 1 Dr. Jones Spring 2005. Recombinant DNA (Molecular Cloning) exercise: HCS604.03 Exercise 1 Dr. Jones Spring 2005 Recombinant DNA (Molecular Cloning) exercise: The purpose of this exercise is to learn techniques used to create recombinant DNA or clone genes. You will clone

More information

Genetics Test Biology I

Genetics Test Biology I Genetics Test Biology I Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Avery s experiments showed that bacteria are transformed by a. RNA. c. proteins.

More information

GenBank, Entrez, & FASTA

GenBank, Entrez, & FASTA GenBank, Entrez, & FASTA Nucleotide Sequence Databases First generation GenBank is a representative example started as sort of a museum to preserve knowledge of a sequence from first discovery great repositories,

More information

Gene mutation and molecular medicine Chapter 15

Gene mutation and molecular medicine Chapter 15 Gene mutation and molecular medicine Chapter 15 Lecture Objectives What Are Mutations? How Are DNA Molecules and Mutations Analyzed? How Do Defective Proteins Lead to Diseases? What DNA Changes Lead to

More information

Genetic engineering or Genetic manipulation (GM) technology. implies precision engineering being applied to DNA molecules

Genetic engineering or Genetic manipulation (GM) technology. implies precision engineering being applied to DNA molecules Gene Cloning Technology Also known as: Genetic engineering or Genetic manipulation (GM) technology implies precision engineering being applied to DNA molecules Recombinant DNA technology - implies that

More information

Overview of the Recombinant DNA technology- the process of subcloning a foreign gene into the plasmid vector puc19

Overview of the Recombinant DNA technology- the process of subcloning a foreign gene into the plasmid vector puc19 Health and Life Sciences Faculty Course Title: Biological and Forensic Science Module code: 216 BMS Module Title: Molecular Genetics Overview of the Recombinant DNA technology- the process of subcloning

More information

BCH401G Lecture 39 Andres

BCH401G Lecture 39 Andres BCH401G Lecture 39 Andres Lecture Summary: Ribosome: Understand its role in translation and differences between translation in prokaryotes and eukaryotes. Translation: Understand the chemistry of this

More information

Control of Gene Expression

Control of Gene Expression Home Gene Regulation Is Necessary? Control of Gene Expression By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection favoring

More information

Viruses. Viral components: Capsid. Chapter 10: Viruses. Viral components: Nucleic Acid. Viral components: Envelope

Viruses. Viral components: Capsid. Chapter 10: Viruses. Viral components: Nucleic Acid. Viral components: Envelope Viruses Chapter 10: Viruses Lecture Exam #3 Wednesday, November 22 nd (This lecture WILL be on Exam #3) Dr. Amy Rogers Office Hours: MW 9-10 AM Too small to see with a light microscope Visible with electron

More information

STANDARD 2 Students will demonstrate appropriate safety procedures and equipment use in the laboratory.

STANDARD 2 Students will demonstrate appropriate safety procedures and equipment use in the laboratory. BIOTECHNOLOGY Levels: 11-12 Units of Credit: 1.0 CIP Code: 51.1201 Prerequisite: Biology or Chemistry Skill Certificates: #708 COURSE DESCRIPTION is an exploratory course designed to create an awareness

More information

Site-directed mutagenesis

Site-directed mutagenesis Site-directed mutagenesis Adrian Suarez Covarrubias Modified from Sherry Mowbray s 1 Content DNA, PCR, oligonucleotides Reverse PCR mutagenesis Quick change mutagenesis Multi-change mutagenesis Oligonucleotide

More information

Introduction. Chapter 11 DNA replication, repair and recombination. Overview. DNA replication is essential for life. Short on DNA structure

Introduction. Chapter 11 DNA replication, repair and recombination. Overview. DNA replication is essential for life. Short on DNA structure Chapter 11 DNA replication, repair and recombination Overview Brief introduction DNA replication DNA repair DNA recombination DNA replication is essential for life Introduction Cells divide and make copies

More information

13.2 Ribosomes & Protein Synthesis

13.2 Ribosomes & Protein Synthesis 13.2 Ribosomes & Protein Synthesis Introduction: *A specific sequence of bases in DNA carries the directions for forming a polypeptide, a chain of amino acids (there are 20 different types of amino acid).

More information

13.4 Gene Regulation and Expression

13.4 Gene Regulation and Expression 13.4 Gene Regulation and Expression Lesson Objectives Describe gene regulation in prokaryotes. Explain how most eukaryotic genes are regulated. Relate gene regulation to development in multicellular organisms.

More information

Protein Expression. A Practical Approach J. HIGGIN S

Protein Expression. A Practical Approach J. HIGGIN S Protein Expression A Practical Approach S. J. HIGGIN S B. D. HAMES List of contributors Abbreviations xv Xvi i 1. Protein expression in mammalian cell s Marlies Otter-Nilsson and Tommy Nilsso n 1. Introduction

More information

Viruses and Prokaryotes

Viruses and Prokaryotes Viruses and Prokaryotes Cellular Basis of Life Q: Are all microbes that make us sick made of living cells? 20.1 What is a virus? WHAT I KNOW SAMPLE ANSWER: A virus is a tiny particle that can make people

More information

Gene Regulation -- The Lac Operon

Gene Regulation -- The Lac Operon Gene Regulation -- The Lac Operon Specific proteins are present in different tissues and some appear only at certain times during development. All cells of a higher organism have the full set of genes:

More information

Restriction Endonucleases

Restriction Endonucleases Nucleic Acids and Molecular Biology 14 Restriction Endonucleases Bearbeitet von Alfred Pingoud 1. Auflage 2004. Buch. xxvi, 443 S. Hardcover ISBN 978 3 540 20502 9 Format (B x L): 15,5 x 23,5 cm Gewicht:

More information

Chapter 6 DNA Replication

Chapter 6 DNA Replication Chapter 6 DNA Replication Each strand of the DNA double helix contains a sequence of nucleotides that is exactly complementary to the nucleotide sequence of its partner strand. Each strand can therefore

More information

Microbial Genetics (Chapter 8) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College. Eastern Campus

Microbial Genetics (Chapter 8) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College. Eastern Campus Microbial Genetics (Chapter 8) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology An Introduction

More information

Gene Switches Teacher Information

Gene Switches Teacher Information STO-143 Gene Switches Teacher Information Summary Kit contains How do bacteria turn on and turn off genes? Students model the action of the lac operon that regulates the expression of genes essential for

More information

1.5 page 3 DNA Replication S. Preston 1

1.5 page 3 DNA Replication S. Preston 1 AS Unit 1: Basic Biochemistry and Cell Organisation Name: Date: Topic 1.5 Nucleic Acids and their functions Page 3 l. DNA Replication 1. Go through PowerPoint 2. Read notes p2 and then watch the animation

More information

Common Course Topics Biology 1406: Cell and Molecular Biology

Common Course Topics Biology 1406: Cell and Molecular Biology Common Course Topics Biology 1406: Cell and Molecular Biology 1. Introduction to biology --the scientific study of organisms --properties of life --assumptions, methods and limitations of science --underlying

More information

Viruses, Archaea and Bacteria

Viruses, Archaea and Bacteria Viruses, Archaea and Bacteria Viruses and Viroids Features of Prokaryotes Bacterial Diversity Archaeal Diversity Viruses A virus is a noncellular infectious agent Ø Consists of a protein coat around a

More information

BioBoot Camp Genetics

BioBoot Camp Genetics BioBoot Camp Genetics BIO.B.1.2.1 Describe how the process of DNA replication results in the transmission and/or conservation of genetic information DNA Replication is the process of DNA being copied before

More information

somatic cell egg genotype gamete polar body phenotype homologous chromosome trait dominant autosome genetics recessive

somatic cell egg genotype gamete polar body phenotype homologous chromosome trait dominant autosome genetics recessive CHAPTER 6 MEIOSIS AND MENDEL Vocabulary Practice somatic cell egg genotype gamete polar body phenotype homologous chromosome trait dominant autosome genetics recessive CHAPTER 6 Meiosis and Mendel sex

More information

DNA Replication in Prokaryotes

DNA Replication in Prokaryotes OpenStax-CNX module: m44488 1 DNA Replication in Prokaryotes OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section,

More information

Introduction to Genome Annotation

Introduction to Genome Annotation Introduction to Genome Annotation AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT

More information