A polynucleotide consisting of the nucleotide sequence of SEQ ID NO:2.
|
|
|
- Dominick Sanders
- 7 years ago
- Views:
Transcription
1 Case A A polynucleotide consisting of the nucleotide sequence of SEQ ID NO:1 nucleotide sequence of SEQ ID NO:1 is one of the sequences which were analyzed using an automated DNA sequencer The sequences analyzed were only part (500bp) of the cdnas of the library The polynucleotide consisting of the nucleotide sequence of SEQ ID NO:1 is part of a structural gene, and it can be used as a probe in one of the steps to obtain the fulllength DNA However, there is no working example indicating that the full-length DNA was actually obtained, and there is no description of the function or biological activity of the DNA and its corresponding protein There is no known nucleotide sequence with high similarity to that of SEQ ID NO:1 Case B A polynucleotide consisting of the nucleotide sequence of SEQ ID NO:2 nucleotide sequence of SEQ ID NO:2 is one of the sequences which were analyzed using automated DNA sequencer The sequences analyzed were only part (500bp) of the cdnas of the library Each sequence obtained in this manner was automatically computer-searched in a DNA sequence database The peptide sequence deduced from the cdna sequence was also automatically computer-searched in an amino acid sequence database As a result of a similarity search, the polynucleotide consisting of the nucleotide sequence of SEQ ID NO:2 was assumed to be part of a structural gene encoding human protein X The polynucleotide demonstrated 95% homology to part of a structural gene encoding rat protein X, which has a known specific function and a biological activity (eg insulin) The corresponding amino acid sequence also showed 95% homology to part of the amino acid sequence of rat protein X The size of the full-length DNA encoding rat protein X is 2400bp This polynucleotide can be used as a probe in one of the steps to obtain the full-length DNA
2 However, there is no working example indicating that the full-length DNA is actually obtained The DNA sequence encoding rat protein X was known Case C A polynucleotide consisting of the nucleotide sequence of SEQ ID NO:3 nucleotide sequence of SEQ ID NO:3 is one of the sequences which were analyzed using an automated DNA sequencer Those analyzed sequences were only part (500bp) of the cdnas of the library As the amino acid sequence deduced from the nucleotide sequence of SEQ ID NO:3 has a potential site of glycosylation, the polynucleotide was assumed to be part of a structural gene encoding a glycoprotein This polynucleotide can be used as a probe in one of the steps to obtain the full-length DNA However, there is no working example indicating that the full-length DNA is actually obtained There is no known nucleotide sequence with high similarity to that of SEQ ID NO:3 Case D A polynucleotide consisting of the nucleotide sequence of SEQ ID NO:4 The polynucleotide is one of the 500bp long cdnas which were found in a cdna library derived from the hepatocyte of a patient with disease Y, but not found in those of normal persons expressed only in the patients' hepatocyte Therefore, the polynucleotide can be used as a probe to diagnose disease Y There is no known DNA that is unique in the patients with disease Y There is no known nucleotide sequence with high homology to that of SEQ ID NO:4 Case E
3 [Claim 2] A polynucleotide comprising the nucleotide sequence of SEQ ID NO:4 The polynucleotide is one of the 500bp long cdnas which were found in a cdna library derived from the hepatocyte of a patient with disease Y, but not found in those of normal persons expressed only in the patients' hepatocyte Therefore, the polynucleotide can be used as a probe to diagnose disease Y There is no known DNA that is unique in the patients with disease Y There is no known nucleotide sequence with high homology to that of SEQ ID NO:4 Case F [Claim 3] A structural gene comprising the nucleotide sequence of SEQ ID NO:2 nucleotide sequence of SEQ ID NO:2 is one of the sequences which were analyzed using automated DNA sequencer The sequences analyzed were only part (500bp) of the cdnas of the library Each sequence obtained in this manner was automatically computer-searched in a DNA sequence database The peptide sequence deduced from the cdna sequence was also automatically computer-searched in an amino acid sequence database As a result of a similarity search, the polynucleotide consisting of the nucleotide sequence of SEQ ID NO:2 was assumed to be part of a structural gene encoding human protein X The polynucleotide demonstrated 95% homology to part of a structural gene encoding rat protein X, which has a known specific function and a biological activity (eg insulin) The corresponding amino acid sequence also showed 95% homology to part of the amino acid sequence of rat protein X The size of the full-length DNA encoding rat protein X is 2400bp This polynucleotide can be used as a probe in one of the steps to obtain the full-length DNA However, there is no working example indicating that the full-length DNA is actually obtained The DNA sequence encoding rat protein X was known
4 Case G 1 A polynucleotide consisting of the nucleotide sequence of SEQ ID NO:1 2 A polynucleotide consisting of the nucleotide sequence of SEQ ID NO:2 3 A polynucleotide consisting of the nucleotide sequence of SEQ ID NO:3 4 A polynucleotide consisting of the nucleotide sequence of SEQ ID NO:4 5 A polynucleotide consisting of the nucleotide sequence of SEQ ID NO:5 6 A polynucleotide consisting of the nucleotide sequence of SEQ ID NO:6 7 A polynucleotide consisting of the nucleotide sequence of SEQ ID NO:7 8 A polynucleotide consisting of the nucleotide sequence of SEQ ID NO:8 9 A polynucleotide consisting of the nucleotide sequence of SEQ ID NO:9 10 A polynucleotide consisting of the nucleotide sequence of SEQ ID NO:10 11 A polynucleotide consisting of the nucleotide sequence of SEQ ID NO:11 A cdna library was constructed from human liver using oligo (dt) primers Each claimed polynucleotide is one of the sequences which were analyzed using an automated DNA sequencer The sequences analyzed were only part (500bp) of the cdnas of the library The polynucleotides consisting of the nucleotide sequence of SEQ ID NO:1- SEQ ID NO:11 are part of structural genes, and they can be used as probes in one of the steps to obtain the full-length DNAs However, there is no working example indicating that the full-length DNAs were actually obtained and there is no description of the function or biological activity of the DNAs and their corresponding proteins These polynucleotides are not highly homologous to each other Case H 1 A polynucleotide consisting of the nucleotide sequence of SEQ ID NO:1
5 2 A polynucleotide consisting of the nucleotide sequence of SEQ ID NO:2 11 A polynucleotide consisting of the nucleotide sequence of SEQ ID NO:11 A cdna library was constructed from human liver using an oligo (dt) primers Each claimed polynucleotide is one of the sequences which were analyzed using an automated DNA sequencer The sequences analyzed were only part (500bp) of the cdnas of the library As the amino acid sequences deduced from the nucleotide sequences of SEQ ID NO:1- SEQ ID NO:11 had potential sites of glycosylation, the polynucleotides were assumed to be part of structural genes encoding glycoproteins These polynucleotides can be used as probes in one of the steps to obtain the full-length DNAs However, there is no working example indicating that the full-length DNAs are actually obtained These polynucleotides are not highly homologous to each other Case I 1 A polynucleotide consisting of the nucleotide sequence of SEQ ID NO:1 2 A polynucleotide consisting of the nucleotide sequence of SEQ ID NO:2 11A polynucleotide consisting of the nucleotide sequence of SEQ ID NO:11 These polynucleotides are the 500bp long cdnas which were found in cdna library derived from hepatocyte of a patient with disease Y but not found in those of normal persons expressed only in the patients' hepatocyte Therefore, these polynucleotides can be used as probes to diagnose disease Y These polynucleotides are not highly homologous to each other There is no known DNA that is unique in the patients with disease Y
Introduction to Bioinformatics 3. DNA editing and contig assembly
Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 matthewb@ba.ars.usda.gov
How many of you have checked out the web site on protein-dna interactions?
How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss
CCR Biology - Chapter 9 Practice Test - Summer 2012
Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible
Biological Sequence Data Formats
Biological Sequence Data Formats Here we present three standard formats in which biological sequence data (DNA, RNA and protein) can be stored and presented. Raw Sequence: Data without description. FASTA
LabGenius. Technical design notes. The world s most advanced synthetic DNA libraries. hi@labgeni.us V1.5 NOV 15
LabGenius The world s most advanced synthetic DNA libraries Technical design notes hi@labgeni.us V1.5 NOV 15 Introduction OUR APPROACH LabGenius is a gene synthesis company focussed on the design and manufacture
Becker Muscular Dystrophy
Muscular Dystrophy A Case Study of Positional Cloning Described by Benjamin Duchenne (1868) X-linked recessive disease causing severe muscular degeneration. 100 % penetrance X d Y affected male Frequency
Worksheet - COMPARATIVE MAPPING 1
Worksheet - COMPARATIVE MAPPING 1 The arrangement of genes and other DNA markers is compared between species in Comparative genome mapping. As early as 1915, the geneticist J.B.S Haldane reported that
Transcription and Translation of DNA
Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes
Gene and Chromosome Mutation Worksheet (reference pgs. 239-240 in Modern Biology textbook)
Name Date Per Look at the diagrams, then answer the questions. Gene Mutations affect a single gene by changing its base sequence, resulting in an incorrect, or nonfunctional, protein being made. (a) A
Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
Introduction to Bioinformatics 2. DNA Sequence Retrieval and comparison
Introduction to Bioinformatics 2. DNA Sequence Retrieval and comparison Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 matthewb@ba.ars.usda.gov
STUDIES ON SEED STORAGE PROTEINS OF SOME ECONOMICALLY MINOR PLANTS
STUDIES ON SEED STORAGE PROTEINS OF SOME ECONOMICALLY MINOR PLANTS THESIS SUBMITTED FOR THE DEGREB OF DOCTOR OF PHILOSOPHY (SCIENCE) OF THE UNIVERSITY OF CALCUTTA 1996 NRISINHA DE, M.Sc DEPARTMENT OF BIOCHEMISTRY
Activity 7.21 Transcription factors
Purpose To consolidate understanding of protein synthesis. To explain the role of transcription factors and hormones in switching genes on and off. Play the transcription initiation complex game Regulation
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS
Molecular Genetics. RNA, Transcription, & Protein Synthesis
Molecular Genetics RNA, Transcription, & Protein Synthesis Section 1 RNA AND TRANSCRIPTION Objectives Describe the primary functions of RNA Identify how RNA differs from DNA Describe the structure and
Biotechnology: DNA Technology & Genomics
Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 The BIG Questions How can we use our knowledge of DNA to: diagnose disease or defect? cure disease or defect? change/improve organisms? What
Annex 6: Nucleotide Sequence Information System BEETLE. Biological and Ecological Evaluation towards Long-Term Effects
Annex 6: Nucleotide Sequence Information System BEETLE Biological and Ecological Evaluation towards Long-Term Effects Long-term effects of genetically modified (GM) crops on health, biodiversity and the
European Medicines Agency
European Medicines Agency July 1996 CPMP/ICH/139/95 ICH Topic Q 5 B Quality of Biotechnological Products: Analysis of the Expression Construct in Cell Lines Used for Production of r-dna Derived Protein
Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS)
Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) A typical RNA Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,
Genetics Test Biology I
Genetics Test Biology I Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Avery s experiments showed that bacteria are transformed by a. RNA. c. proteins.
Ms. Campbell Protein Synthesis Practice Questions Regents L.E.
Name Student # Ms. Campbell Protein Synthesis Practice Questions Regents L.E. 1. A sequence of three nitrogenous bases in a messenger-rna molecule is known as a 1) codon 2) gene 3) polypeptide 4) nucleotide
Regents Biology REGENTS REVIEW: PROTEIN SYNTHESIS
Period Date REGENTS REVIEW: PROTEIN SYNTHESIS 1. The diagram at the right represents a portion of a type of organic molecule present in the cells of organisms. What will most likely happen if there is
WHEREAS the need exists to streamline the procedures for processing applications with a view to enhancing efficiency and ensuring quality,
FEDERAL PUBLIC SERVICE MINISTRY OF DEVELOPMENT, INDUSTRY AND FOREIGN TRADE NATIONAL INSTITUTE OF INDUSTRIAL PROPERTY PRESIDENCY March 12, 2015 RESOLUTION N. 144/2015 SUBJECT MATTER: Introduce the Guidelines
PrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID papillary renal cell carcinoma (translocation-associated) PRCC Human This gene
New Technologies for Sensitive, Low-Input RNA-Seq. Clontech Laboratories, Inc.
New Technologies for Sensitive, Low-Input RNA-Seq Clontech Laboratories, Inc. Outline Introduction Single-Cell-Capable mrna-seq Using SMART Technology SMARTer Ultra Low RNA Kit for the Fluidigm C 1 System
Bioinformatics Grid - Enabled Tools For Biologists.
Bioinformatics Grid - Enabled Tools For Biologists. What is Grid-Enabled Tools (GET)? As number of data from the genomics and proteomics experiment increases. Problems arise for the current sequence analysis
Mitochondrial DNA Analysis
Mitochondrial DNA Analysis Lineage Markers Lineage markers are passed down from generation to generation without changing Except for rare mutation events They can help determine the lineage (family tree)
A Multiple DNA Sequence Translation Tool Incorporating Web Robot and Intelligent Recommendation Techniques
Proceedings of the 2007 WSEAS International Conference on Computer Engineering and Applications, Gold Coast, Australia, January 17-19, 2007 402 A Multiple DNA Sequence Translation Tool Incorporating Web
Chapter 6 DNA Replication
Chapter 6 DNA Replication Each strand of the DNA double helix contains a sequence of nucleotides that is exactly complementary to the nucleotide sequence of its partner strand. Each strand can therefore
Replication Study Guide
Replication Study Guide This study guide is a written version of the material you have seen presented in the replication unit. Self-reproduction is a function of life that human-engineered systems have
First Strand cdna Synthesis
380PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name First Strand cdna Synthesis (Cat. # 786 812) think proteins! think G-Biosciences
Translation Study Guide
Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to
Genomes and SNPs in Malaria and Sickle Cell Anemia
Genomes and SNPs in Malaria and Sickle Cell Anemia Introduction to Genome Browsing with Ensembl Ensembl The vast amount of information in biological databases today demands a way of organising and accessing
RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison
RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the
The National Institute of Genomic Medicine (INMEGEN) was
Genome is...... the complete set of genetic information contained within all of the chromosomes of an organism. It defines the particular phenotype of an individual. What is Genomics? The study of the
Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology
Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,
Lecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides
Lecture Series 7 From DNA to Protein: Genotype to Phenotype Reading Assignments Read Chapter 7 From DNA to Protein A. Genes and the Synthesis of Polypeptides Genes are made up of DNA and are expressed
Chapter 3. Protein Structure and Function
Chapter 3 Protein Structure and Function Broad functional classes So Proteins have structure and function... Fine! -Why do we care to know more???? Understanding functional architechture gives us POWER
IIID 14. Biotechnology in Fish Disease Diagnostics: Application of the Polymerase Chain Reaction (PCR)
IIID 14. Biotechnology in Fish Disease Diagnostics: Application of the Polymerase Chain Reaction (PCR) Background Infectious diseases caused by pathogenic organisms such as bacteria, viruses, protozoa,
MAKING AN EVOLUTIONARY TREE
Student manual MAKING AN EVOLUTIONARY TREE THEORY The relationship between different species can be derived from different information sources. The connection between species may turn out by similarities
GenBank, Entrez, & FASTA
GenBank, Entrez, & FASTA Nucleotide Sequence Databases First generation GenBank is a representative example started as sort of a museum to preserve knowledge of a sequence from first discovery great repositories,
HUMAN GENETIC TESTING PATENTS : ELIGIBILITY AND ENFORCEMENT
HUMAN GENETIC TESTING PATENTS : ELIGIBILITY AND ENFORCEMENT FRENCH APPROACH DENISE HIRSCH HEAD OF IP THE ENVIRONNENT Patentability of living organism was a public debate in France focusing on ethical issues
From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains
Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes
Proteins. Proteins. Amino Acids. Most diverse and most important molecule in. Functions: Functions (cont d)
Proteins Proteins Most diverse and most important molecule in living i organisms Functions: 1. Structural (keratin in hair, collagen in ligaments) 2. Storage (casein in mother s milk) 3. Transport (HAEMOGLOBIN!)
Oligonucleotide Stability Study
Oligonucleotide Stability Study IDT is performing a long term study of oligo stability. The study has been ongoing for 2 years and has tested oligo stability under various conditions. An overview of the
MUTATION, DNA REPAIR AND CANCER
MUTATION, DNA REPAIR AND CANCER 1 Mutation A heritable change in the genetic material Essential to the continuity of life Source of variation for natural selection New mutations are more likely to be harmful
Bioinformatics Resources at a Glance
Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences
13.2 Ribosomes & Protein Synthesis
13.2 Ribosomes & Protein Synthesis Introduction: *A specific sequence of bases in DNA carries the directions for forming a polypeptide, a chain of amino acids (there are 20 different types of amino acid).
Hidden Markov Models in Bioinformatics. By Máthé Zoltán Kőrösi Zoltán 2006
Hidden Markov Models in Bioinformatics By Máthé Zoltán Kőrösi Zoltán 2006 Outline Markov Chain HMM (Hidden Markov Model) Hidden Markov Models in Bioinformatics Gene Finding Gene Finding Model Viterbi algorithm
Proteins and Nucleic Acids
Proteins and Nucleic Acids Chapter 5 Macromolecules: Proteins Proteins Most structurally & functionally diverse group of biomolecules. : o Involved in almost everything o Enzymes o Structure (keratin,
Recombinant DNA Unit Exam
Recombinant DNA Unit Exam Question 1 Restriction enzymes are extensively used in molecular biology. Below are the recognition sites of two of these enzymes, BamHI and BclI. a) BamHI, cleaves after the
The Steps. 1. Transcription. 2. Transferal. 3. Translation
Protein Synthesis Protein synthesis is simply the "making of proteins." Although the term itself is easy to understand, the multiple steps that a cell in a plant or animal must go through are not. In order
Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research. March 17, 2011 Rendez-Vous Séquençage
Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research March 17, 2011 Rendez-Vous Séquençage Presentation Overview Core Technology Review Sequence Enrichment Application
Lecture 26: Overview of deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) structure
Lecture 26: Overview of deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) structure Nucleic acids play an important role in the storage and expression of genetic information. They are divided into
DNA Sequence formats
DNA Sequence formats [Plain] [EMBL] [FASTA] [GCG] [GenBank] [IG] [IUPAC] [How Genomatix represents sequence annotation] Plain sequence format A sequence in plain format may contain only IUPAC characters
Module 10: Bioinformatics
Module 10: Bioinformatics 1.) Goal: To understand the general approaches for basic in silico (computer) analysis of DNA- and protein sequences. We are going to discuss sequence formatting required prior
SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE
AP Biology Date SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE LEARNING OBJECTIVES Students will gain an appreciation of the physical effects of sickle cell anemia, its prevalence in the population,
Gene Models & Bed format: What they represent.
GeneModels&Bedformat:Whattheyrepresent. Gene models are hypotheses about the structure of transcripts produced by a gene. Like all models, they may be correct, partly correct, or entirely wrong. Typically,
RNA & Protein Synthesis
RNA & Protein Synthesis Genes send messages to cellular machinery RNA Plays a major role in process Process has three phases (Genetic) Transcription (Genetic) Translation Protein Synthesis RNA Synthesis
a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled
Biology 101 Chapter 14 Name: Fill-in-the-Blanks Which base follows the next in a strand of DNA is referred to. as the base (1) Sequence. The region of DNA that calls for the assembly of specific amino
DNA Insertions and Deletions in the Human Genome. Philipp W. Messer
DNA Insertions and Deletions in the Human Genome Philipp W. Messer Genetic Variation CGACAATAGCGCTCTTACTACGTGTATCG : : CGACAATGGCGCT---ACTACGTGCATCG 1. Nucleotide mutations 2. Genomic rearrangements 3.
Forensic DNA Testing Terminology
Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.
PRODUCTION AND QUALITY CONTROL OF MEDICINAL PRODUCTS DERIVED BY RECOMBINANT DNA TECHNOLOGY
PRODUCTION AND QUALITY CONTROL OF MEDICINAL PRODUCTS DERIVED BY RECOMBINANT DNA TECHNOLOGY Guideline Title Production and Quality Control of Medicinal Products derived by recombinant DNA Technology Legislative
From DNA to Protein
Nucleus Control center of the cell contains the genetic library encoded in the sequences of nucleotides in molecules of DNA code for the amino acid sequences of all proteins determines which specific proteins
Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in
DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results
2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.
1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence
Protein Synthesis How Genes Become Constituent Molecules
Protein Synthesis Protein Synthesis How Genes Become Constituent Molecules Mendel and The Idea of Gene What is a Chromosome? A chromosome is a molecule of DNA 50% 50% 1. True 2. False True False Protein
Concluding lesson. Student manual. What kind of protein are you? (Basic)
Concluding lesson Student manual What kind of protein are you? (Basic) Part 1 The hereditary material of an organism is stored in a coded way on the DNA. This code consists of four different nucleotides:
Basic Concepts of DNA, Proteins, Genes and Genomes
Basic Concepts of DNA, Proteins, Genes and Genomes Kun-Mao Chao 1,2,3 1 Graduate Institute of Biomedical Electronics and Bioinformatics 2 Department of Computer Science and Information Engineering 3 Graduate
1.Gene Synthesis. 2.Peptide & Phospho-P. Assembly PCR. Design & Synthesis. Advantages. Specifications. Advantages
1.Gene Synthesis Assembly PCR Looking for a cdna for your research but could not fish out the gene through traditional cloning methods or a supplier? Abnova provides a gene synthesis service via assembly
Introduction to Genome Annotation
Introduction to Genome Annotation AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT
Sequence Formats and Sequence Database Searches. Gloria Rendon SC11 Education June, 2011
Sequence Formats and Sequence Database Searches Gloria Rendon SC11 Education June, 2011 Sequence A is the primary structure of a biological molecule. It is a chain of residues that form a precise linear
Human Genome and Human Genome Project. Louxin Zhang
Human Genome and Human Genome Project Louxin Zhang A Primer to Genomics Cells are the fundamental working units of every living systems. DNA is made of 4 nucleotide bases. The DNA sequence is the particular
A novel pig gene, CPNE1, differentially expressed in the muscle tissues from Wujin pigs and Large White pigs*
Animal Science Papers and Reports vol. 30 (2012) no. 2, 131-138 Institute of Genetics and Animal Breeding, Jastrzębiec, Poland A novel pig gene, CPNE1, differentially expressed in the muscle tissues from
The Human Genome Project
The Human Genome Project Brief History of the Human Genome Project Physical Chromosome Maps Genetic (or Linkage) Maps DNA Markers Sequencing and Annotating Genomic DNA What Have We learned from the HGP?
PrimePCR Assay Validation Report
Gene Information Gene Name sorbin and SH3 domain containing 2 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID SORBS2 Human Arg and c-abl represent the mammalian
Algorithms in Computational Biology (236522) spring 2007 Lecture #1
Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office
MGC premier full length cdna and ORF clones
MGC premier full length cdna and ORF clones TCH1003, TCM1004, TCR1005, TCB1006, TCL1007, TCT1008, TCZ1009, TOH6003, TOM6004, TOZ6009, TCHS1003, TCMS1004, TCRS1005, TCBS1006, TCLS1007, TCTS1008 MGC premier
Expression and Purification of Recombinant Protein in bacteria and Yeast. Presented By: Puspa pandey, Mohit sachdeva & Ming yu
Expression and Purification of Recombinant Protein in bacteria and Yeast Presented By: Puspa pandey, Mohit sachdeva & Ming yu DNA Vectors Molecular carriers which carry fragments of DNA into host cell.
'LVFXVVLRQ $UUD\HGF'1$H[SUHVVLRQOLEUDULHV 5RERWWHFKQRORJ\DQGDUUD\HGOLEUDULHV
Discussion 74 'LVFXVVLRQ This study describes arrayed cdna libraries as a source of clonally expressed recombinant proteins which can be directly linked to clones characterised and identified by DNA hybridisation
KMS-Specialist & Customized Biosimilar Service
KMS-Specialist & Customized Biosimilar Service 1. Polyclonal Antibody Development Service KMS offering a variety of Polyclonal Antibody Services to fit your research and production needs. we develop polyclonal
1. Molecular computation uses molecules to represent information and molecular processes to implement information processing.
Chapter IV Molecular Computation These lecture notes are exclusively for the use of students in Prof. MacLennan s Unconventional Computation course. c 2013, B. J. MacLennan, EECS, University of Tennessee,
Question 4 /29 points. Total /100 points
MIT Department of Biology 7.28, Spring 2005 - Molecular Biology 7.28 Spring 2005 Exam Three Question 1 Question 2 Question 3 /30 points /20 points /21 points Question 4 /29 points Total /100 points 1 Question
HENIPAVIRUS ANTIBODY ESCAPE SEQUENCING REPORT
HENIPAVIRUS ANTIBODY ESCAPE SEQUENCING REPORT Kimberly Bishop Lilly 1,2, Truong Luu 1,2, Regina Cer 1,2, and LT Vishwesh Mokashi 1 1 Naval Medical Research Center, NMRC Frederick, 8400 Research Plaza,
Specific problems. The genetic code. The genetic code. Adaptor molecules match amino acids to mrna codons
Tutorial II Gene expression: mrna translation and protein synthesis Piergiorgio Percipalle, PhD Program Control of gene transcription and RNA processing mrna translation and protein synthesis KAROLINSKA
BUDAPEST: Bioinformatics Utility for Data Analysis of Proteomics using ESTs
BUDAPEST: Bioinformatics Utility for Data Analysis of Proteomics using ESTs Richard J. Edwards 2008. Contents 1. Introduction... 2 1.1. Version...2 1.2. Using this Manual...2 1.3. Why use BUDAPEST?...2
Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company
Genetic engineering: humans Gene replacement therapy or gene therapy Many technical and ethical issues implications for gene pool for germ-line gene therapy what traits constitute disease rather than just
A disaccharide is formed when a dehydration reaction joins two monosaccharides. This covalent bond is called a glycosidic linkage.
CH 5 Structure & Function of Large Molecules: Macromolecules Molecules of Life All living things are made up of four classes of large biological molecules: carbohydrates, lipids, proteins, and nucleic
DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!
DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other
Searching Nucleotide Databases
Searching Nucleotide Databases 1 When we search a nucleic acid databases, Mascot always performs a 6 frame translation on the fly. That is, 3 reading frames from the forward strand and 3 reading frames
A Primer of Genome Science THIRD
A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:
Name: Date: Period: DNA Unit: DNA Webquest
Name: Date: Period: DNA Unit: DNA Webquest Part 1 History, DNA Structure, DNA Replication DNA History http://www.dnaftb.org/dnaftb/1/concept/index.html Read the text and answer the following questions.
Innovations in Molecular Epidemiology
Innovations in Molecular Epidemiology Molecular Epidemiology Measure current rates of active transmission Determine whether recurrent tuberculosis is attributable to exogenous reinfection Determine whether
Biochemistry of Cells
Biochemistry of Cells 1 Carbon-based Molecules Although a cell is mostly water, the rest of the cell consists mostly of carbon-based molecules Organic chemistry is the study of carbon compounds Carbon
BioBoot Camp Genetics
BioBoot Camp Genetics BIO.B.1.2.1 Describe how the process of DNA replication results in the transmission and/or conservation of genetic information DNA Replication is the process of DNA being copied before
Lecture Outline. Introduction to Databases. Introduction. Data Formats Sample databases How to text search databases. Shifra Ben-Dor Irit Orr
Introduction to Databases Shifra Ben-Dor Irit Orr Lecture Outline Introduction Data and Database types Database components Data Formats Sample databases How to text search databases What units of information
Chapter 3 Molecules of Cells
Bio 100 Molecules of cells 1 Chapter 3 Molecules of Cells Compounds containing carbon are called organic compounds Molecules such as methane that are only composed of carbon and hydrogen are called hydrocarbons
Focusing on results not data comprehensive data analysis for targeted next generation sequencing
Focusing on results not data comprehensive data analysis for targeted next generation sequencing Daniel Swan, Jolyon Holdstock, Angela Matchan, Richard Stark, John Shovelton, Duarte Mohla and Simon Hughes
ID of alternative translational initiation events. Description of gene function Reference of NCBI database access and relative literatures
Data resource: In this database, 650 alternatively translated variants assigned to a total of 300 genes are contained. These database records of alternative translational initiation have been collected