Transcription: Writing again Translation: Changing languages

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "Transcription: Writing again Translation: Changing languages"

Transcription

1 How? 1 Why? Transcription: Writing again Translation: Changing languages

2 2 Today we ll go from here... Text To here

3 Off to see the wizard... 3 Sending messages out from DNA DNA replication both strands => new DNA => new cell Transcription 1 strand => new RNA => new protein

4 Transcription: seeing it 4

5 5 Amino acids From 4 letters of storage/information to 20 letters of action!!

6 20 toys 6 EVERY one has a blue part. Chem name? EVERY one has a red part. Chem name? Thus these are all...? How many are there?

7 aadancer 7 Why do nucleotides look like nucleotides, while amino acids look like amino acids? Remember the handshakes What are amino acids for?

8 Different tools; different jobs You & partner have an amino acid; which is it? (StructViewer or homepage => left column big twenty amino acids) 8 In what ways are all bases identical? Different? In what ways are all amino acids identical? Different? Which set is more diverse in terms of feel? Which more diverse in terms of shape? Which would allow you to build more diverse shapes & surfaces?

9 Mutation--not always 9 bad While the comparison is often made, proteins are not sentences An amino acid is a collection of properties; changing from one to another changes a region of the protein by (little/some/ a lot/completely) It s an exaggeration, but think of amino acids more like different vacuum cleaner nozzles

10 How does a codon mean 10 an amino acid?

11 11 Walking the walk How bio machines translate the language of nucleotides into an amino acid string

12 Biology: because it has to work like that way 12 Von Neumann argued that... [self-reproducing] machines would need to store separately the information needed to make the machine and would need to have a mechanism to interpret that information a tape and a tape reader. In effect, he abstractly described the gene, the ribosome, and the messenger. --Matt Ridley in Francis Crick, discoverer of the genetic code

13 Types of bonds 13 VELCRO: a bond that can be cheerfully broken/re-made during lab Duct tape: same at the molecular level, but at the 181L student level, breaking such a bond gets you a zero on this week s quiz

14 Blinding you with Science (jargon) " RNA Polymerase: joins RNA links into a chain " mrna: messenger RNA; RNA string copied ( transcribed ) from DNA " trna: transfer RNA; one of many RNA molecules that carry specific amino acids " ribosome: giant machine (>200 proteins, 4 RNAs (2 > 1000 nucleotides) that oversees the reading of the mrna and the creation of polypeptide " aminoacyl trna synthetase: protein machine adds amino acid to trnas " Termination factor: reads UAA etc., => ribosome looses the peptide & falls apart

15 DNA template strand 15 5 CTTAAATCCGAATGCCCATG 3

16 DNA template strand 16 (alternate version) 5 CTTAAATCCGAATGCCCATG 3 5 end is pointy/spiky 3 end is soft/furry

17 Roles--for single mrna 17 4 trna (1-2 people) 5 end is pointy/spiky 3 end is soft/furry 4 pairs to be synthetases 1 small ribosomal subunit x 2 1 large ribosomal subunit x 2 2 to be (RNA polymerase & the RNA it makes ) 1 termination factor (1-2 people)

18 Roles--for TWO mrna 18 5 end is pointy/spiky 3 end is soft/furry 4 trna 4 synthetases 1 ribosome 1-2 to be (RNA polymerase & the RNA it makes ) 1 termination factor

19 Learning your lines 19 Handout: Each group find questions related to their role; answer them Lab manual, textbook, internet OK as sources Meet your blocks-- 5 is the end that sticks to hair, socks, shirts 5 end is pointy/spiky 3 end is soft/furry

20 Special powers 20 Recall that ribosome assembly is the result of methionine trna finding a match on mrna in presence of small ribosome subunit Only methionine trna (it will know itself once crowned by the synthetase that hands out met) can team with small ribosomal subunit & join with the AUG!

21 21 Choreographing translation A play of many parts, many players, no brains

22 Going with the flow 22 mrna at the central bench ribosome assembles around it synthetases at bench corners (or diffuse opp. direction vs. trna) trnas will diffuse by following a path through the room When any event first happens*, action stops, molecules involved will announce, explain Go until a protein happens *This includes non-events (rejections, etc.)

23 Walk-through with 1 trna 23 Everybody watches visits to synthetase, ribosome In the real world, everything is happening all the time; all is happenstance

24 Who knows the code? 24 What happens if a trna carries the wrong amino acid? What happens if the mrna contains a copy error relative to DNA? What happens if a trna has a mutated anticodon

25

26 26 Meet your semesterlong interest

27 27! Semester Project! Pineapple chunks in milk.! What do you observe?! What may be the explanation behind this observation?! Is a protein responsible? Maybe an enzyme?!

28 28 Homework StructViewer*--amino acid look & feel** Begin thinking about your project Assessor: mutation & translation *As will always be the case in this course, no tricks; focus on the primary idea(s) ** SurfaceViewer link from Software page may help Ch. 3 reading about the immune system is just for fun

Opening Activity: Where in the cell does transcription take place? Latin Root Word: Review of Old Information: Transcription Video New Information:

Opening Activity: Where in the cell does transcription take place? Latin Root Word: Review of Old Information: Transcription Video New Information: Section 1.4 Name: Opening Activity: Where in the cell does transcription take place? Latin Root Word: Review of Old Information: Transcription Video New Information: Protein Synthesis: pages 193-196 As

More information

Chapter 10: Protein Synthesis. Biology

Chapter 10: Protein Synthesis. Biology Chapter 10: Protein Synthesis Biology Let s Review What are proteins? Chains of amino acids Some are enzymes Some are structural components of cells and tissues More Review What are ribosomes? Cell structures

More information

OUTCOMES. PROTEIN SYNTHESIS IB Biology Core Topic 3.5 Transcription and Translation OVERVIEW ANIMATION CONTEXT RIBONUCLEIC ACID (RNA)

OUTCOMES. PROTEIN SYNTHESIS IB Biology Core Topic 3.5 Transcription and Translation OVERVIEW ANIMATION CONTEXT RIBONUCLEIC ACID (RNA) OUTCOMES PROTEIN SYNTHESIS IB Biology Core Topic 3.5 Transcription and Translation 3.5.1 Compare the structure of RNA and DNA. 3.5.2 Outline DNA transcription in terms of the formation of an RNA strand

More information

Molecular Genetics. RNA, Transcription, & Protein Synthesis

Molecular Genetics. RNA, Transcription, & Protein Synthesis Molecular Genetics RNA, Transcription, & Protein Synthesis Section 1 RNA AND TRANSCRIPTION Objectives Describe the primary functions of RNA Identify how RNA differs from DNA Describe the structure and

More information

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes

More information

Tuesday 11/13. Agenda 1.Warm Up (Stamp HW) 2.Protein Synthesis Notes 3.HW Time (Transcription/ Translation Worksheet)

Tuesday 11/13. Agenda 1.Warm Up (Stamp HW) 2.Protein Synthesis Notes 3.HW Time (Transcription/ Translation Worksheet) Tuesday 11/13 Warm Up 1.What are the three parts of a nucleotide? How do two nucleotides link together 2.What binds the two strands of DNA together? Be Specific 3.What are the three main enzymes of DNA

More information

Transcription Animations

Transcription Animations Transcription Animations Name: Lew Ports Biology Place http://www.lewport.wnyric.org/jwanamaker/animations/protein%20synthesis%20-%20long.html Protein is the making of proteins from the information found

More information

13.2 Ribosomes & Protein Synthesis

13.2 Ribosomes & Protein Synthesis 13.2 Ribosomes & Protein Synthesis Introduction: *A specific sequence of bases in DNA carries the directions for forming a polypeptide, a chain of amino acids (there are 20 different types of amino acid).

More information

Figure During transcription, RNA nucleotides base-pair one by one with DNA

Figure During transcription, RNA nucleotides base-pair one by one with DNA Objectives Describe the process of DNA transcription. Explain how an RNA message is edited. Describe how RNA is translated to a protein. Summarize protein synthesis. Key Terms messenger RNA (mrna) RNA

More information

Translation. The process of converting the mrna base sequence into amino acid chains or proteins; occurs in the cytoplasm of the cell on ribosomes

Translation. The process of converting the mrna base sequence into amino acid chains or proteins; occurs in the cytoplasm of the cell on ribosomes The process of converting the mrna base sequence into amino acid chains or proteins; occurs in the cytoplasm of the cell on ribosomes The process of converting the mrna base sequence into amino acid chains

More information

Genetics Notes C. Molecular Genetics

Genetics Notes C. Molecular Genetics Genetics Notes C Molecular Genetics Vocabulary central dogma of molecular biology Chargaff's rules messenger RNA (mrna) ribosomal RNA (rrna) transfer RNA (trna) Your DNA, or deoxyribonucleic acid, contains

More information

RNA & Protein Synthesis

RNA & Protein Synthesis RNA & Protein Synthesis Genes send messages to cellular machinery RNA Plays a major role in process Process has three phases (Genetic) Transcription (Genetic) Translation Protein Synthesis RNA Synthesis

More information

Transcription and Translation of DNA

Transcription and Translation of DNA Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes

More information

Translation Study Guide

Translation Study Guide Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to

More information

Genetics. Instructor: Dr. Jihad Abdallah Topic 5: Translation of RNA (Protein synthesis)

Genetics. Instructor: Dr. Jihad Abdallah Topic 5: Translation of RNA (Protein synthesis) Genetics Instructor: Dr. Jihad Abdallah Topic 5: Translation of RNA (Protein synthesis) 1 Central dogma of genetics DNA In the nucleus Transcription mrna Translation In the cytoplasm Protein 2 3 The primary

More information

The Steps. 1. Transcription. 2. Transferal. 3. Translation

The Steps. 1. Transcription. 2. Transferal. 3. Translation Protein Synthesis Protein synthesis is simply the "making of proteins." Although the term itself is easy to understand, the multiple steps that a cell in a plant or animal must go through are not. In order

More information

From DNA to Protein! (Transcription & Translation)! I. An Overview

From DNA to Protein! (Transcription & Translation)! I. An Overview Protein Synthesis! From DNA to Protein! (Transcription & Translation)! I. An Overview A. Certain sequences of nucleotides in DNA [called genes], can be expressed/used as a code to determine the sequence

More information

Transcription recap What is translation? Short Video Activity. Initiation Elongation Termination. Short Quiz on Thursday! 6.1 and 6.

Transcription recap What is translation? Short Video Activity. Initiation Elongation Termination. Short Quiz on Thursday! 6.1 and 6. Protein Synthesis Transcription recap What is translation? Initiation Elongation Termination Short Video Activity Short Quiz on Thursday! 6.1 and 6.2 1. RNA polymerase attaches to promoter region 2. Unwinds/unzips

More information

Transcription & Translation. Part of Protein Synthesis

Transcription & Translation. Part of Protein Synthesis Transcription & Translation Part of Protein Synthesis Three processes Initiation Transcription Elongation Termination Initiation The RNA polymerase binds to the DNA molecule upstream of the gene at the

More information

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!! DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other

More information

Transcription Study Guide

Transcription Study Guide Transcription Study Guide This study guide is a written version of the material you have seen presented in the transcription unit. The cell s DNA contains the instructions for carrying out the work of

More information

Section 12 3 RNA and Protein Synthesis

Section 12 3 RNA and Protein Synthesis Name Class Date Section 12 3 RNA and Protein Synthesis (pages 300 306) Key Concepts What are the three main types of RNA? What is transcription? What is translation? The Structure of RNA (page 300) 1.

More information

Ch. 12: DNA and RNA 12.1 DNA Chromosomes and DNA Replication

Ch. 12: DNA and RNA 12.1 DNA Chromosomes and DNA Replication Ch. 12: DNA and RNA 12.1 DNA A. To understand genetics, biologists had to learn the chemical makeup of the gene Genes are made of DNA DNA stores and transmits the genetic information from one generation

More information

RNA and Protein Synthesis Biology Mr. Hines

RNA and Protein Synthesis Biology Mr. Hines RNA and Protein Synthesis 12.3 Biology Mr. Hines Now we know how DNA (genes) are copied. But how is it used to make a living organism? Most of the structures inside of a cell are made of protein - so we

More information

Biology 3 Transcription, Translation, and Mutations

Biology 3 Transcription, Translation, and Mutations Biology 3 Transcription, Translation, and Mutations Dr. Terence Lee Overview 1. DNA and RNA structure 2. DNA replication 3. Transcription makes RNA 4. Translation makes protein James Watson, Francis Crick,

More information

The Genetic Code There are 20 amino acids, but there are only four nucleotide bases in DNA. How many nucleotides correspond to an amino acid?

The Genetic Code There are 20 amino acids, but there are only four nucleotide bases in DNA. How many nucleotides correspond to an amino acid? CH 17 Transcription & Translation Basic Principles of Transcription & Translation RNA is the bridge between genes and the proteins for which they code. Transcription is the synthesis of RNA under the direction

More information

Exercise 7: DNA and Protein Synthesis

Exercise 7: DNA and Protein Synthesis Exercise 7: DNA and Protein Synthesis Introduction DNA is the code of life, and it is the blueprint for all living things. DNA is contained in all cells, and it is replicated every time a cell divides.

More information

Chapter 17: From Gene to Protein

Chapter 17: From Gene to Protein Name Period This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect to spend at least 6 hours to truly master

More information

Structure. Structural Components of Nucleotides Base. Introduction Nucleotide to Cells & Microscopy and Nucleic Acid. Sugar. Phosphate Glycosidic bond

Structure. Structural Components of Nucleotides Base. Introduction Nucleotide to Cells & Microscopy and Nucleic Acid. Sugar. Phosphate Glycosidic bond 11 Introduction Nucleotide to Cells & Microscopy and Nucleic Acid Structure Structural Components of Nucleotides Base Sugar Phosphate Glycosidic bond H NUCLEOTIDE H 1 RNA DNA Table 3-1 Nucleic acid polymer

More information

II. DNA Deoxyribonucleic Acid Located in the nucleus of the cell Codes for your genes

II. DNA Deoxyribonucleic Acid Located in the nucleus of the cell Codes for your genes HEREDITY = passing on of characteristics from parents to offspring How?...DNA! I. DNA, Chromosomes, Chromatin, and Genes DNA = blueprint of life (has the instructions for making an organism) Chromatin=

More information

It took a while for biologists to figure out that genetic information was carried on DNA.

It took a while for biologists to figure out that genetic information was carried on DNA. DNA Finally, we want to understand how all of the things we've talked about (genes, alleles, meiosis, etc.) come together at the molecular level. Ultimately, what is an allele? What is a gene? How does

More information

Unit 6 Study Guide Protein Name pg I can tell the difference between mrna, trna, and rrna.

Unit 6 Study Guide Protein Name pg I can tell the difference between mrna, trna, and rrna. Unit 6 Study Guide Protein Name pg. 1 1. I can tell the difference between mrna, trna, and rrna. Messenger RNA (mrna) acts as a copy of the instructions for making a protein. mrna carries these instructions

More information

The genetic code consists of a sequence of three letter "words" (called 'codons'), written one after another along the length of the DNA strand.

The genetic code consists of a sequence of three letter words (called 'codons'), written one after another along the length of the DNA strand. Review Questions Translation (protein synthesis) 1. What is the genetic code? The genetic code consists of a sequence of three letter "words" (called 'codons'), written one after another along the length

More information

(DNA) 2 = = RNA - DNA

(DNA) 2 = = RNA - DNA Genetics and Cellular Function Genes and nucleic acids Protein synthesis and secretion DNA replication and the cell cycle Chromosomes and heredity Organization of the Chromatin Threadlike chromatin = chromosomes

More information

LEVEL TWO BIOLOGY: GENE EXPRESSION

LEVEL TWO BIOLOGY: GENE EXPRESSION LEVEL TWO BIOLOGY: GENE EXPRESSION Protein synthesis DNA structure and replication Polypeptide chains and amino acids Mutations Metabolic pathways Protein Synthesis: I can define a protein in terms of

More information

Unit 6 ~ Learning Guide

Unit 6 ~ Learning Guide Unit 6 ~ Learning Guide Name: INSTRUCTIONS Complete the following notes and questions as you work through the related lessons. You are required to have this package completed BEFORE you write your unit

More information

Protein Synthesis How Genes Become Constituent Molecules

Protein Synthesis How Genes Become Constituent Molecules Protein Synthesis Protein Synthesis How Genes Become Constituent Molecules Mendel and The Idea of Gene What is a Chromosome? A chromosome is a molecule of DNA 50% 50% 1. True 2. False True False Protein

More information

2. Describe (draw) the structure of a chromosome. Identify: DNA, proteins + a gene.

2. Describe (draw) the structure of a chromosome. Identify: DNA, proteins + a gene. Biology 12 DNA Functions Practice Exam - KEY A. DNA Structure 1. DNA is often called the "code of life". Actually it contains the code for a) the sequence of amino acids in a protein b) the sequence of

More information

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled Biology 101 Chapter 14 Name: Fill-in-the-Blanks Which base follows the next in a strand of DNA is referred to. as the base (1) Sequence. The region of DNA that calls for the assembly of specific amino

More information

From Gene to Protein Transcription and Translation i

From Gene to Protein Transcription and Translation i From Gene to Protein Transcription and Translation i How do the genes in our DNA influence our characteristics? For example, how can a gene determine whether a person is an albino with very pale skin and

More information

DNA TM Review And EXAM Review. Ms. Martinez

DNA TM Review And EXAM Review. Ms. Martinez DNA TM Review And EXAM Review Ms. Martinez 1. Write out the full name for DNA molecule. Deoxyribonucleic acid 2. What are chromosomes? threadlike strands made of DNA and PROTEIN 3. What does DNA control

More information

Structure and Function of DNA

Structure and Function of DNA Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four

More information

SAM Teacher s Guide DNA to Proteins

SAM Teacher s Guide DNA to Proteins SAM Teacher s Guide DNA to Proteins Note: Answers to activity and homework questions are only included in the Teacher Guides available after registering for the SAM activities, and not in this sample version.

More information

SAM Teacher s Guide DNA to Proteins

SAM Teacher s Guide DNA to Proteins SAM Teacher s Guide DNA to Proteins Overview Students examine the structure of DNA and the processes of translation and transcription, and then explore the impact of various kinds of mutations. Learning

More information

TR056/PG1005. Lecture 18. Translation

TR056/PG1005. Lecture 18. Translation TR056/PG1005 Lecture 18 Translation Dr. Neil Docherty My Teaching Objectives To explain the meaning of the genetic code To introduce trna structure and describe the mechanism of amino acid (AA) charging

More information

RNA Transcription and Translation

RNA Transcription and Translation RNA Transcription and Translation How is information in DNA used to make protein? RNA acts as DNA and protein synthesis machinery Transcription - copying of Translation - production of Whole process =

More information

From DNA to Protein. Chapter 14

From DNA to Protein. Chapter 14 From DNA to Protein Chapter 14 Impacts, Issues: Ricin and your Ribosomes Ricin is toxic because it inactivates ribosomes, the organelles which assemble amino acids into proteins, critical to life processes

More information

Specific problems. The genetic code. The genetic code. Adaptor molecules match amino acids to mrna codons

Specific problems. The genetic code. The genetic code. Adaptor molecules match amino acids to mrna codons Tutorial II Gene expression: mrna translation and protein synthesis Piergiorgio Percipalle, PhD Program Control of gene transcription and RNA processing mrna translation and protein synthesis KAROLINSKA

More information

Transcription Activity Guide

Transcription Activity Guide Transcription Activity Guide Teacher Key Ribonucleic Acid (RNA) Introduction Central Dogma: DNA to RNA to Protein Almost all dynamic functions in a living organism depend on proteins. Proteins are molecular

More information

DNA, RNA AND PROTEIN SYNTHESIS

DNA, RNA AND PROTEIN SYNTHESIS DNA, RNA AND PROTEIN SYNTHESIS Evolution of Eukaryotic Cells Eukaryotes are larger, more complex cells that contain a nucleus and membrane bound organelles. Oldest eukarytotic fossil is 1800 million years

More information

Micro 611(Molecular Virology) Dr. Nagwa Mohamed Amin Aref

Micro 611(Molecular Virology) Dr. Nagwa Mohamed Amin Aref Lecture Gene Structure, Transcription, & Translation Micro 611(Molecular Virology) Presented by Dr. Nagwa Mohamed Amin Aref TYPICAL GENE STRUCTURE Promoter Coding Region +1 transcription PROKARYOTES COORDINATED

More information

Genes DNA Replication

Genes DNA Replication Genes DNA Replication Classwork 1. Explain why it is necessary to be able to replicate DNA in order to sustain life. 2. What is the appropriate scientific term used to describe a series of bases that code

More information

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d. 13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both

More information

From DNA to Protein

From DNA to Protein Nucleus Control center of the cell contains the genetic library encoded in the sequences of nucleotides in molecules of DNA code for the amino acid sequences of all proteins determines which specific proteins

More information

I. DNA, Chromosomes, Chromatin, and Genes. II. DNA Deoxyribonucleic Acid Located in the of the cell Codes for your - discovered DNA in 1928

I. DNA, Chromosomes, Chromatin, and Genes. II. DNA Deoxyribonucleic Acid Located in the of the cell Codes for your - discovered DNA in 1928 Name: Period: Date: = passing on of characteristics from parents to offspring How?...! I. DNA, Chromosomes, Chromatin, and Genes = blueprint of life (has the instructions for making an organism) = uncoiled

More information

Thymine = orange Adenine = dark green Guanine = purple Cytosine = yellow Uracil = brown

Thymine = orange Adenine = dark green Guanine = purple Cytosine = yellow Uracil = brown 1 DNA Coloring - Transcription & Translation Transcription RNA, Ribonucleic Acid is very similar to DNA. RNA normally exists as a single strand (and not the double stranded double helix of DNA). It contains

More information

Warm Up: What do you think the transcription does? Where does it occur? What is its significance?

Warm Up: What do you think the transcription does? Where does it occur? What is its significance? Day 1: Transcription Warm Up: What do you think the transcription does? Where does it occur? What is its significance? Lecture: Powerpoint slides with main points bulleted and a few pictures Connection

More information

1. Which of the following correctly organizes genetic material from the broadest category to the most specific category?

1. Which of the following correctly organizes genetic material from the broadest category to the most specific category? DNA and Genetics 1. Which of the following correctly organizes genetic material from the broadest category to the most specific category? A. genome chromosome gene DNA molecule B. genome chromosome DNA

More information

To be able to describe polypeptide synthesis including transcription and splicing

To be able to describe polypeptide synthesis including transcription and splicing Thursday 8th March COPY LO: To be able to describe polypeptide synthesis including transcription and splicing Starter Explain the difference between transcription and translation BATS Describe and explain

More information

SCI 102. HUMAN GENOME Transcription / Translation 24/03/2015 HUMAN GENOME PROJECT. Human Genome Project (HGP) Whose DNA samples were sequenced in HGP?

SCI 102. HUMAN GENOME Transcription / Translation 24/03/2015 HUMAN GENOME PROJECT. Human Genome Project (HGP) Whose DNA samples were sequenced in HGP? SCI 102 HUMAN GENOME Transcription / Translation HUMAN GENOME PROJECT 26 June 2000; announcement for the completion of the first draft Prof. MÜGE TÜRET Bill Clinton (USA President), Francis Collins (HUGO-international

More information

DNA Lecture II Protein Synthesis Notes. Using the Code of Life DNA & RNA. Page #1 (Stratton 2010) Name: 2. : production of proteins

DNA Lecture II Protein Synthesis Notes. Using the Code of Life DNA & RNA. Page #1 (Stratton 2010) Name: 2. : production of proteins Page #1 Using the Code of Life DNA & RNA Slide #2 Two process involve DNA : making an copy of DNA a. purpose: b. occurs: c. uses: DNA : production of proteins a. purpose: & b. occurs: between nucleus &

More information

INTRODUCTION TO DNA. DNA, CHROMOSOMES AND GENES How do these terms relate to one another?

INTRODUCTION TO DNA. DNA, CHROMOSOMES AND GENES How do these terms relate to one another? INTRODUCTION TO DNA You've probably heard the term a million times. You know that DNA is something inside cells; you probably know that DNA has something to do with who we are and how we get to look the

More information

Ms. Campbell Protein Synthesis Practice Questions Regents L.E.

Ms. Campbell Protein Synthesis Practice Questions Regents L.E. Name Student # Ms. Campbell Protein Synthesis Practice Questions Regents L.E. 1. A sequence of three nitrogenous bases in a messenger-rna molecule is known as a 1) codon 2) gene 3) polypeptide 4) nucleotide

More information

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins

More information

What s the Point? --- Point, Frameshift, Inversion, & Deletion Mutations

What s the Point? --- Point, Frameshift, Inversion, & Deletion Mutations What s the Point? --- Point, Frameshift, Inversion, & Deletion Mutations http://members.cox.net/amgough/mutation_chromosome_translocation.gif Introduction: In biology, mutations are changes to the base

More information

No growth: Mutant cells cannot grow and divide Minimal medium. Classes of Neurospora crassa. Class I mutants Class II mutants Class III mutants

No growth: Mutant cells cannot grow and divide Minimal medium. Classes of Neurospora crassa. Class I mutants Class II mutants Class III mutants EXPERIMENT Growth: Wild-type cells growing and dividing No growth: Mutant cells cannot grow and divide Minimal medium RESULTS Minimal medium (MM) (control) Wild type Classes of Neurospora crassa Class

More information

Name: Date: Period: DNA Unit: DNA Webquest

Name: Date: Period: DNA Unit: DNA Webquest Name: Date: Period: DNA Unit: DNA Webquest Part 1 History, DNA Structure, DNA Replication DNA History http://www.dnaftb.org/dnaftb/1/concept/index.html Read the text and answer the following questions.

More information

From Gene to Protein. Chapter 17. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for

From Gene to Protein. Chapter 17. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for Chapter 17 From Gene to Protein PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp

More information

Bio EOC Questions for DNA and Protein Synthesis

Bio EOC Questions for DNA and Protein Synthesis Bio EOC Review Topics for DNA and Protein Synthesis o DNA: structure - What are the parts of a nucleotide? sugar, acid, N-bases (and be able to identify these parts on a diagram) A-T / T-A / C-G / G-C

More information

Translation. Translation: Assembly of polypeptides on a ribosome

Translation. Translation: Assembly of polypeptides on a ribosome Translation Translation: Assembly of polypeptides on a ribosome Living cells devote more energy to the synthesis of proteins than to any other aspect of metabolism. About a third of the dry mass of a cell

More information

Lab # 12: DNA and RNA

Lab # 12: DNA and RNA 115 116 Concepts to be explored: Structure of DNA Nucleotides Amino Acids Proteins Genetic Code Mutation RNA Transcription to RNA Translation to a Protein Figure 12. 1: DNA double helix Introduction Long

More information

PRACTICE TEST QUESTIONS

PRACTICE TEST QUESTIONS PART A: MULTIPLE CHOICE QUESTIONS PRACTICE TEST QUESTIONS DNA & PROTEIN SYNTHESIS B 1. One of the functions of DNA is to A. secrete vacuoles. B. make copies of itself. C. join amino acids to each other.

More information

16 Protein Synthesis: Transcription and Translation

16 Protein Synthesis: Transcription and Translation 16 Protein Synthesis: Transcription and Translation Ge n e s c a r r y t h e information that, along with environmental factors, determines an organism s traits. How does this work? Although the complete

More information

DNA (Deoxyribonucleic Acid)

DNA (Deoxyribonucleic Acid) DNA (Deoxyribonucleic Acid) Genetic material of cells GENES units of genetic material that CODES FOR A SPECIFIC TRAIT Called NUCLEIC ACIDS DNA is made up of repeating molecules called NUCLEOTIDES Phosphate

More information

Complementary Base Pairs: A and T. DNA contains complementary base pairs in which adenine is always linked by two hydrogen bonds to thymine (A T).

Complementary Base Pairs: A and T. DNA contains complementary base pairs in which adenine is always linked by two hydrogen bonds to thymine (A T). Complementary Base Pairs: A and T DNA contains complementary base pairs in which adenine is always linked by two hydrogen bonds to thymine (A T). Complementary Base Pairs: G and C DNA contains complementary

More information

Transcription, Translation & Protein Synthesis

Transcription, Translation & Protein Synthesis Transcription, Translation & Protein Synthesis Do you remember what proteins are made of? Hundreds of Amino Acids link together to make one Protein There are 20 types of amino acids, some we can make,

More information

Concept 17.4: Translation is the RNA-directed synthesis of a polypeptide: a closer look

Concept 17.4: Translation is the RNA-directed synthesis of a polypeptide: a closer look Concept 17.4: Translation is the RNA-directed synthesis of a polypeptide: a closer look A cell translates an message into protein with the help of transfer RNA () Molecules of are not identical: ach carries

More information

DNA to Protein BIOLOGY INSTRUCTIONAL TASKS

DNA to Protein BIOLOGY INSTRUCTIONAL TASKS BIOLOGY INSTRUCTIONAL TASKS DNA to Protein Grade-Level Expectations The exercises in these instructional tasks address content related to the following science grade-level expectations: Contents LS-H-B1

More information

Bioinformatics: Network Analysis

Bioinformatics: Network Analysis Bioinformatics: Network Analysis Molecular Cell Biology: A Brief Review COMP 572 (BIOS 572 / BIOE 564) - Fall 2013 Luay Nakhleh, Rice University 1 The Tree of Life 2 Prokaryotic vs. Eukaryotic Cell Structure

More information

Provincial Exam Questions. 9. Give one role of each of the following nucleic acids in the production of an enzyme.

Provincial Exam Questions. 9. Give one role of each of the following nucleic acids in the production of an enzyme. Provincial Exam Questions Unit: Cell Biology: Protein Synthesis (B7 & B8) 2010 Jan 3. Describe the process of translation. (4 marks) 2009 Sample 8. What is the role of ribosomes in protein synthesis? A.

More information

Lecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides

Lecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides Lecture Series 7 From DNA to Protein: Genotype to Phenotype Reading Assignments Read Chapter 7 From DNA to Protein A. Genes and the Synthesis of Polypeptides Genes are made up of DNA and are expressed

More information

GENE EXPRESSION Transcription (Video)

GENE EXPRESSION Transcription (Video) GENE EXPRESSION Is the process by which information from a gene is used in the synthesis of a functional gene product. These products are often proteins, but in non-protein coding genes such as rrna genes

More information

Written by: Prof. Brian White

Written by: Prof. Brian White Molecular Biology II: DNA Transcription Written by: Prof. Brian White Learning Goals: To work with a physical model of DNA and RNA in order to help you to understand: o rules for both DNA & RNA structure

More information

Translation Activity Guide

Translation Activity Guide Translation Activity Guide Teacher Key β-globin Translation Translation occurs in the cytoplasm of the cell and is defined as the synthesis of a protein (polypeptide) using information encoded in an mrna

More information

Biology - Student Reader & Workbook Unit 3, Chapter 4: Molecular Genetics - DNA Structure and Protein Synthesis

Biology - Student Reader & Workbook Unit 3, Chapter 4: Molecular Genetics - DNA Structure and Protein Synthesis Biology - Student Reader & Workbook Unit 3, Chapter 4: Molecular Genetics - DNA Structure and Protein Synthesis UNIT 3, CHAPTER 4: MOLECULAR GENETICS: DNA STRUCTURE AND... 3 PROTEIN SYNTHESIS... 3 LESSON

More information

Study Guide Chapter 12

Study Guide Chapter 12 Study Guide Chapter 12 1. Know ALL of your vocabulary words! 2. Name the following scientists with their contributions to Discovering DNA: a. Strains can be transformed (or changed) into other forms while

More information

This activity will help you to learn how a gene provides the instructions for making a protein.

This activity will help you to learn how a gene provides the instructions for making a protein. NAME: PERIOD: From Gene to Protein Transcription and Translation By Dr. Ingrid Waldron and Jennifer Doherty, Department of Biology, University of Pennsylvania, Copyright, 2009 i This activity will help

More information

DNA Web Quest. 2. Who discovered that individual traits are passed on from one generation to the next? In what year?

DNA Web Quest. 2. Who discovered that individual traits are passed on from one generation to the next? In what year? Part 1 Introduction, History, DNA Structure, DNA Replication Introduction Go to http://science.howstuffworks.com/cell4.htm Read the text. As you read fill in the blanks below. Stop! 1 DNA History Go to

More information

12/22/2014. Read the introduction. How does a cell make proteins with the information from DNA? Protein Synthesis: Transcription and Translation

12/22/2014. Read the introduction. How does a cell make proteins with the information from DNA? Protein Synthesis: Transcription and Translation EQ How does a cell make proteins with the information from DNA? Protein Synthesis: Get Started Get Started Think of a corn cell that is genetically modified to contain the Bt gene and a corn cell that

More information

Lab #5: DNA, RNA & Protein Synthesis. Heredity & Human Affairs (Biology 1605) Spring 2012

Lab #5: DNA, RNA & Protein Synthesis. Heredity & Human Affairs (Biology 1605) Spring 2012 Lab #5: DNA, RNA & Protein Synthesis Heredity & Human Affairs (Biology 1605) Spring 2012 DNA Stands for : Deoxyribonucleic Acid Double-stranded helix Made up of nucleotides Each nucleotide= 1. 5-carbon

More information

7 Nucleic acids. Chapter summary a reminder of the issues to be revised

7 Nucleic acids. Chapter summary a reminder of the issues to be revised 7 Nucleic acids Chapter summary a reminder of the issues to be revised 1 DNA, an extremely long, thread-like macromolecule, consists of two anti-parallel polynucleotide strands, paired together and held

More information

Multiple Choice Review- Genes

Multiple Choice Review- Genes Multiple Choice Review- Genes 1. Deoxyribonucleic acid nucleotides are composed of a. Ribose sugar, a phosphate group and one of four bases (adenine, cytosine, thymine and guanine) b. Ribose sugar, a phosphate

More information

DNA, RNA, Protein synthesis, and Mutations. Chapters 12-13.3

DNA, RNA, Protein synthesis, and Mutations. Chapters 12-13.3 DNA, RNA, Protein synthesis, and Mutations Chapters 12-13.3 1A)Identify the components of DNA and explain its role in heredity. DNA s Role in heredity: Contains the genetic information of a cell that can

More information

BCH401G Lecture 39 Andres

BCH401G Lecture 39 Andres BCH401G Lecture 39 Andres Lecture Summary: Ribosome: Understand its role in translation and differences between translation in prokaryotes and eukaryotes. Translation: Understand the chemistry of this

More information

Q1. Describe how a section of DNA determines the structure of a protein. (4) Q2. Producing new cells (a) The diagram shows the mass of DNA (m), before, during and after cell division in one cell. (i) Name

More information

The sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized:

The sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized: Module 3F Protein Synthesis So far in this unit, we have examined: How genes are transmitted from one generation to the next Where genes are located What genes are made of How genes are replicated How

More information

Announcements. Chapter 15. Proteins: Function. Proteins: Function. Proteins: Structure. Peptide Bonds. Lab Next Week. Help Session: Monday 6pm LSS 277

Announcements. Chapter 15. Proteins: Function. Proteins: Function. Proteins: Structure. Peptide Bonds. Lab Next Week. Help Session: Monday 6pm LSS 277 Lab Next Week Announcements Help Session: Monday 6pm LSS 277 Office Hours Chapter 15 and Translation Proteins: Function Proteins: Function Enzymes Transport Structural Components Regulation Communication

More information

GENE EXPRESSION AT THE MOLECULAR LEVEL

GENE EXPRESSION AT THE MOLECULAR LEVEL GENE EXPRESSION AT THE MOLECULAR LEVEL 1 Gene expression Gene function at the level of traits Gene function at the molecular level Two levels tied together since the molecular level affects the structure

More information

Structure of DNA Remember: genes control certain traits, genes are sections of DNA

Structure of DNA Remember: genes control certain traits, genes are sections of DNA tructure of DNA Remember: genes control certain traits, genes are sections of DNA I. tructure of DNA (deoxyribonucleic acid) A. Made of nucleotides 1. nucleotides have 3 main parts a. sugar (deoxyribose)

More information