(St. Petersburg, FL). [y-32p]atp (3000 Ci/mmol; 1 Ci = 37

Transcription

1 Proc. Nati. Acad. Sci. USA Vol. 82, pp , May 198 Biochemistry loning and sequence analysis of cdna for the luminescent protein aequorin (bioluminescence/photoprotein/calcium-binding protein/molecular cloning/amino acid sequence) SATOSHI INOUYE*, MASATO NOGUHI*, YOSHIYUKI SAKAKI*, YASUYUKI TAKAGI*, ToSHIYUKI MIYATAt, SADAAKI IWANAGAt, TAKASHI MIYATAt, AND FREDERIK I. Tsujit *Research Laboratory for Genetic Information, Faculty of Medicine, and tdepartment of Biology, Faculty of Science, Kyushu University, Fukuoka 812, Japan; tmarine Biology Research Division, Scripps Institution of Oceanography, University of alifornia at San Diego, La Jolla, A 92093; and Veterans Administration Medical enter Brentwood, Los Angeles, A ommunicated by Martin D. Kamen, January 1, 198 ABSTRAT The luminescent jellyfish Aequorea contains a photoprotein, aequorin, which emits light by an intramolecular reaction in the presence of a trace amount of a2+. A cdna library of Aequorea was constructed and clones carrying the cdna for the a2+-dependent photoprotein were isolated by the method of colony hybridization using synthetic oligonucleotide probes. The primary structure of the protein deduced from the nucleotide sequence showed that the protein is composed of 189 amino acid residues and has three F-F hand structures that are characteristic for a2+-binding sites. The sequence also suggested that the protein has hydrophobic regions at which the protein may interact with its functional chromophore, coelenterazine. Aequorin is a photoprotein found in the jellyfish Aequorea and has been used as a biological calcium indicator, since the luminescent reaction is dependent on calcium ions (1-). The protein emits a blue light (Xmax = 470 nm) when allowed to react with a2" and forms a blue-fluorescent protein (BFP), which dissociates into two components (apoaequorin and coelenteramide) when treated with acid or ether (7, 8). Structure determination and regeneration studies with BFP have shown that coelenterazine is the functional chromophore in aequorin (9-14). The a2"-triggered oxidation of coelenterazine yields coelenteramide and the excited state of coelenteramide bound to apoaequorin is the light emitter in the reaction. To understand the molecular mechanism of the luminescent reaction, it is also necessary to know the structure and function of the protein moiety, but little is known of this. As a first step in investigating this problem, we attempted to clone the DNA complementary to apoaequorin mrna. In this paper, we describe the cloning and sequence analysis of apoaequorin cdna. The primary structure of apoaequorin deduced from the nucleotide sequence shows that the protein has three E-F hand structures characteristic for a2"-binding sites. MATERIALS AND METHODS Materials. Aequorin (2 mg, >90% pure) was purchased from the Mayo Foundation (Rochester, MN) courtesy of John R. Blinks. A gift of highly pure aequorin (1. mg) was also obtained from William W. Ward (Rutgers University). Restriction enzymes were purchased from Takara Shuzo (Kyoto, Japan), Nippon Gene (Toyama, Japan), and Bethesda Research Laboratories. T4 polynucleotide kinase was obtained from Takara Shuzo, terminal deoxynucleotidyl transferase was from P-L Biochemicals, and avian myeloblastosis virus reverse transcriptase was from Life Sciences The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S solely to indicate this fact. (St. Petersburg, FL). [y-32p]atp (3000 i/mmol; 1 i = 37 GBq) was purchased from Amersham and [a-32p]dtp (3000 i/mmol), [a-32p]dgtp (3000 i/mmol), and [a-32p]dttp (3000 i/mmol) were obtained from New England Nuclear. Yeast trna was obtained from Sigma. All other reagents were of the highest grade available. Isolation of RNA. Specimens of the jellyfish Aequorea victoria were collected at Friday Harbor Laboratories, University of Washington. The outer margin of the umbrella of the jellyfish was excised with a cutting machine as described by Johnson and Shimomura (8). Four hundred outer margins were ground in a Waring blender at 4 with 30 ml of phenol saturated with 10 mm sodium acetate (ph ) containing 10 mm EDTA and,ug of polyvinyl sulfate per ml. The mixture was subjected to centrifugation at 9000 rpm for min in a Sorvall SS34 rotor and the phenol was removed. The phenol extraction was repeated and finally the upper aqueous phase was kept. RNA was precipitated with absolute ethanol, collected by centrifugation at 9000 rpm for min, and dissolved in 10 mm Tris Hl, ph 7./1.0 mm EDTA to give a concentration of 1.0 mg/ml. The RNA was further subjected to oligo(dt)-cellulose column chromatography in order to obtain poly(a)+ RNA (). The RNA was precipitated with ethanol, dried in vacuo, and stored at -80. Determination of Amino Acid omposition and Partial Amino Acid Sequence. The amino acid composition of aequorin was determined as described (1, 17). The protein was cleaved into fragments with cyanogen bromide or lysyl endopeptidase and the fragments were isolated by HPL (18). Partial sequences were determined by the method of Edman degradation using a Beckman 890D amino acid sequencer (19) and an Applied Biosystems (Foster ity, A) model 470A gas-phase Sequenator (20). Preparation of Oligonucleotide Probes. The oligonucleotides were synthesized by Fujisawa Yakuhin (Osaka, Japan), using the phosphotriester method, and by Nikkaki (Tokyo, Japan), using the phosphoramidate method and a model 380A DNA synthesizer (Applied Biosystems). The oligonucleotides were purified and labeled according to the procedures of Wallace et al. (21). Two probes were prepared. Isolation and Analysis of cdna lones. Three micrograms of poly(a)+ RNA was converted to cdna with avian myeloblastosis virus reverse transcriptase and cloned into Escherichia coli DH1 as described by Okayama and Berg (22). About 1. x 104 independent clones were obtained. The clones carrying aequorin cdna were selected by the method of colony hybridization (21) using the synthetic oligonucleotide probes. Hybridization was carried out in 1.1 M Nal/0 mm NaH2PO4, ph 7.4/ mm EDTA/0.2% Ficoll/0.2% polyvinylpyrrolidone/0.2% bovine serum albumin/0.% NaDodSO4/20,g of yeast trna per ml/0.1 ng of 32plabeled probe DNA per ml at 30 for 12 hr. The filter was washed three times with 0.9 M Nal/0.09 M sodium citrate, 34

2 Biochemistry: Inouye et A A) Val-Lys-Leu-(Asp)-(Phe)-Asp-Phe-Asp-Asn-Pro----- Ser Gly Leu B) Val-Lys-Leu-Asn-Thr-Asp-Phe-Asp-Asn-Pro----- Probe I ' GA TT GA AA T T T T ) Met-(Phe or Thr)-Asn-(Phe)-Leu-Asp-Val-Asn----- Proc. Nati. Acad. Sci. USA 82 (198) 3 D) Met-Asp-Pro-Ala-ys-Glu-Lys-Leu-Tyr-Gly--- Probe II ' ATG GAT T GAT TG G G A A FIG. 1. Partial amino acid sequences of apoaequorin and oligonucleotide sequences synthesized for probes. (A) NH2-terminal sequence of whole aequorin protein. (B-D) NH2-terminal sequences of three fragments produced by cyanogen bromide treatment of the protein. At some positions, more than one amino acid residue was detected, which was probably due to the existence of isoproteins. At such positions, major amino acids are shown in parentheses. Two segments of the sequences having minimum codon ambiguity were used to synthesize the oligonucleotide probes I and II. 3' 3' ph 7.0, at room temperature, then washed twice with the same solution at 37, and subjected to autoradiography. Plasmid DNA was extracted by using the alkaline method from clones that gave strongly positive signals for both probes (23). The restriction map of the inserted cdna was constructed by using a combination of various restriction enzymes. Restriction fragments were isolated by agarose gel electrophoresis and subjected to nucleotide sequence determination by the method of Maxam and Gilbert (24). RESULTS Isolation of Apoaequorin cdna lone. From among the amino acid sequences of the NH2-terminal regions of aequorin and some peptides obtained by cyanogen bromide treatment, two segments having minimum codon ambiguity were selected to synthesize the oligonucleotide probes (Fig. 1). Using the colony hybridization technique (21), three cdna clones were isolated from the library that gave strongly positive signals for both probes. Since cdna from all three clones showed similar cleavage maps by restriction enzymes, one of them, AQ440, was subjected to further study. The nucleotide sequence of AQ440 was determined by the method of Maxam and Gilbert (24), using the strategy shown in Fig. 2, and the results are summarized in Fig. 3. The sequence of the clone was found to have a long open reading frame starting from methionine at nucleotide position (Fig. 3). Several lines of evidence indicated that the amino acid sequence shown in Fig. 3 is actually that of apoaequorin: (i) the amino acid sequences as determined by the Edman degradation method (Fig. 1) were found in portions of the amino acid sequence deduced from the nucleotide sequence - 3' I t1 -~~~~~~~~~~~ 4 10 ll) bp FIG. 2. Restriction map and sequencing strategy of apoaequorin cdna clone AQ440. Sequenced regions are shown by horizontal arrows. The solid and open boxes show the coding region and the NH2-terminal flanking peptide, respectively. The shaded boxes I and li show the regions used as probes. bp, Base pairs. (shown by shaded regions in Fig. 3), (ii) the amino acid compositions of the peptides from lysyl endopeptidase digestion (horizontal arrows, Fig. 3) of aequorin were consistent with those expected from the sequence given in Fig. 3, and (iii) the amino acid composition (Table 1) of whole aequorin protein obtained by chemical analysis coincided well with that estimated from the sequence shown in Fig. 3. Moreover, as described below, the molecular weight of the protein estimated from the results of Fig. 3 agreed fairly closely with that estimated by gel filtration and NaDodSO4 gel electrophoresis (2) and also the amino acid sequence shown in Fig. 3 contained E-F hand structures that are characteristic of a2'-binding sites. Thus, from these results, it is reasonable to conclude that AQ440 is a clone of apoaequorin cdna. The cdna contained a putative poly(a) signal, A-A-T-A- Table 1. Amino acid composition of aequorin Predicted from Amino acid Analysis* nucleotide sequence mys Asp Asn Thr Ser Glu Gln Pro Gly Ala Val Met Ile Leu Tyr Phe Lys His Trp Arg lo.ot 9.3t t t Total 189 *Average value obtained from 24-, 48-, and 72-hr hydrolyses with.7 M Hl. tvalue extrapolated to zero time. ttaken from 72-hr hydrolysis

3 3 Biochemistry: Inouye et al. Proc. Natl. Acad. Sci. USA 82 (198) ( G )33 AA - So TGAATT AT.TTTGATGAAAGAOTTAATGTGAATGTGTAGTTGATGATAAATTGT TiGGAAGAAAAGAAA Met Thr Ser Lys Gin Tyr Ser Val Lys Leu Thir Ser Asp Phe Asp Asn Pro Arg Trp Ilie ATG AA AG AAA MA TA TA GT AAG TT AA TA GA TTG GA AA GA AGA TGG ATT G0?n Gly Arg His Lys His Met Phe Asn Phe Leu. Asp Val Asn His Asn Gly Lys lie Ser Leu GGA GA A AAG AT ATG IT AAT TT TT GAT GT AA A AAT GG0 AAA AT TT TT 120 Asp Glu Met Val Tyr Lys GA GAG ATG GTG TA AAG Gin Ala Lys Arg AO G AAA GA 0 'His Lys Asp A AAA GAT Gly Va] Glu Thr Asp Irp GGT GTG GAO AGT GAT TGG Leu GS U Lys Tyr Al a Lys TTG GAG AAA TA G AAA Asp Ile Val Asp Lys Asp GAT ATG OTT GA AAA GAT Lys Ala Ala Sly Ile Ile AAA. GT GI GOT AT AT 40 Ala Ser GA TT Asp Ile Val Ile Asn Asn Leu Gly Ala Thr Pro Glu GAT OTT GT AT AAT AA GTT GGA GA AA T GAG 180 Ala Val G1u Ala Phe Phe Gly Gly Ala Gly Met GT GTA GAA G TT TTG GGA GGA GT GGA ATG 30 Pro Ala Tyr Ile Glu GSly 'rp Lys Lys Leu Ala Thr Asp Gu [G GA TAT ATT GAA GGA TOG AAA AAA TTG GT AGT GAT GAO Asn AA 120 Gin GAO SbU Pro Thr Leu Ile Arg GAA A AG T AT GT Asn Gly Ala Ile Thr Leu Asp Glu lrp AAT GGA G ATT AA TG GAT GAA TGG l 4 Gin Ser Ser Glu Asp ys GSu GOu Thr Phe GAA TA TA GAA GOT TG GAG GAA AA TT Ile Trp Gly Asp Ala Lel Phe ATA TGG GGT GAT GT TTG TTT 30 Lys AAA Ala GA Tyr T A Thr A 420 I. a Arg Val ys Asp AGA GTG TO GAT Ile Asp Glu Ser Gly Gln Leu Asp Val Asp Glu Met Thr Arg Gln His Leu Gly Phe Trp ATT GAT GAA AST GGA AA T GAT GTT GAT GAG ATG AA AGA AA AT TTA 0GA TTT TGG 40 Tyr Thr Met Asp TA AG AT GAT 180 Pro Ala ys Glu Lys T OT TG GAA AAG Leu. Tyr Gly.Gly Ala Val T TA GGT GGA GT GTG Pro *** G TAA GAAGT TAG 02 GTGGTGATGAGTGGAAGATGATGTGATTTTGAATAAAAATGATGAATTAATGAAAATT-T--rTGAAATTTTTGA 81 AGATTTAATGGTTGTGTTGATTTT rgtaattaroaaagattaaatgaatgattagttot'! TTTTAATGAAGAG 70 OAOGTTAAAATGAAAAAGT (A)0 Lys Tyr AAA TAO 240 FIG. 3. Nucleotide sequence of the aequorin cdna clone AQ440 and the predicted amino acid sequence. The amino acid sequences that coincided with those obtained by Edman degradation are shaded. The vertical arrow shows the presumed NH2 terminus of aequorin. The horizontal arrows show the regions where the amino acid compositions coincided with those obtained from lysyl endopeptidase digestion. The numbers at the right and those on the amino acid residues show the nucleotide positions and the amino acid positions, respectively. (G)" and (A), are the oligo(g) and oligo(a) residues. The putative poly(a) addition signals A-A-T-A-A-A, A-T-T-A-A-A, and A-A-T--A-A are underlined. A-A (2), at nucleotide position 38-43, but it should be noted that the position of the signal is unusually far from the poly(a)+ site (usually base pairs away). It is possible that A-T-T-A-A-A (27) at position or A-A-T--A-A at position may also function as a poly(a) signal in jellyfish. Structural Analysis of Apoaequorin. The chemical analysis of whole apoaequorin protein showed that the NH2-terminal sequence was (Val or Ser or Gly or Leu)-Lys-Leu-(Asp)- (Phe)-Asp-Phe-Asp-Asn-Pro---- (Fig. 1A), which is similar to the sequence starting from the eighth amino acid residue from the first methionine (Fig. 3). onsequently, we concluded that the NH2-terminus of the mature protein is the valine at amino acid position 1 in Fig. 3. The results showed that the precursor protein had an additional peptide of seven amino acid residues at the NH2 terminus. The additional peptide had no characteristics expected as leader peptide and its role is obscure. The OOH terminus of the mature protein was presumed to be proline because a tryptic peptide having no lysine residue had an amino acid composition of (leucine, tyrosine, 2 glycine, alanine, valine, proline); which coincided with the 1 z,~~~~_ 79 a. VKLTSDFDNPRWIGRHKHMfNFLDVNH#4KISLDEMVYKASDIVINN ATPEQAKRHKDAVEAFFGGAGMKYGVET0- * * * * * * *... GTVMRSLGQNPTEAELQDMINEVDADONGTIDFFEFL L----- DA DIVKQQtLAtTLDEWKAYTKAAOIIQSSEDEETFRVD1D.ESGQLDVDE9MTRQHLGF * * * * * * *** * * REAFRVFDK GO YI SAAELRHVMTHLGEKLTDtEVDEMIREANDIGDGEVNYEEFVQMMTAK FIG. 4. Sequence homology between jellyfish aequorin (a) and bovine calmodulin (b). Horizontal arrows show the a2+-binding site of E-F hand structure. Letters in the shaded regions indicate the homologous amino acids and the asterisks indicate the amino acids having similar physical and chemical properties. Numbers indicate the residue number from the NH2 terminus of each protein. 17 2

4 -3. -os x~ L- x H--IS 1J a4x AI 2_- I i I 2- j' Biochemistry: Inouye et al. 0o Sequence position FIG.. Hydropathy profile of the sequence of aequorin. The average hydropathy value of a moving window of nine amino acids is plotted at the midpoint of the window. Possible a2l-binding sites are shown by horizontal arrows. OOH-terminal sequence ----Leu-Tyr-Gly-Gly-Ala-Val-Pro (Fig. 3). From these results, it was concluded that apoaequorin is composed of 189 amino acid residues and the molecular weight of the protein is 21,400, which is close to the published values (2). The luminescent reaction of aequorin is calcium-dependent and it has been reported that two calcium ions bind to one aequorin molecule (8, 2). A comparison of the amino acid sequence in Fig. 3 with those of the a2'-binding proteins such as calmodulin (28), parvalbumin (29), and troponin (30) revealed that apoaequorin has three possible a2+binding sites (E-F hand structures). High sequence homologies were found between apoaequorin and bovine calmodulin at three possible a2+-binding sites (horizontal arrows, Fig. 4). Interestingly, the distance between the second (the third in calmodulin) and the third (the fourth in calmodulin) E-F hand structures is conserved in these two proteins. This may mean that both proteins have a common evolutionary origin. Apoaequorin has three cysteine residues at positions 14, 2, and 180 near the third E-F hand structure. ysteine appears to be involved in an important way since the SH-blocking agent N-ethylmaleimide causes a loss of a2+triggered luminescence activity (13) and a reducing agent, 2-mercaptoethanol, is necessary in the regeneration of aequorin from apoaequorin (14). Fig. shows the hydropathy profile of aequorin estimated by the method of Kyte and Doolittle (31). The E-F hand regions had relatively high hydrophilicity, suggesting that the regions are located near the surface of the protein. Three hydrophobic regions were found at positions 40-0, -, and These may be the sites where the protein interacts with its chromophore, coelenterazine. DISUSSION The primary structure of aequorin deduced from the nucleotide sequence of cdna shows good agreement with the properties of the protein found by chemical analysis. However, some discrepancies were found between the results of chemical and nucleotide sequence analyses. For example, the amino acids at positions 4 and were threonine and serine from the nucleotide sequence but were aspartic acid and phenylalanine from chemical analysis (Figs. 1A and 3). Also, the NH2-terminus of the protein was ambiguous from the chemical analysis. It is known that aequorin exists in multiple Proc. Natl. Acad. Sci. USA 82 (198) 37 molecular forms (2) and it is possible that the results may have been due to the presence of these forms in our preparations. Another discrepancy has been in the molecular weight of aequorin. Earlier the molecular weight was reported to be around 31,000 (32, 33), but the accepted value is now 21,000 (8, 2) as proposed earlier (34). A further discrepancy has been in the number of a2+-binding sites, which was found to be three in the present study. Previous estimates have been conflicting, with one study indicating a value of three (3) and others two (2, 2). In contrast to a previous report (32), no carbohydrate was found in aequorin, and the amino acid sequence did not contain the sequence -Asn-X-Thr or Ser- (X = variable amino acid) believed necessary for carbohydrate attachment (3). Note Added in Proof. Analyses of two additional fragments have shown their amino acid compositions to coincide with the sequences 1-11 and in Fig. 3, except that arginine (position 11) and valine (position 11) were replaced by lysine. A recent paper by Prasher et al. (37) describes the cloning and expression of cdna for aequorin protein. We are grateful to the following: Drs. John R. Blinks and William W. Ward, for making aequorin available; Dr. Osamu Shimomura, for loan of the cutting machine and helpful advice; Mr. and Mrs. Eric Thompson and Ms. Elizabeth Hill, for assistance in collecting Aequorea; Fujisawa Yakuhin o. and Nikkaki o., for synthesis of the oligonucleotide probes; and Dr. A. 0. D. Willows, Director, Friday Harbor Laboratories, for providing laboratory facilities. This work was supported in part by grants from the Japan Society for the Promotion of Science (to Y.T. and Y.S.) and the National Science Foundation (INT to F.I.T.) under the U.S.-Japan ooperative Science Program and by research Grant PM from the National Science Foundation (to F.I.T.). 1. Shimomura, O., Johnson, F. H. & Saiga, Y. (192) J. ell. omp. Physiol. 9, Shimomura, O., Johnson, F. H. & Saiga, Y. (193) Science 140, Shimomura, 0. & Johnson, F. H. (1972) Nature (London) New Biol. 237, Blinks, J. R., Mattingly, P. H., Jewell, B. R., van Leeuwen, M., Harrer, G.. & Allen, D. G. (1978) Methods Enzymol. 7, Shimomura, 0. & Shimomura, A. (1982) FEBS Lett. 138, Shimomura, 0. & Shimomura, A. (1984) Biochem. J. 221, Shimomura, 0. & Johnson, F. H. (197) Soc. Exp. Biol. Symp. 30, Johnson, F. H. & Shimomura, 0. (1978) Methods Enzymol. 7, Shimomura, 0. & Johnson, F. H. (1972) Biochemistry 11, Kishi, Y., Tanino, H. & Goto, T. (1972) Tetrahedron Lett., Shimomura, 0. & Johnson, F. H. (1973) Tetrahedron Lett., Shimomura, O., Johnson, F. H. & Morise, H. (1974) Biochemistry 13, Shimomura, 0. & Johnson, F. H. (1978) Proc. Natl. Acad. Sci. USA 7, Shimomura, 0. & Johnson, F. H. (197) Nature (London) 2, Norgard, M. V., Tocci, M. J. & Monahan, J. J. (1980) J. Biol. hem. 2, Miyata, T., Iwanaga, S., Sakata, Y., Aoki, N., Takamatsu, J. & Kamiya, T. (1984) J. Biochem. (Tokyo) 9, Miyata, T., Hiranaga, M., Umezu, M. & Iwanaga, S. (1984) J. Biol. hem. 29, Miyata, T., Iwanaga, S., Sakata, Y. & Aoki, N. (1982) Proc. Natl. Acad. Sci. USA 79, Miyata, T., Usui, K. & Iwanaga, S. (1984) J. Biochem. (Tokyo) 9,

5 38 Biochemistry: Inouye et al. 20. Hunkapiller, M. W., Hewick, R. M., Dreyer, W. J. & Hood, L. E. (1983) Methods Enzymol. 91, Wallace, R. B., Johnson, M. J., Hirose, T., Miyake, T., Kawashima, E. H. & Itakura, K. (1981) Nucleic Acids Res. 9, Okayama, H. & Berg, P. (1982) Mol. ell. Biol. 2, Birnboim, H.. & Doly, J. (1979) Nucleic Acids Res. 7, Maxam, A. M. & Gilbert, W. (1980) Methods Enzymol., Blinks, J. R., Prendergast, F. G. & Allen, D. G. (197) Pharmacol. Rev. 28, Proudfoot, N. J. & Brownlee, G. G. (197) Nature (London) 23, Sherman, L., Dafni, N., Lieman-Hurwitz, J. & Groner, Y. (1983) Proc. Natl. Acad. Sci. USA 80, Watterson, D. M., Sharief, F. & Vanaman, T.. (1980) J. Biol. hem. 2, Proc. Nati. Acad. Sci. USA 82 (198) 29. Kretsinger, R. H. & Nockolds,. E. (1973) J. Biol. hem. 248, ollins, J. H., Potter, J. D., Horn, M. J., Wilshire, G. & Jackman, N. (1973) FEBS Lett. 3, Kyte, J. & Doolittle, R. F. (1982) J. Mol. Biol. 7, Shimomura, 0. & Johnson, F. H. (199) Biochemistry 8, Kohama, Y., Shimomura, 0. & Johnson, F. H. (1971) Biochemistry 10, Hastings, J. W., Mitchell, G., Mattingly, P. H., Blinks, J. R. & van Leeuwen, M. (199) Nature (London) 222, Shimomura, 0. & Johnson, F. H. (1970) Nature (London) 227, Pless, D. D. & Lennarz, W. J. (1977) Proc. Natl. Acad. Sci. USA 74, Prasher, D., Mcann, R. 0. & ormier, M. J. (198) Biochem. Biophys. Res. ommun. 12,