The NF1-gene a hotspot for de novo Alu- and L1-insertion? Katharina Wimmer Division Humangenetik, Medizinische Universität Innsbruck Molekulare Diagnostik 2013 Zürich, 1. März, 2013
2 Die im Vortrag vorgestellten Daten wurden zu einem großen Teil in dieser Publikation veröffentlicht:
NF1 gene Structure Chromosomal location: 17q11.2 Genomic sequence: 280 kb Coding sequence: 8454 bp (57 exons) Gene product neurofibromin: 220 kd Presence 3 of multiple pseudogene copies Mutations Point mutations: >90% Microdeletions: 5% Intragenic deletions/duplications: 2% Chromosomal alterations: <1%
Direct cdna sequencing of NF1 gene Blood sample RNA-Extraction cdna Synthesis with random hexamers Amplification of the entire coding sequence in 5 overlapping long-range (2-3 kb) PCR fragments F1 F2 F3 F4 F5 Fragment F1-F5 modified from Heim et al. (1995) Hum Mol Genet 4:975-81 4 Sequencing of the entire coding with 20 internal primers
Illegitimate splicing of the NF1 gene in aged blood samples mimics mutation-induced splicing alterations 5 Wimmer et al. Hum Genet (2000) 106: 311-313
0 hrs RT 24 hrs RT 48 hrs RT 24 hrs RT +72 hrs cult. 48 hrs RT +72 hrs cult. Short-term PHA-stimulated lymphocyte culture prevents illegitimate splicing 600 bp 400 bp M + exon 14 - exon 14 circumvents nonsense-mediated decay (NMD) by puromycine treatment of proliferating lymphocytes with puromycine treatment without puromycine treatment 6
Comprehensive NF1 mutation analysis protocol blood sample blood sample Short-term culture for RNA extraction inhibition illegitimate splicing inhibition NMD gdna extraction Direct cdna sequencing identification of all types of point mutations and many intragenic CNC gdna sequencing confirmation of mutation MLPA identification/ confirmation of deletions/ duplications 7
Spectrum of NF1 mutations reaching a detection rate of 95% complex other <1% frameshift 26% missense or 1-multi AA del/dup 18% nonsense 21% splice 27% 8 intragenic CNC 2% total gene deletion 5% Messiaen & Wimmer (2008) Monographs in Hum Genet 16:63-77
Types of splicing mutations found in 85 index cases 29 Classic splice-site mutations affecting GT-AG dinucleotides 34% 29 Splice-site mutations outside the GT-AG dinucleotides 34% 13 Exonic mutations creating novel 5 or 3 splice sites 15% 5 Exonic mutations causing exon skipping 6 % 6 Deep-intronic mutations causing insertion of cryptic exons 9 7 %
Unexplained NF1 splice alterations detected by direct cdna-sequencing blood sample Short-term lymphocyte culture for RNA extraction Inhibition of illegitimate splicing Inhibition of nonsense-mediated decay DNA extraction direct cdna sequencing gdna sequencing splice-mutation end ex 4b start ex 4c start ex 5 and/or wild-type 4b 4c 5 MLPA deletion 10 mutant 4b 5 exon skipping
gdna sequencing of exon 4c sequencing direction exon 4c c.650_651 Alu sequence 11
Alu & L1 elements are still amplifying retrotransposons in the human genome ~ 6000 bp < 290 bp 12
13 Mechanism of retrotansposition: target primed reverse transcription (TPRT)
gdna sequencing shows background sequence of an Alu element within the exon sequencing direction exon 4c c.650_651 Alu sequence IVS 4b Exon 4c Exon 4c IVS 4c 50nt + ATAAATAGCCTGGA AluYa5 + (A)n TSD + 4nt target site duplication (TSD) 14
Improved PCR conditions to detect Alu insertions A NF1 exon 4c B short PCR product control exon 4c c.650_651 short PCR long PCR M P C W P C W M short PCR product patient 1 kb 0.5 kb long PCR product patient IVS 4b exon 4c IVS 4c wild type 50nt + ATAAATAGCCTGGA + 4nt IVS 4b exon 4c exon 4c IVS 4c mutated 50nt + ATAAATAGCCTGGA AluYa5 + (A)n TSD + 4nt 15 TSD
16 14 Alus introduced into NF1 gene belong to the youngest Alu families: 2x AluY, 6x AluYa5, 6x AluYb8
17 Identification of a full-length (~6000bp) L1 insertion in NF1 exon 30
Table 1: List of all Alu, L1 and poly(t) insertions uncovered in the NF1 gene No. Location Element Mutation nomenclature 1 IVS 14 (10c) Alu Y c.1642-1_1642insaluy 2 IVS 10 (8) AluY c.1186-86_1186-16delinsaluy 3 E6 (4c) Alu Ya5 c.650_651insaluya5 4 E21 (16) Alu Ya5 c.2835_2836insaluya5 5 E21 (16) Alu Ya5 c.2835_2836insaluya5 6 E22 (17) Alu Ya5 c.2858_2859insaluya5 7 E33 (25) Alu Ya5 c.4319_4320insaluya5 8 E47 (38) Alu Ya5 c.6951_6952ins AluYa5 9 E12 (10a) Alu Yb8 c.1354_1355insaluyb8 10 IVS 14 (10c) Alu Yb8 c.1642-12_1642-11insaluyb8 11 E21 (16) Alu Yb8 c.2439_2440insaluyb8 12 E22 (17) Alu Yb8 c.2979_2980insaluyb8 13 E33 (25) Alu Yb8 c.4319_4320insaluyb8 14 IVS48 (39) Alu Yb8 c.7127-5_7127_4insaluyb8 15 E25 (19b) poly (T) strech or: c.3312_313inst (n~120) 16 E23 (18) L1 (5'-truncated) c.3048_3049l1 17 E39 (30) L1 (full-length) c.5606_5607insl1 18 IVS9 (7) L1 (inverted) c.1062+195_1062+196ins L1 18
19 Splice effects of 18 Alu & L1 insertions
Alignment of the integration sites in NF1 Table 2: Sequences at the integration sites aligned to the L1 endonuclease cleavage consensus site Integration sites TSD Orientation Alu family NF1 location 3'AAAGAGAAAAAA TTTTTTAAGTCCGAGACGACCAAG 5' 11 sense Y I 14 (10c) 3'TTGTCGTTTATC TTTCAAATTTTTTTGTGATTCAAA 5' * - antisense Y I 10 (8) 3'GTCAATCGTCAA TATTTATCGGACCTTTTCCATTCA 5' 14 sense Ya5 E 6 (4c) 3'AGGAACCCTCAG TTTTTTGAACGACTACCATAAGAA 5' # 12 antisense Ya5 E 21 (16) 3'AGGAACCCTCAG TTTTTTGAACGACTACCATAAGAA 5' # 17 antisense Ya5 E 21 (16) 3'CCATAGTCAGTT ATTTTGGATTTCTTTCTTGTTTAT 5' 13 antisense Ya5 E 22 (17) 3'ACAAGAGAAGTG TTTTCTTCTTGTATACGCCGGAAA 5' 15 sense Ya5 E 33 (25) 3'GTCCAAAACAAG TTCTTCACGCCATGGACGACTTAT 5' 16 antisense Ya5 E 47 (38) 3'CTTTGTGAAGTA TTTCGTCACGTTCCAACACCTCGT 5' 10 sense Yb8 E 12 (10a) 3'GGACTTAAAAAA TTTTTTCTCTTTCTGTTCCGGCCC 5' 17 antisense Yb8 I 14 (10c) 3'GTAAGCGGAGAA TTGTTACCAGAACACTTCCGAAAG 5' 12 antisense Yb8 E 21 (16) 3'TTCGATCGTAAC TTTGTTACTACAATTTAGACCAGT 5' 14 sense Yb8 E 22 (17) 3'ACAAGAGAAGTG TTTTCTTCTTGTATACGCCGGAAA 5' 15 sense Yb8 E 33 (25) 3'GGACATGGGATG TTTTTTGTTTGTTTGTTTGTTTGT 5' 16 antisense Yb8 I 48 (39) 3'ACGTTAAGTTTA TTTTTGCTTTGACACAGTTAATCA 5' 16 sense L1P1_orf2 E 23 (18) 3'CATGGAAATTAA ATTTTTAGCTCCCGGTCAATGATC 5' 13 sense LINE 1 E 39 (30) 3'AATACGAATAAA TTCTTTTACCAAGTAACATCTAAG 5' 3'ACTTTAAATGAA TTCTTTATTGACACTAAACCGAAG 5' 11 6 antisense antisense L1 T (n~120) I 9 (7) E 25 (19b) AA-TTTT L1 endonuclease cleavage consensus site *This integration site cannot be unequivocally determined due to an associated 71-bp deletion and the lack of a TSD. 20
Distribution of Alu & L1 insertions within the NF1 gene 1 (1) 6 (4c) 9 10 12 (7)(8)(10a) 14 21-23 25 (11)(16-18)(19b) ~1500 bp 33 (25) ~ 282 kb 39 (30) 47 (38) 49 (40) 58 (49) 21
Summary 18 pathogenic Alu and L1 insertions: highest no. of this type of mutations identified in a single disease gene Explanation: 1) RNA-based mutation analysis protocol improves detection of Alu/L1 insertions 2) NF1 gene may be a preferred target of L1- endonuclease mediated retrotransposition 22
Many thanks to: Tom Callens, Anne Wernstedt, Ludwine Messiaen all doctors who referred patients all patients and their families 23 Barbara McClintock (1902 1992) Nobel Laureate 1983