Biological Sciences Initiative. Human Genome



Similar documents
Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources

Human Genome and Human Genome Project. Louxin Zhang

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA

Chapter 6 DNA Replication

Human Genome Organization: An Update. Genome Organization: An Update

Structure and Function of DNA

1 Mutation and Genetic Change

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure enzymes control cell chemistry ( metabolism )

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!

SNP Essentials The same SNP story

CCR Biology - Chapter 9 Practice Test - Summer 2012

GENE REGULATION. Teacher Packet

Heredity - Patterns of Inheritance

Algorithms in Computational Biology (236522) spring 2007 Lecture #1

Bob Jesberg. Boston, MA April 3, 2014

Gene mutation and molecular medicine Chapter 15

Genetics Module B, Anchor 3

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology

Basic Concepts of DNA, Proteins, Genes and Genomes

Genomes and SNPs in Malaria and Sickle Cell Anemia

BioBoot Camp Genetics

Becker Muscular Dystrophy

Gene Switches A Model

Basic Concepts Recombinant DNA Use with Chapter 13, Section 13.2

Teacher Guide: Have Your DNA and Eat It Too ACTIVITY OVERVIEW.

Immunology Ambassador Guide (updated 2014)

12.1 The Role of DNA in Heredity

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison

Control of Gene Expression

14.3 Studying the Human Genome

Mitochondrial DNA Analysis

The world of non-coding RNA. Espen Enerly

Replication Study Guide

School of Nursing. Presented by Yvette Conley, PhD

Plant Growth & Development. Growth Stages. Differences in the Developmental Mechanisms of Plants and Animals. Development

The sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized:

Activity 7.21 Transcription factors

Translation Study Guide

Protein Synthesis How Genes Become Constituent Molecules

MUTATION, DNA REPAIR AND CANCER

Chapter 13: Meiosis and Sexual Life Cycles

Genetics Lecture Notes Lectures 1 2

Genetics. Biology Spring 2014

A and B are not absolutely linked. They could be far enough apart on the chromosome that they assort independently.

The Making of the Fittest: Evolving Switches, Evolving Bodies

MCAS Biology. Review Packet

Principles of Evolution - Origin of Species

DNA, RNA, Protein synthesis, and Mutations. Chapters

Genetic Technology. Name: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question.

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company

13.4 Gene Regulation and Expression

Single Nucleotide Polymorphisms (SNPs)

The following chapter is called "Preimplantation Genetic Diagnosis (PGD)".

Chapter 5: Organization and Expression of Immunoglobulin Genes

Gene Therapy and Genetic Counseling. Chapter 20

Concluding lesson. Student manual. What kind of protein are you? (Basic)

The Human Genome Project. From genome to health From human genome to other genomes and to gene function Structural Genomics initiative

AP Biology Essential Knowledge Student Diagnostic

About The Causes of Hearing Loss

A trait is a variation of a particular character (e.g. color, height). Traits are passed from parents to offspring through genes.

Bio EOC Topics for Cell Reproduction: Bio EOC Questions for Cell Reproduction:

Transcription and Translation of DNA

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College

Recombinant DNA and Biotechnology

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in

Next Generation Sequencing: Technology, Mapping, and Analysis

Sample Questions for Exam 3

Biology 274: Genetics Syllabus

Chromosomes, Mapping, and the Meiosis Inheritance Connection

Module 3 Questions. 7. Chemotaxis is an example of signal transduction. Explain, with the use of diagrams.

RNA and Protein Synthesis

BI122 Introduction to Human Genetics, Fall 2014

Final Project Report

Biology Notes for exam 5 - Population genetics Ch 13, 14, 15

To be able to describe polypeptide synthesis including transcription and splicing

The correct answer is c A. Answer a is incorrect. The white-eye gene must be recessive since heterozygous females have red eyes.

(1-p) 2. p(1-p) From the table, frequency of DpyUnc = ¼ (p^2) = #DpyUnc = p^2 = ¼(1-p)^2 + ½(1-p)p + ¼(p^2) #Dpy + #DpyUnc

How many of you have checked out the web site on protein-dna interactions?

Trasposable elements: P elements

Thymine = orange Adenine = dark green Guanine = purple Cytosine = yellow Uracil = brown

1865 Discovery: Heredity Transmitted in Units

EPIGENETICS DNA and Histone Model

Control of Gene Expression

Fact Sheet 14 EPIGENETICS

Transfection-Transfer of non-viral genetic material into eukaryotic cells. Infection/ Transduction- Transfer of viral genetic material into cells.

Genetics 301 Sample Final Examination Spring 2003

Amazing DNA facts. Hands-on DNA: A Question of Taste Amazing facts and quiz questions

Milestones of bacterial genetic research:

Influence of Sex on Genetics. Chapter Six

Mendelian and Non-Mendelian Heredity Grade Ten

Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs)

Mechanisms of Evolution

Cancer Genomics: What Does It Mean for You?

Searching Nucleotide Databases

GenBank, Entrez, & FASTA

Gene Mapping Techniques

Bio 102 Practice Problems Genetic Code and Mutation

Evolution (18%) 11 Items Sample Test Prep Questions

When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want

Transcription:

Biological Sciences Initiative HHMI Human Genome Introduction In 2000, researchers from around the world published a draft sequence of the entire genome. 20 labs from 6 countries worked on the sequence. The International Human Genome Project international effort begun in 1995 All data from this project is available to all online free! Historical Context 1865 - Mendel 1900-1925 Heredity resides in chromosomes, DNA is the genetic material 1925 1950 - Structure of DNA, double helix 1950 1975 How information is stored in DNA (DNAÆRNAÆprotein) Lab techniques such as cloning and sequencing 1975 2000 Sequencing of genes, small genomes, human genome Why sequence the human and other genomes? With the completion of the human genome we will no longer need to be smart and lucky to identify a gene (or genes) responsible for a disease, we can be systematic. Identification of genes and their functions will provide huge insight into molecular mechanisms and provide numerous targets for therapy. For example, finding that mutations leading to cystic fibrosis were located in a gene encoding a chloride ion channel led to a better understanding of the causes of ion imbalance in cystic fibrosis patients. Differences between individuals will again further our insight into molecular mechanisms and provide opportunities for individualized therapies. (Many different mutations in the chloride ion channel gene can lead to cystic fibrosis. A description of different treatments being tested for different CFTR mutations can be found in pages 7 10 of the lecture notes from our cystic fibrosis workshop. http://www.colorado.edu/outreach/bsi/k12activities/cysticfibrosis.html) Comparison of the human genome to that of other organisms will further studies of the evolution of genes, gene families, and different life forms University of Colorado 470 UCB Boulder, CO 80309-0470 (303) 492-8230 Fax (303) 492-4916 www.colorado.edu/outreach/bsi

Sequence comparison has led to a complete revision of taxonomy and development of a completely new tree of life with three domains. Sequencing the human genome will also allow us to uncover things we could not imagine in advance. For example, studying the sequence of the human genome is beginning to lead to an understanding of how non-coding sequences may be regulating gene expression at several different levels. Sequencing Technology 1980s 2 days and 1 person to get 600 bases of 10 samples Today in the Molecular Cellular and Developmental Biology department at CU Boulder 1 day and 1 person to get 600 bases of 192 samples The human genome was sequenced on machines with even higher throughput 2

Cold Spring Harbor s DNA Interactive website has some online activities, information, and interviews on sequencing, the public vs private sector projects, cost etc. To access this information go to www.dnai.org Click on genome. Then click on The Project. Size The human genome is 3 billion bases long New York Times spread out 6 pgs across would run from 4 th St. to 142 nd St. The sequence would take up 69,900 double pages of the New York Times If you printed the human genome in 12 font and stretched it out, it would run all the way from Penn Station, New York City to Union Station, Los Angeles. It would take 142 large phone books to contain the entire human genome. 23 pairs of chromosomes ranging in size from 246,122,627 base pairs Chromosome 1 44,626,493 base pairs Chromosome 21 Differences among humans An average of 1 in 1200 bases differ between any two humans. This is less than 0.1%. The average 0.1% difference is responsible for inherited differences among humans (physical traits, genetically inherited diseases) We refer to these differences as single nucleotide polymorphisms or SNPs 1.4 million SNPs have been identified and mapped. SNPs allow studies of: Genome mapping determining the location of genes linked to diseases or traits Evolution and migration of human populations Organization and evolution of the human genome Race there is more variability within a given ethnic group than between ethnic groups. You cannot tell what race someone is by looking at their DNA sequence. At Cold Spring Harbor s DNA Interactive site there is a page (genome fishing) that shows the size of the different chromosomes as well as a the locations of SNPs. A second page (gene spots) shows a small sampling of important genes found on each chromosome. www.dnai.org Click on genome on the right hand side Click on tour Click on Genome Fishing or Gene Spots 3

Mutation and Crossing Over Most new mutations in humans arise during meiosis. Mutations during meiosis occur two times more frequently in males compared to females. Recombination rates are higher in distal regions of chromosomes and on shorter chromosome arms Expect at least one crossover per chromosome arm in each meiosis Coding sequences Surprisingly, the human genome has an estimated 30,000 40,000 genes. This number is much lower than the previous estimate of 100,000 120,000 genes. 1 2% of the genome codes for protein This is similar to the number of genes in mouse or mustard weed, and only twice as many genes as flies or nematodes. Thus genome size and the number of genes do not account for vertebrate or human complexity. However, vertebrates have 5 times as many proteins as flies or worms. Sequencing of the genomes of various organisms including human, mouse, fly and nematode has allowed us to observe that the complexity in vertebrates is largely due to alternative splicing (several proteins made from one gene) gene duplication and divergence resulting in large gene families evolution of new protein domains rearrangement of existing protein domains in unique combinations Parasitic sequences 46% of the genome is parasitic DNA sequences (transposable sequences) These sequences are considered parasitic because they can copy themselves and move to a new place in the genome while leaving the original copy in place. These parasitic sequences have selfish motives they are concerned with their own reproduction and survival. However they have been important in many of the innovations in our genome and have been important in shaping genomes. Some of our regulatory elements and genes originated from these sequences They have played an active role in shaping genomes by rearrangement and creating and shuffling genes. These sequences may also be important in gene regulation. To the researcher, these sequences are a rich paleontological record. They provide information that will further the study of evolution of genes, families, species. Vertebrates vs other genomes (fly, nematode, plant) In vertebrates there is less removal of parasitic sequences. Vertebrates thus have older transposons than flies or nematodes. 4

60% of vertebrate transposable sequences two specific elements (LINE1 or Alu), other genomes have no predominant transposable sequence Humans vs mouse Transposition is much more common in mouse, the hominid genome is much more stable than any other genome studied to date. No one knows exactly why or what this means. 1 in 600 mutations in humans are due to transposition, compared to 1 in 10 for mouse. At Cold Spring Harbor s DNA Interactive site there is a page that is a flyover visual of a piece of a chromosome. It shows how parasitic elements, introns (non-coding parts of a genes), exons (coding portions of genes), and gene families are arranged and interspersed in a representative piece of chromosome; the short arm of chromosome 11. This part of chromosome contains the b-globin and olfactory receptor genes as well as an intergenic region. Note: The movies have no audio so you will need to scroll down and read the text below the movie as the movie is playing. www.dnai.org Click on genome on the right hand side Click on tour Click on Flyover choose one or more of the four pieces GC content GC rich regions are dark bands on chromosomes (associated with coding regions) Average GC content 41% GC content of a small region varies from 60 70% for coding sequences to 30%. CpG Islands CG is greatly under-represented in the human genome (1/5 of the expected frequency). Most CGs are methylated on the C, When the C is methylated it leads to spontaneous deamination of C forming U U is replaced with T by the repair system Vertebrates methylate their DNA as a defense mechanism against bacterial infection. We have specific molecules that recognize long stretches of unmodified DNA and direct an immune response against them. CpG islands are areas in which CG are not methylated and occur at the expected frequency. CpG Islands are of interest because they are associated with the 5 ends of genes (or pseudogenes). There are 28,890 CpG islands not in the repeat sequences Most have 60-70% GC content (expected for coding regions) 5

What s next Now we have the human genome sequenced what s next? The completion of the sequence does not mean that our understanding of the human genome is complete, rather it is just beginning. The data analysis phase of the project will take longer than the sequencing project itself and will yield information we can not yet even imagine. Identifying genes - most of the 30,000 human genes have not yet been. Identifying gene products and their functions the function of many of the identified genes is unknown. Identifying disease genes and designing treatments (some patient specific) Sequencing the genome of other organisms and animals Comparison of genomes to answer questions about evolution, both of specific organisms, and of genes and gene families. Identify regulatory sequences Traditional regulatory sequences up and down stream of genes to which proteins bind to activate or repress expression. Some transcribed sequences are not translated, instead the transcript itself acts in gene regulation There is extensive DNA modification that is also thought to play a role in gene regulation Finish identifying SNPs and their association with different traits and populations. About 3 million SNPs have been identified to date. 6

Activity Let s take a look at some random sequence. The following page contains a random set of bases. There are 50 bases per line. There are 46 lines for a total of 2300 bases. How many of these pages would it take to print out the whole human genome (assume 3 billion base pairs as the size)? Fill in the empty column of the table below. (Determine how many bases out of 2300 would be represent each characteristic) Characteristic % of genome # of bases out of 2300 Color Coding DNA 1.5% Green Parasitic DNA 46% Yellow Differences between humans 0.1% Pink To generate a visual representation of the % of different types of sequences that make up the human genome you will shade in bases on the sample sequence. Using the colored highlighters supplied, color in correct number of bases on the following page. In reality these different sequences are interspersed throughout the genome. However, for this activity, it doesn t matter which particular bases you color in. 7

AGTCGTGCGTGGTACGAGACACACACAGGGTCTTAAACTTAGCTGAGCA GAGATGGACGTGATGTGCATGTCGTAGTCGTAGCTGTAGCTGATCGTGT GCCGCGTAGCTGCCCCGTAGCTGTGTAATATACTGTATCGTAGCTGATC GTGACTGTACGTGATGCTGACGATCTGTGATGCTGAACACACAGCTATA GGTCGATGTGCAGCTAGCACGAGCTCGATGACGACGTAGCTGACACAC AGTGTAGACGTGTGACACACGTGCGGGCAAAACGTTGACGCACGTGAC GTAGCTGGCAGCAGTCTAGCGAGACGTGCTGATGCGATGAAAAACGTG TACTGGTTTTATCGAGAGGCGGCGCGAGTACGATATTAGCTATTACTGA TGTCGATGTCGATCGTAGTGAGCATGACTCGAACAGACGCAGGCAGTAA CAAAACGTGTAGCGCGCGCGATATAACGTCGATACGACAATATACGAG TACGTGTACGACCACACGTGACTATATCTACGTAGCTATATTATCGTATA TATATTTACGTGATTCAGTTACGATCGACCGTATATAGATGTCGAACCAT CATCGACGATAGCAGTCAGTCTAACGTCGATTAATTACTGCCTAGCATA TCGCAGTCTACGTAACTATCGATACACGCTACACACACCAGTAACCATC AACACAAAAATTTTTTAGGCATTACTTACAACAAACTTTCTATAGAGGA GAGAGGACTCCCCCCCCATCATATACGTACGTTGACGGATGTGGGACGT AGTGTACAGTGCTAGTGCTGTAGTGTGCTTATTTATCTTATGCTGTATTA CGTTTTTTGACACTGACTACGACACTACAGAAATAAGTAAGCCTATACG AACTCCCTAAGAAGAACTCACGACATACCGCCCGCCGCTCTCCTCCTAG TCGATAAGCGATTATAGCGGCGGATGTATGCGGCGATGTAGGCGTGTAT ATATTCGGTATATTACGGGCCGACGCTCTCTAGCTCTATAGCGATCGAG CGTGTAGTACGAACGGGATATCTTCTCTATCTGATCTTATCTAGGACGG ATTCAGTGATCGGCGAACGTGTAGCACACGTACGGAGTATATATCGGAT CTTATCGTATTGCGGAGCTTAGCGTAGTGCGATCTTAGCGTGATCTGTAG TGCTGATGCTAATGCGCGTATGCGGAGCTGTAGCGATCTCGCGCGATCG AGGGGGGGCACGTATGTCGACGGACACGCCAACGGTACAGGCTATTCT GAGGCAACCATAGTCGTGAACCATGCTTTGAGGCGTATTACGTGTAGTG CTGGCTGATGTCGCGTAGTCGCGCGCGAGGCGGAGTCGTTAACACAACC ACCAGTCGAGCGATTACGTGCGATTAAACCCAACAAAAAAAAAGTGTG TACGTGATGTGCGTGCCCGCGGCGATTCTCTTACCGCGGCCAACACGTA GTGCGATGTCGTGAGTATATATGTCTCTCTTTTCTAAACCATGTTAGTCA TGGTAGCCCATCGTGCTGTGCCGCATATTATACAAAACGTGTCTCCCCCT AGGTCGTACTATTCGTGATAGTCGTGTGATGTCGTGTGATGAACGTGTC GACTGTGTGACTGTAACACACCAACAGTGTGTACCACTACTTACGGCGG CGGGACGTACACGTGCCGCGATGCGCGATGCGCGATGTCGTAGGAGAG AGGATCGTGTACCACAGCTATCTACTGAGTCGTAGCTGTGAGCTGTGAT GGGAGGAACCCCATACCACTTCATTCTATCGTACCCAGTCCAGTGTCGA TCGTGCTAGCCACACGTCTCTCCTCTGACCACGTCACCGTGACTGTGTAC GTGCTAGCTGATCGTGATCGTGACACCACGCATATGAACCAACATACCA TTATATATTATCCATCAGGTGGATCGTGTACGACGTGTACGTGTACGTGT ACCTAGCGTATCGATATTATATACGATCATATAGTACCCGCCGCCACAA AAAACGTATAGCTGCCCCCCCATGTGCTTAGACGAGCGTTAAAAAAATG AGAAGGGGGACATTATCAGTCTATTGAAAGGATATTTACACCCCCATTA GTGGCGAGGCCCATTTATTATATTATATAGTGCTAGCTCCTCTTCTTATT CTTCTCTCTATTTACGGTAGCTGTACCCTACGGGGGGGATTCTTATGCGT AGGAAAAAAAAACGTGTAGGCGGAGCTTTTATGCTAATCGGTATGCGA 8

Supplemental Information Types of transposable sequences long interspersed elements (LINEs 21%) have 2 open reading frames, encode their own enzymes required to copy themselves and move (polymerase, recombinase) Alu sequences are an example short interspersed elements (SINEs 13%) do not encode their own proteins use proteins encoded by LINEs to move retrotransposons (8%) encode reverse transcriptase and ability to move other DNA transposons (2%) 9