Dal proge*o genoma umano ad oggi: evoluzione delle tecniche di sequenziamento, analisi genomica e proteomica e prospe9ve future!

Transcription

1 Dal proge*o genoma umano ad oggi: evoluzione delle tecniche di sequenziamento, analisi genomica e proteomica e prospe9ve future! David Horner Dipar.mento di Bioscienze Università degli Studi di Milano

2 Come va sequenziato il DNA? Sequenziamento Sanger (1978 oggi): Cos. rela.vamente al. Richiede molto tempo per preparazione di campioni Produce poche leluri LUNGHI (1000 nt) Pochi errori di sequenziamento

3 Sequenziamento Sanger (1978)

4 Sequenziamento Sanger (1978)

5 1) Frammentare in modo casuale, clonare fammen. in plasmidi Genome 3) Individuare un clone sovraposto. Sequenziarlo e costruire un frammento piu lungo 2) Sequenziare un fragmento (a caso) 4) Andare al passaggio 2 (fino alla fine!)

6 Genomi, quanto sono grandi? plasmids viruses bacteria fungi plants algae insects mollusks bony fish amphibians rep.les birds mammals

7

8 Sequenziamento Sanger (anni 1990) 96 reazioni in parallelo 1000 nt x reazione

9 Robot!

10 Sinclair ZX

11 Computer

12 Whole Genome Shotgun Approach

13 Assembly by overlap

14 Sequenze Ripetute Sequenze ripetute Sequenze uniche Se le sequenze ripetute sono meno lunghe del lelure di sequenziamento, non c è problema A B C

15 Sequenze Ripetute Se sono piu lunghi, NON POSSIAMO ASSEMBLARE! A B C A B c? A C B?

16 Steps to Assemble a Genome Some Terminology read 1. Find a overlapping long word reads that comes out of sequencer mate pair a pair of reads from two ends 2. of Merge the same some insert good fragment pairs of reads into longer contigs con-g a con.guous sequence formed by several overlapping reads with no gaps 3. Link contigs to form supercontigs supercon-g an ordered and oriented set (scaffold) of con.gs, usually by mate pairs 4. Derive consensus sequence..acgattacaataggtt.. consensus sequence derived from the sequene mul.ple alignment of reads in a con.g

17 Con.gs and scaffolds

18 Shot Gun Sequencing 2. Library 1. Genome fragmentation 3. Sequences 4. Genome assembly by overlap

19 Timeline

20 The Human Genome Meet Your Genome (The Wheat genome (16.9 Gbp) is more than 5.mes bigger than the human genome and 80% of its genome consists of repe..ve sequences)

21 Quanto è COMPLESSO il genoma? Il genoma Umano c. 3Gb (Il Genoma di FRUMENTO (16.9 Gbp) è piu di 5 VOLTE piu grande di quello umano. 80% consiste di elemen. ripetu.)

22 Physical Mapping

23 Top down sequencing Genome fragmentation Physical map Subclone library Sequence clones by walking or by SHOTGUN strategy

24 Human Genome Project 16/02/2001

25 OK, abbiamo sequenziato il genoma. Ora che cosa fare? Dove sono I geni? Sequenziare ed allineare cdna (mrna) al genoma

26 Ma quali gene/allele sono responsabile per feno.pi di interesse? Dobbiamo paragonare genomi di tan. individui diversi e fare sta.s.ca per capire feno.pi complessi. Cioè, dobbiamo sequenziare TANTI individui della stessa specie ed associare feno.pi con geno.pi. Genome Wide Associa.on Studies (GWAS)

27 GWAS + Human nella leleratura Prima di 2004 (60 ar.coli) Da 2004 in poi (>14000 ar.coli) Sono sta. sequenzia. > genomi umani da 2004 in poi, Come è stato falo?

28 Revolu.onary techniques in molecular gene.cs Molecular cloning Sanger sequencing PCR Gel Electrophoresis Bloung (Southern/Northern/Western etc) Expression cloning (microarrays) Next Genera.on Sequencing

29 Next Genera.on Sequencing (Massively Parallel /Second Genera.on) HIGH throughput (lots of data) Rela.vely low cost Transversal in terms of applica.on

30 Read Length is Not As Important For Resequencing % of Paired K-mers with Uniquely Assignable Location 100% 90% 80% 70% 60% 50% 40% 30% 20% 10% 0% E.COLI HUMAN Length of K-mer Reads (bp)

31 Cost per megabase of DNA sequence

32 Next-Generation Sequencing A number of platforms using different strategies and chemistries, and with different throughput are entering the market. Ion Proton PacBio Roche / 454 Genome Sequencer FLX.tanium (800 bp, 800 Mb / run) Illumina / Solexa Gene.c Analyzer HiSeq 2000 (150x2 bp, 600 Gb / run) Applied Biosystems SOLiD 4 System TM (100x2 bp, 400 Gb / run)

33 When has a genome been fully sequenced? Fold coverage % sequenced

34 Illumina Bridge PCR Sequencing by synthesis using fluorescent reversible terminators

35 Technology Overview: Solexa/Illumina Sequencing

36 Immobilize DNA to Surface Source:

37 Technology Overview: Solexa Sequencing

38 Bridge PCR DNA fragments are flanked with adaptors. A flat surface coated with two types of primers, corresponding to the adaptors. Amplifica.on proceeds in cycles, with one end of each bridge tethered to the surface. Used by Solexa.

39 Sequence Colonies The bases are reversible terminators, only one base can be added. Then they are modified so that the next round of extension can occur.

40

41 Sequence Colonies Each base has a different Fluor (color). Excited by laser, and color is read.

42 Illumina sequencers sequencing-by-synthesis coupled with bridge amplification Available versions: HiSeq 2000 (up to 600 Gb, 250x2 bp reads) HiSeq 1000 (up to 300 Gb, 250x2 bp reads) Genome Analyzer (up to 95 Gb, 150x2 bp reads) MiSeq pla=orm (up to 6 Gb, 250x2 bp reads)

43 Da 2008

44

45 SNP calling The basic principle is simple! ACTTTTGCCCTGTGTCTAAAATGCGTCGTAGCATGT - reference! ACTTTTGCCCTGTGACTAAAATG!!!read1! TTGCCCTGTGACTAAAATGCGT!!!read2! TGCCCTGTGACTAAAATGCGTA!!read3! GCCCTGTGACTAAAATGCGTAG!!read4! GCCCTGTGACTAAAATGCGTAG!!read5! CCTGTGACTAAAATGCGTAGTAG!!read6! This looks like a homozygous SNP

46 SNP calling And this one looks heterozygous ACTTTTGCCCTGTGTCTAAAATGCGTCGTAGCATGT - reference! ACTTTTGCCCTGTGACTAAAATG!!!read1! TTGCCCTGTGTCTAAAATGCGT!!!read2! TGCCCTGTGACTAAAATGCGTA!!read3! GCCCTGTGTCTAAAATGCGTAG!!read4! GCCCTGTGACTAAAATGCGTAG!!read5! CCTGTGTCTAAAATGCGTAGTAG!!read6!

47 On average, we think that we will find a SNP (Single Nucleo.de Polymorphism) between 2 Human individuals about every 2000 bases. 99.5% iden.ty maybe 1,500,000 differences!

48 Structural Variation (SV) l Any DNA sequence altera.on other than a single nucleo.de subs.tu.on l l l l l l l copy number variations (CNV), transposon movement Expansion of trinucleotide and other simple repeats insertions-deletions (indels) translocations inversions the vast majority of SV events are small indels Human genomes differ more as a consequence of structural varia.on than of single- base- pair differences* Causal events in hereditary diseases somatic SV markers for GWAS / mapping studies

49 Copy Number Varia.on (CNVs) so... how representative is the reference genome? 49

50

51

52 Applica.ons of NGS playorms DNA sequencing - genome resequencing (SNPs, CNV, GWAS) - de novo sequencing - identification of genome structural variants (cancer genome) - 3D chromatin interactions - Epigenomics (chromatin state and genome methylation) - Metagenomics (taxonomic analysis of environmental samples) RNA sequencing - Qualitative and quantitative analysis of the Transcriptome - Identification and characterization of mirnas and other ncrnas - RNA editing - Metatrancriptomics (functional analysis of envronmental samples)