Clones ORFs cdna Proteins Tags Vectors Markers Etc.
|
|
|
- Martin Mitchell
- 10 years ago
- Views:
Transcription
1 OmicsLink Expression-Ready ORF cdna Clones Clones ORFs cdna Proteins Tags Vectors Markers Etc. GeneCopoeia The original source for expression-ready human and mouse full-length ORF cdna constructs. Express any protein 2 Perform multiple applications 3 Streamline tasks 4 Answer questions 5 Choose a platform 6 Select a tag 7 Search the gene 8 Select gene families 9 View vector tables 10 Inquire about custom services 13 Publish 14 Choose GeneCopoeia 15 Contact us 16
2 Express any protein with OmicsLink full-length ORF cdna clones Exclusive GeneCopoeia is the original manufacturer of expression-ready full-length ORF cdna clones. OmicsLink clones deliver high levels of expression, increase productivity and save time. Complete GeneCopoeia offers the largest collection of human and mouse full-length protein-coding ORF cdna clones. 2 OmicsLink Expression-Ready ORF cdna Clones are constructed from carefully curated and sequencevalidated full-length cdnas and cdnas from highquality libraries. 45,000 human and mouse genes Fully sequenced 80 vectors, 50 fusion tags in any system. Flexible OmicsLink ORF cdna clones are available for expression in any system including mammalian, lentiviral and bacterial. All constructs are optimized for protein expression, purification and functional assays in a variety of cell systems as well as in cell-free transcription and translation coupling systems. Save time Publish faster Increase productivity EXPRESSWAY TO DISCOVERY
3 for any application. Versatile OmicsLink ORF cdna clones are carefully designed for a variety of expression and functional studies using a range of cell systems. OmicsLink clones are available in a variety of expression vectors that provide a choice of features including promoters, selection markers and fusion tags. Mammalian Express proteins in E. coli mammalian cells or other common cell types Express proteins in vitro and at high success rate with cell-free translation systems Use tags for protein purification and production Use tags for protein detection and wide a range of functional assays Generate in situ hybridization probes for tissue or organ expression profiling Restore gene functions for shrna or mirna functional validation studies 3 Bacterial Lentiviral HTC/HTS Insect OmicsLink TM ORF cdna Vector Systems Yeast Uniformity and high quality of OmicsLink Expression- Ready ORF cdna Clone Sets make them ideal for largescale high-content and high-throughput screening (HTC/ HTS) studies in functional genomics, proteomics and systems biology. Cell Free Comprehensive GeneCopoeia offers comprehensive suites of optimized, reliable and affordable gene- and protein-based products, including recombinant proteins, polyclonal and monoclonal antibodies, RNAi products, and other life sciences tools and products. In addition, custom cloning and protein production services are available.
4 Streamline tasks OmicsLink Expression-Ready Clones are ready for in vitro and in vivo expression eliminating time-consuming cloning and verification steps. All clones are fully-sequenced and many have been verified in ongoing expression testing. Steps to acquire full-length expression-ready cdna ORF clones Option 1 Get expression-ready from GeneCopoeia Option 2 Other vendors or do-it-yourself Template cdna PCR Protein coding ORFs Restriction enzyme digestion Empty Vector 4 Insert Digested Vector Ligation Transformation Clones selection Validation PCR Restriction enzyme digestion Sequencing Expression-ready clones Expression-ready clones Multiple applications Application EXPRESSWAY TO DISCOVERY
5 Answer perplexing questions sooner What impact does this protein have on cellular functions? Which proteins does the protein of my interest interact with? Which cell signals are affected? OmicsLink expression-ready clones simplify the following applications: In vivo and in vitro protein production Functional studies using model cell lines or whole organisms Transduction into stem, primary and other difficult-to-transfect cells Cellular imaging for protein trafficking, localization, immobilization, Functional rescue in shrna and mirna studies High-throughput screening assays Protein-DNA and protein-protein interaction studies A comprehensive suite of GeneCopoeia expression ready constructs enables asking and answering a broad spectrum of questions. Gene knockdown with shrna collections and mirna precursor and target validation clones are available under the OmicsLink clone family. 5 OmicsLink TM ORF cdna Clone Collection miexpress TM mirna Expression Clones OmicsLink TM shrna Clone Collection mitarget TM mirna Target 3 UTR Validation Clones All-in-One TM qrt-pcr Kits
6 Choose the right platform OmicsLink Expression-Ready ORF cdna Clones represent the largest collections of human and mouse full-length protein-coding ORF cdna clones. Choose among 80 vectors and 50 different fusion tags to design the right clone for your task and begin immediately. The clones are optimized for protein expression, easy purification and functional assays in a variety of cell systems including cell-free transcription and translation. 6 ORFEXPRESS Gateway PLUS Shuttle Clones allow rapid and simple transfer of ORF inserts into any Gateway destination expression vector for expression and functional analysis of target proteins in various host cells. Multiple cloning sites flanking the ORFs make these clones compatible with traditional cloning systems that utilize classical restriction enzyme digestion and ligation cloning methods. Lentiviral Technology IRES Technology Gateway Shuttle Technology HaloTag Technology OmicsLink Expression-Ready ORF cdna Clones Cell Free Technology SNAP-Tag Technology AviTag Technology Internal Ribosome Entry Site (IRES) allows coordinated and efficient co-expression of two genes with the same promoter in a single vector. When reporter and target genes are simultaneously expressed, biological activities of the target proteins are minimally affected. AviTag technology is based on site-specific in vitro or in vivo biotinylation of a short tag sequence enabling specific or reversible binding of avidin or streptavidin to biotin for immobilization, purification and visualization of the tagged target proteins. HaloTag is a novel multi-functional protein tag that binds covalently and specifically to a variety of synthetic ligands, enabling tagged proteins to be labeled with fluorophores for in vitro or in vivo imaging or with affinity agents for purification. EXPRESSWAY TO DISCOVERY
7 .from the widest selection of promoters, tags and selection markers available. OmicsLink ORFs and genes are available in more than 80 different types of expression vectors offering a choice of more than 50 fusion tags and enabling expression in mammalian, bacterial, insect, or yeast cells as well as cellfree expression systems. GeneCopoeia Technical Services is ready to help you select the best tag to meet your needs. Promoters Selection markers Fusion tags Cell systems CMV, T7, Tac, EF1α, GAL1, padh, AcMNPV polyhedrin Neomycin, puromycin, hygromycin, blastamycin, zeomycin egfp, eyfp, ecfp, mcherry, HaloTag, AviTag, SNAP-Tag, His6, Flag, GST, MBP, HA, Myc, Avi+ IRES-Biotin ligase, Myc+ IRES-eGFP, IRES-eGFP, IRES- Neomycin, and 35 other different types. Bacterial, mammalian, lentiviral, insect, yeast, wheat germ cellfree systems 7 Fusion tag Purification Increase solubility Ab-IP Cellular labeling His + +/- + Sumo/His-Sumo GST MBP Flag/3xFlag + +/- + + HA/3xHA + ++ GFP/YFP/RFP +++ cmyc + + AviTag His-AviTag Halo-Tag
8 Find your gene with a simple search Keyword BLAST Pathway Search products by Gene and disease associations Gene ontology Gene families Six online search tools for finding the OmicsLink ORF cdna clone you need Keywords Sequence homology (BLAST) Gene families and groups Gene ontology classification Gene and disease associations Signal and metabolic pathways Multiple options for searching individual clones with the online search query tool Gene description Gene symbols and aliases Nucleotide accessions UniGene cluster IDs Entrez gene IDs Catalog numbers or product IDs 8 Simple search Search products/clones Choose search type Specific field Click on Product ID Choose a vector type Add to shopping cart Proceed with order BLAST Easy search to find your favorite clones from GeneCopoeia 1. Go to Search products/clones webpage. 2. Choose any of three options provided to start the search Use Simple Search. Type any keyword. (Description, Nucleotide accession, Entrez gene ID, Symbols/Aliases or Catalog/product ID) Search by a particular field Search by BLAST 3. The search engine gives options based on the search query entered. Click on the column Product ID. 4. The returned webpage contains brief annotation informationfor the gene corresponding to chosen product ID. Choose among 80 different ready-for-expression vector types including mammalian, bacterial, lentiviral, insect and yeast. Gateway shuttle system and ORFeome Collaboration clones are also available. Related products with the clone of interest are also listed for quick access. 5. To learn more about the specific gene or to view detailed gene annotation page, click on Product ID again. 6. To view price and proceed with the order, select the appropriate expression vector type, then click on Add to Shopping Cart. EXPRESSWAY TO DISCOVERY
9 or use pre-selected gene families or disease groups More than 40,000 OmicsLink ORF clones have been curated and categorized into various gene families, groups, ontological classifications, pathways and disease associations using GeneCopoeia bioinformatics analysis tools. Gene families and disease associations Based on GeneCopoeia s proprietary literature mining algorithm, over 10,000 genes have been associated with major disease categories. Browsing these associations using the Gene Families and Diseases browser on the GeneCopoeia Website search page makes finding genes of interest straightforward and convenient. Disease Families ORF cdnas Gene Families ORF cdnas Cardiovascular diseases 1596 Congenital anomalies and genetic diseases 3978 Digestive system diseases 864 Diseases of the blood and bloodforming organs Endocrine, metabolic and nutrition diseases Immunologic diseases 3644 Infectious diseases 3536 Mental disorders 1805 Musculoskeletal system diseases 946 Neoplasms 8950 Nervous system and sense organs diseases 2404 Other diseases 141 Respiratory System diseases 565 Skin and connective tissue diseases 866 Symptoms and general pathology 2022 Urologic and Genital Diseases 1304 Cytokines 315 Cytokine receptors 152 Druggable target genes 6245 G protein-coupled receptors 718 Histone modification enzymes 38 Histone proteins 66 Ion channels 463 Membrane-bound proteins 2138 Nuclear hormone receptors 105 Other kinases 201 Proteases 625 Protein kinases 933 Protein phosphatases 293 Surface antigens (CD) 263 Transcription factors 1096 Organelle markers
10 Mammalian Expression Vectors with CMV Promoter and Neomycin Selection 10 Vector Tag Protease Site preceiver-m01 N-His N/A preceiver-m02 N/A N/A preceiver-m29 N-eGFP N/A preceiver-m03 C-eGFP N/A preceiver-m15 N-eYFP N/A preceiver-m16 C-eYFP N/A preceiver-m32 N-eCFP N/A preceiver-m33 C-eCFP N/A preceiver-m04 N-GST EK preceiver-m05 N-Avi N/A preceiver-m48 N-Avi+ IRES-Biotin ligase N/A preceiver-m17 C-Avi N/A preceiver-m06 N-3xHA N/A preceiver-m07 C-3xHA N/A preceiver-m08 C-3xHA-His N/A preceiver-m45 C-3xHA+ IRES-eGFP N/A preceiver-m09 C-Myc N/A preceiver-m10 C-Myc-His N/A preceiver-m47 C-Myc+ IRES-eGFP N/A preceiver-m11 N-Flag N/A preceiver-m12 N-3XFlag N/A preceiver-m13 C-Flag N/A preceiver-m46 C-Flag+ IRES-eGFP N/A preceiver-m14 C-3XFlag N/A preceiver-m24 N-SNAP N/A preceiver-m26 C-SNAP N/A preceiver-m49 N-HaloTag Tev protease preceiver-m50 C-HaloTag Tev protease preceiver-m55 N-mCherry N/A preceiver-m56 C-mCherry N/A preceiver-m01 N-His N/A Yeast Expression Vectors Vector Promoter Host Cell Selection Marker Tag Protease Site preceiver-y01 GAL1 S. cerevisiae N/A C-His N/A preceiver-yad padh Yeast N/A GAL4AD N/A preceiver-ybd padh Yeast N/A GAL4DB N/A EXPRESSWAY TO DISCOVERY
11 Lentiviral Expression Vectors with CMV Promoter for Stem, Primary and Other Difficult-to-Transfect Cells Vector Selection Marker Tag preceiver-lv01 No N/A preceiver-lv31 No IRES-eGFP preceiver-lv36 No IRES-luciferase preceiver-lv40 Neomycin IRES-Neomycin preceiver-lv21 Neomycin N/A preceiver-lv02 No C-3xHA preceiver-lv32 No C-3xHA + IRES-eGFP preceiver-lv52 N/A C-3xHA+IRES2-eGFP preceiver-lv06 Neomycin C-3xHA preceiver-lv23 Neomycin N-Flag preceiver-lv03 No C-Flag preceiver-lv33 No C-Flag + IRES-eGFP preceiver-lv53 N/A C-Flag+IRES2-eGFP preceiver-lv07 Neomycin C-Flag preceiver-lv19 Neomycin N-eGFP preceiver-lv04 No C-eGFP preceiver-lv08 Neomycin C-eGFP preceiver-lv20 Neomycin N-eYFP preceiver-lv05 No C-eYFP preceiver-lv09 Neomycin C-eYFP preceiver-lv34 Neomycin N-eCFP preceiver-lv61 No C-eCFP preceiver-lv62 Neomycin C-eCFP preceiver-lv35 No N-Avi + IRES-Biotin ligase preceiver-lv26 Neomycin N-Avi preceiver-lv10 Neomycin C-Avi preceiver-lv25 Neomycin N-Myc preceiver-lv17 Neomycin C-Myc preceiver-lv18 Neomycin C-Myc-His preceiver-lv43 No C-Myc+ IRES-eGFP preceiver-lv70 N/A C-Myc+IRES2-eGFP preceiver-lv44 No C-Myc+ IRES-eYFP preceiver-lv47 Neomycin C-Myc+IRES-Neomycin preceiver-lv64 Neomycin N-HaloTag* preceiver-lv65 Neomycin C-HaloTag* preceiver-lv69 N/A C-Myc+IRES-mCherry preceiver-lv71 Puromycin N-mCherry preceiver-lv72 Neomycin C-mCherry preceiver-lv41 Neomycin N/A 11 *Tev protease site EF1a promoter
12 Insect Expression Vector Vector Promoter Host Cell Selection Marker Tag Protease Site preceiver-i01 AcMNPV polyhedrin Insect cell N/A N-His Tev ORFEXPRESS Gateway PLUS Shuttle Vector (Gateway pdest compatible) Vector Promoter Host Cell Selection Marker Tag Protease Site pdonr Vector ORFEXPRESS Shuttle Clone (Gateway PLUS Clone) N/A N/A N/A N/A Bacterial Expression Vectors (14 types) 12 Vector Promoter Host Cell Selection Marker Tag Protease Site preceiver-b01 T7 E. Coli N/A N-His N/A preceiver-b02 T7 E. Coli N/A N/A N/A preceiver-b03 T7 E. Coli N/A N-GST Tev preceiver-b04 T7 E. Coli N/A N-GST EK preceiver-b05 Tac E. Coli N/A N-GST Tev preceiver-b06 Tac E. Coli N/A N-GST EK preceiver-b07 Tac E. Coli N/A N-MBP Tev preceiver-b08 Tac E. Coli N/A N-MBP EK preceiver-b09 T7 E. Coli N/A N-Avi N/A preceiver-b10 Tac E. Coli N/A N-Flag N/A preceiver-b11 Tac E. Coli N/A N-His N/A preceiver-b12 Tac E. Coli N/A HisSUMO SUMO protease preceiver-b13 T7 E. Coli N/A HisSUMO SUMO protease preceiver-b31 T7 E. Coli N/A C-His N/A Wheat Germ Cell-Free Expression Vectors (8 types) Vector Promoter Host Cell Selection Marker Tag Protease Site preceiver-wg02 T7 cell free N/A N-His Factor Xa preceiver-wg03 T7 cell free N/A N-HisSUMO CoolCutter TM preceiver-wg04 T7 cell free N/A N-AviSUMO CoolCutter TM preceiver-wg05 T7 cell free N/A N-HisAviSUMO CoolCutter TM preceiver-wg09 T7 cell free N/A HisGST TEV preceiver-wg16 T7 cell free N/A N/A N/A preceiver-wg31 T7 cell free N/A N-HisSUMOAvi CoolCutter TM preceiver-wg33 T7 cell free N/A N-TrxHisSUMO CoolCutter TM EXPRESSWAY TO DISCOVERY
13 Custom Services from GeneCopoeia Custom gene synthesis GeneCopoeia offers de novo gene synthesis services for any gene that is not currently available. Guaranteeing 100% sequence accuracy, GeneCopoeia can also customize sequence composition, splicing variants and functional domains or fragments. GeneCopoeia scientists use codon optimization techniques to ensure high levels of expression in host cells. Synthesized genes can be delivered in any of more than 80 different vector types at no additional custom service fee. Custom cloning and mutagenesis GeneCopoeia offers a full spectrum of high-quality custom cloning services at very low costs and with speedy delivery. 13 Protein production With GeneCopoeia custom protein services, you can skip cloning and expression steps. The protein production facility uses a range of host-cell and cellfree expression systems including E. coli, insect, yeast, CHO and mammalian cells as well as wheat germ cell-free systems. Protein expression, solubility and yield are significantly increased by using a variety of unique fusion tags that are not available in the market. Antibody production GeneCopoeia custom services for poly- and monoclonal antibody production specializes in using recombinant proteins and different animal species for unmatched low costs and short delivery times.
14 Overview of GeneCopoeia Product Platform 14 Publish faster With GeneCopoeia as your partner, ready-to-go constructs will help you realize robust and reproducible results quicker helping you to publish sooner. Blish, K et al. (2008) A Human Bone Morphogenetic Protein Antagonist Is Down-Regulated in Renal Cancer, MBC Online, 19 (2): [BMP-7, DKK1, Noggin and Wnt-3a] Chiu, S et al. (2009) Over-expression of EphB3 enhances cell cell contacts and suppresses tumor growth in HT-29 human colon cancer cells, Carcinogenesis, 30(9): Chu, C et al. (2009) Conversion of MDCK cell line to suspension culture by transfecting with human siat7e gene and its application for influenza virus production, PNAS, 106 (35): [V1581, C-eGFP tag] Dagda, R et al. (2009) Loss of PINK1 Function Promotes Mitophagy through Effects on Oxidative Stress and Mitochondrial Fission, J. Biol. Chem., 284 (20): [Parkin, HA tag and PINK1, C-3xFlag tag] Delisle, B et al. (2009) Small GTPase Determinants for the Golgi Processing and Plasmalemmal Expression of Human Ether-a-gogo Related (herg) K+ Channels, J. Biol. Chemistry, 284(5): [Rab Transcripts] Muik, M et al. (2008) Dynamic Coupling of the Putative Coiled-coil Domain of ORAI1 with STIM1 Mediates ORAI1 Channel Activation, The Journal of Biological Chemistry, 283(12): [STIM1, C-eYFP tag] Olma, M et al. (2009) An interaction network of the mammalian COP9 signalosome identifies Dda1 as a core subunit of multiple Cul4-based E3 ligases, Journal of Cell Science, 122: [Lrr1 entry clone] Pérot, G et al. (2009) Strong Smooth Muscle Differentiation Is Dependent on Myocardin Gene Amplification in Most Human Retroperitoneal Leiomyosarcomas, Cancer Research, 69: [EX-E0450-Lv06] Ruvolo, V et al. (2008) PKR Regulates B56α-mediated BCL2 Phosphatase Activity in Acute Lymphoblastic Leukemia-derived REH Cells, J. Biol. Chem., 283(51): [PPP2R5A, N-HA tag] Soni, K et al. (2009) Coatomer-dependent protein delivery to lipid droplets, Journal of Cell Science, 122: [ADRP GFP tag] Taguchi, Y et al. (2009) Specific Biarsenical Labeling of Cell Surface Proteins Allows Fluorescent- and Biotin-tagging of Amyloid Precursor Protein and Prion Proteins, MBC Online, 20(1): [APP695] Zhang, Z et al. (2009) A Conserved Na+ Binding Site of the Sodiumcoupled Neutral Amino Acid Transporter 2 (SNAT2), J. Biol. Chem., 284 (37): [SNAT2, C-eYFP tag] EXPRESSWAY TO DISCOVERY
15 Choose GeneCopoeia GeneCopoeia and its joint venture FulenGen have manufactured and released the largest number of full-length protein-coding ORF cdna clones in multiple vector systems with a wider selection of features than is available anywhere else. GeneCopoeia clones are suitable for a variety of protein expression, purification and functional assay applications and can be used with many cell types as well as with cell-free transcription and translation coupling systems for large-scale functional genomics and proteomics studies. Operating since 2000, GeneCopoeia is the original manufacturer and provider of expression-ready, full-length clones for academic and governmental research institutes as well as pharmaceutical and biotechnology industries. With a focus on innovative technologies for developing products as well as unique tools and services for research, discovery and product development in the areas of biological and biomedical research, GeneCopoeia provides accelerated pathways to discovery, strong guarantees and the highest possible quality. 15 The ORFeome Collaboration GeneCopoeia is a member of the ORFeome Collaboration, funded by the National Institutes of Health (NIH) and National Center for Biotechnology Information (NCBI), which provides full-length ORF clones to the research community. Formed in 2005 to meet the research community's need for an unrestricted source of sequence-validated full-length human cdna clones in a format allowing easy transfer into virtually any type of expression vector, the collaboration aims to provide at least one fully sequenced, full-length clone for each of the approximately 18,500 currently known human genes. ORFeome Collaboration clones require transfer into protein expression vectors and are available without restriction to researchers worldwide through multiple commercial distributors including GeneCopoeia. The GeneCopoeia Guarantee GeneCopoeia asserts that all full-length OmicsLink Expression Clones are free of artificial frame-shifting variations including deletion and insertions as well as translation termination mutations (point mutations that result in a pre-mature stop codon).
16 GeneCopoeia Headquarters 9620 Medical Center Drive, Suite 101 Rockville, MD USA Contact GeneCopoeia PHONE FAX WEBSITE China FULENGEN CO., LTD. 8F, BUILDING D, GUANGZHOU INTERNATIONAL BUSINESS INCUBATOR, GUANGZHOU SCIENCE PARK, GUANGZHOU, CHINA (510663) TEL: FAX: Distributors Japan Cosmo Bio Co., Ltd. ProteoGenesys, Inc. Europe imagenes GmbH LabOmics S.A. South Korea Cosmo Genetech Co, Ltd. Taiwan Integrated Bio Ltd. Singapore Centrogen Technologies Pte Ltd. India BioLinkk GeneCopoeia Products are for Research Use Only Copyright 2009 GeneCopoeia Inc. Trademarks: GeneCopoeia, RecJoin, MiExpress, mitarget, OmicsLink CoolCutter, ORFEXPRESS (GeneCopoeia Inc). Gateway (Invitrogen) OMB1-0909
KMS-Specialist & Customized Biosimilar Service
KMS-Specialist & Customized Biosimilar Service 1. Polyclonal Antibody Development Service KMS offering a variety of Polyclonal Antibody Services to fit your research and production needs. we develop polyclonal
Bio-Reagents Gene synthesis Peptide Synthesis Protein Expression Antibody Production. Life Science Products and Services
Bio-Reagents Gene synthesis Peptide Synthesis Protein Expression Antibody Production Life Science Products and Services Since 2002, Biomatik has provided worldwide researchers in life science discovery
BaculoDirect Baculovirus Expression System Free your hands with the BaculoDirect Baculovirus Expression System
BaculoDirect Baculovirus Expression System Free your hands with the BaculoDirect Baculovirus Expression System The BaculoDirect Baculovirus Expression System gives you: Unique speed and simplicity High-throughput
Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
Recombinant DNA and Biotechnology
Recombinant DNA and Biotechnology Chapter 18 Lecture Objectives What Is Recombinant DNA? How Are New Genes Inserted into Cells? What Sources of DNA Are Used in Cloning? What Other Tools Are Used to Study
Expression and Purification of Recombinant Protein in bacteria and Yeast. Presented By: Puspa pandey, Mohit sachdeva & Ming yu
Expression and Purification of Recombinant Protein in bacteria and Yeast Presented By: Puspa pandey, Mohit sachdeva & Ming yu DNA Vectors Molecular carriers which carry fragments of DNA into host cell.
Superior TrueMAB TM monoclonal antibodies for the recognition of proteins native epitopes
Superior TrueMAB TM monoclonal antibodies for the recognition of proteins native epitopes Outlines Brief introduction of OriGene s mission on gene-centric product solution. TrueMAB monoclonal antibody
Custom Antibodies & Recombinant Proteins
Custom Antibodies & Recombinant Proteins INTRODUCTION Custom services to meet your research and development requirements Improvements in health, medicine and diagnostics over the past century can be largely
How many of you have checked out the web site on protein-dna interactions?
How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss
Protein Expression. A Practical Approach J. HIGGIN S
Protein Expression A Practical Approach S. J. HIGGIN S B. D. HAMES List of contributors Abbreviations xv Xvi i 1. Protein expression in mammalian cell s Marlies Otter-Nilsson and Tommy Nilsso n 1. Introduction
CUSTOM ANTIBODIES. Fully customised services: rat and murine monoclonals, rat and rabbit polyclonals, antibody characterisation, antigen preparation
CUSTOM ANTIBODIES Highly competitive pricing without compromising quality. Rat monoclonal antibodies for the study of gene expression and proteomics in mice and in mouse models of human diseases available.
Your partner in immunology
Your partner in immunology Expertise Expertise Reactivity Reactivity Quality Quality Advice Advice Who are we? Specialist of antibody engineering Covalab is a French biotechnology company, specialised
The Leading Gene Through Screen CRO
The Leading Gene Through Screen CRO Molecular Biology Services Molecular Biology drives modern drug discovery. Drug screening, target validation and structural biology processes frequently require recombinant
CCR Biology - Chapter 9 Practice Test - Summer 2012
Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible
A Primer of Genome Science THIRD
A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:
Recombinant DNA Technology
Recombinant DNA Technology Dates in the Development of Gene Cloning: 1965 - plasmids 1967 - ligase 1970 - restriction endonucleases 1972 - first experiments in gene splicing 1974 - worldwide moratorium
Integrated Protein Services
Integrated Protein Services Custom protein expression & purification Version DC04-0012 Expression strategy The first step in the recombinant protein generation process is to design an appropriate expression
Integrated Protein Services
Integrated Protein Services Custom protein expression & purification Last date of revision June 2015 Version DC04-0013 www.iba-lifesciences.com Expression strategy The first step in the recombinant protein
Protein Expression and Analysis. Vijay Yajnik, MD, PhD GI Unit MGH
Protein Expression and Analysis Vijay Yajnik, MD, PhD GI Unit MGH Identify your needs Antigen production Biochemical studies Cell Biology Protein interaction studies including proteomics Structural studies
GenBank, Entrez, & FASTA
GenBank, Entrez, & FASTA Nucleotide Sequence Databases First generation GenBank is a representative example started as sort of a museum to preserve knowledge of a sequence from first discovery great repositories,
HuCAL Custom Monoclonal Antibodies
HuCAL Custom Monoclonal Antibodies Highly Specific Monoclonal Antibodies in just 8 Weeks PROVEN, HIGHLY SPECIFIC, HIGH AFFINITY ANTIBODIES IN 8 WEEKS WITHOUT HuCAL PLATINUM IMMUNIZATION (Human Combinatorial
Advanced BioDesign Outlines Solutions. Antibody Overview. by Advanced BioDesign. Project Start. Immunogenicity. Selecting Your Antigen
Advanced BioDesign Outlines Solutions by Advanced BioDesign Antibody Overview Launching an immunisation programme is an important experimental step that needs care. With Advanced BioDesign, you may develop
HuCAL Custom Monoclonal Antibodies
HuCAL Custom Monoclonal HuCAL Custom Monoclonal Antibodies Highly Specific, Recombinant Antibodies in 8 Weeks Highly Specific Monoclonal Antibodies in Just 8 Weeks HuCAL PLATINUM (Human Combinatorial Antibody
1.Gene Synthesis. 2.Peptide & Phospho-P. Assembly PCR. Design & Synthesis. Advantages. Specifications. Advantages
1.Gene Synthesis Assembly PCR Looking for a cdna for your research but could not fish out the gene through traditional cloning methods or a supplier? Abnova provides a gene synthesis service via assembly
Lecture 8. Protein Trafficking/Targeting. Protein targeting is necessary for proteins that are destined to work outside the cytoplasm.
Protein Trafficking/Targeting (8.1) Lecture 8 Protein Trafficking/Targeting Protein targeting is necessary for proteins that are destined to work outside the cytoplasm. Protein targeting is more complex
RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison
RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS
Biotechnology: DNA Technology & Genomics
Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 The BIG Questions How can we use our knowledge of DNA to: diagnose disease or defect? cure disease or defect? change/improve organisms? What
2.1.2 Characterization of antiviral effect of cytokine expression on HBV replication in transduced mouse hepatocytes line
i 1 INTRODUCTION 1.1 Human Hepatitis B virus (HBV) 1 1.1.1 Pathogenesis of Hepatitis B 1 1.1.2 Genome organization of HBV 3 1.1.3 Structure of HBV virion 5 1.1.4 HBV life cycle 5 1.1.5 Experimental models
Molecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION
Molecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION Susan Carson Heather B. Miller D.Scott Witherow ELSEVIER AMSTERDAM BOSTON HEIDELBERG LONDON NEW YORK OXFORD PARIS SAN DIEGO SAN
NIH Mammalian Gene Collection (MGC)
USER GUIDE NIH Mammalian Gene Collection (MGC) Catalog number FL1002 Revision date 28 November 2011 Publication Part number 25-0610 MAN0000351 For Research Use Only. Not for diagnostic procedures. ii Table
ELITE Custom Antibody Services
ELITE Custom Antibody Services ELITE Custom Antibody Services Experience, confidence, and understanding As a manufacturer and service provider, we have the experience, confidence, and understanding to
specific B cells Humoral immunity lymphocytes antibodies B cells bone marrow Cell-mediated immunity: T cells antibodies proteins
Adaptive Immunity Chapter 17: Adaptive (specific) Immunity Bio 139 Dr. Amy Rogers Host defenses that are specific to a particular infectious agent Can be innate or genetic for humans as a group: most microbes
Custom Antibody Services
Custom Antibody Services Custom service offerings DNA sequence Plasmid Peptide Structure Protein Peptide Small molecule Cells Spleen Lymphocytes Antigen Preparation Immunization Fusion & Subcloning Expansion
Frequently Asked Questions (FAQ)
Frequently Asked Questions (FAQ) Why screen your (therapeutic) antibody for cross-reactivity? Cross-reactivity of therapeutic antibodies leads to adverse effects and might render the antibody unsuitable
Contents. Prefacce xi List of Contributors xiii
V Contents Prefacce xi List of Contributors xiii 1 Peptides as Drugs: Discovery and Development 1 Bernd Groner 1.1 Discovery of New Potential Drug Targets and the Limitations of Druggability 1 1.2 Protein
Kinexus has an in-house inventory of lysates prepared from 16 human cancer cell lines that have been selected to represent a diversity of tissues,
Kinexus Bioinformatics Corporation is seeking to map and monitor the molecular communications networks of living cells for biomedical research into the diagnosis, prognosis and treatment of human diseases.
Aviva Systems Biology
Aviva Custom Antibody Service and Price Mouse Monoclonal Antibody Service Package Number Description Package Contents Time Price Customer provides antigen protein $6,174 Monoclonal package1 (From protein
Mir-X mirna First-Strand Synthesis Kit User Manual
User Manual Mir-X mirna First-Strand Synthesis Kit User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories, Inc.
Providing Trusted and Innovative Solutions t o the Life Science Communities
Providing Trusted and Innovative Solutions t o the Life Science Communities Eurogentec Eurogentec is a leading supplier of trusted and innovative reagents, kits, specialty products and custom research/development
Chapter 5: Organization and Expression of Immunoglobulin Genes
Chapter 5: Organization and Expression of Immunoglobulin Genes I. Genetic Model Compatible with Ig Structure A. Two models for Ab structure diversity 1. Germ-line theory: maintained that the genome contributed
Chapter 18: Applications of Immunology
Chapter 18: Applications of Immunology 1. Vaccinations 2. Monoclonal vs Polyclonal Ab 3. Diagnostic Immunology 1. Vaccinations What is Vaccination? A method of inducing artificial immunity by exposing
Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College
Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology
INDUSTRY OVERVIEW. Our business segments. (ii) Global drug development service market Preclinical drug development services
The information and statistics set out in this section and other sections of this document were extracted from different official government publications, available sources from public market research
Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )
Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins
ptune Inducible Vector
ptune Inducible Vector Application Guide Table of Contents Package contents and Storage Conditions:...2 Related products:...2 Introduction...2 Figure 1. Schematic Diagrams of ptune Inducible vector...3
MUTATION, DNA REPAIR AND CANCER
MUTATION, DNA REPAIR AND CANCER 1 Mutation A heritable change in the genetic material Essential to the continuity of life Source of variation for natural selection New mutations are more likely to be harmful
OriGene Technologies, Inc. MicroRNA analysis: Detection, Perturbation, and Target Validation
OriGene Technologies, Inc. MicroRNA analysis: Detection, Perturbation, and Target Validation -Optimal strategies to a successful mirna research project Optimal strategies to a successful mirna research
Lecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides
Lecture Series 7 From DNA to Protein: Genotype to Phenotype Reading Assignments Read Chapter 7 From DNA to Protein A. Genes and the Synthesis of Polypeptides Genes are made up of DNA and are expressed
We use Reaxys intensively for hit identification, hit-to-lead and lead optimization.
CASE STUDY Dr. Fabio C. Tucci, COO of Epigen Biosciences We use Reaxys intensively for hit identification, hit-to-lead and lead optimization. CREATING NEW ASSETS Epigen Biosciences is a start-up pharmaceutical
RNA Viruses. A Practical Approac h. Alan J. Cann
RNA Viruses A Practical Approac h Alan J. Cann List of protocols page xiii Abbreviations xvii Investigation of RNA virus genome structure 1 A j. Easton, A.C. Marriott and C.R. Pringl e 1 Introduction-the
Bio 102 Practice Problems Recombinant DNA and Biotechnology
Bio 102 Practice Problems Recombinant DNA and Biotechnology Multiple choice: Unless otherwise directed, circle the one best answer: 1. Which of the following DNA sequences could be the recognition site
MGC premier Expression-Ready cdna clones TCH1103, TCM1104, TCR1105, TCB1106, TCH1203, TCM1204, TCR1205, TCB1206, TCH1303, TCM1304, TCR1305
MGC premier Expression-Ready cdna clones TCH1103, TCM1104, TCR1105, TCB1106, TCH1203, TCM1204, TCR1205, TCB1206, TCH1303, TCM1304, TCR1305 The MGC premier Expression-Ready collection has the high quality,
mirnaselect pep-mir Cloning and Expression Vector
Product Data Sheet mirnaselect pep-mir Cloning and Expression Vector CATALOG NUMBER: MIR-EXP-C STORAGE: -80ºC QUANTITY: 2 vectors; each contains 100 µl of bacterial glycerol stock Components 1. mirnaselect
Introduction to Genome Annotation
Introduction to Genome Annotation AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT
COMPANY INTRODUCTION. www.cusabio.com
www.cusabio.com COMPANY INTRODUCTION CUSABIO is a leading biotechnology company specialized in production of high quality products for gene, protein, antibody, ELISA kit, in vitro diagnostic raw material,
A leader in the development and application of information technology to prevent and treat disease.
A leader in the development and application of information technology to prevent and treat disease. About MOLECULAR HEALTH Molecular Health was founded in 2004 with the vision of changing healthcare. Today
Antibody Services from GenScript
Services from GenScript www.genscript.com GenScript USA Inc. 860 Centennial Ave., Piscataway, NJ 08854 USA Toll-Free: 1-877-436-7274 Fax: 1-732-210-0262 1-732-885-5878 Academic Services Pharmaceutical
Antibody Production Price List
Antibody Production Price List Presenting Insight Biotechnology s price list for custom polyclonal and monoclonal antibody production services. We are happy to tailor individual packages towards the specific
EXPRESSION ARREST shrna mir GENOME- WIDE LIBRARIES
C GUGAAG EXPRESSION ARREST shrna mir GENOME- WIDE LIBRARIES MicroRNA-adapted shrna (shrna mir ) for increased, specific and consistent knockdown. MicroRNA PROCESSING PATHWAY UTILIZED FOR shrna mir Developed
Diabetes and Drug Development
Diabetes and Drug Development Metabolic Disfunction Leads to Multiple Diseases Hypertension ( blood pressure) Metabolic Syndrome (Syndrome X) LDL HDL Lipoproteins Triglycerides FFA Hyperinsulinemia Insulin
Human Genome and Human Genome Project. Louxin Zhang
Human Genome and Human Genome Project Louxin Zhang A Primer to Genomics Cells are the fundamental working units of every living systems. DNA is made of 4 nucleotide bases. The DNA sequence is the particular
Custom Antibody Services
prosci-inc.com Custom Antibody Services High Performance Antibodies and More Broad Antibody Catalog Extensive Antibody Services CUSTOM ANTIBODY SERVICES Established in 1998, ProSci Incorporated is a leading
PperCHIP. High-Content Peptide Microarrays. Epitope Mapping & Serum Profiling Services
PepperChip High-Content Peptide Microarrays PepperMap Epitope Mapping & Serum Profiling Services PperCHIP access to custom and dard peptide microarrays up to 9,000 features per in a uniquely flexible and
Antibody Services from GenScript, Brochure
Services from GenScript, Brochure Interest in any of the products, request or order them at Bio-Connect. Bio-Connect B.V. T NL +31 (0)26 326 44 50 T BE +32 (0)2 503 03 48 Begonialaan 3a F NL +31 (0)26
How To Get A Cell Print
QUICK CELL CAPTURE AND CHARACTERIZATION GUIDE FOR CELLSEARCH CUSTOMERS CellSave EDTA Blood sample Rare cell capture Enumeration Single protein marker Cell capture for molecular characterization CELLSEARCH
BBSRC TECHNOLOGY STRATEGY: TECHNOLOGIES NEEDED BY RESEARCH KNOWLEDGE PROVIDERS
BBSRC TECHNOLOGY STRATEGY: TECHNOLOGIES NEEDED BY RESEARCH KNOWLEDGE PROVIDERS 1. The Technology Strategy sets out six areas where technological developments are required to push the frontiers of knowledge
Luca Romagnoli, Ph.D. Business Development Manager
Modelli innovativi di produzione per lo sviluppo di un processo altamente qualitativo di farmaci biologici Luca Romagnoli, Ph.D. Business Development Manager BIOLOGICAL DRUGS - SOURCES Monoclonal antibodies
Error Tolerant Searching of Uninterpreted MS/MS Data
Error Tolerant Searching of Uninterpreted MS/MS Data 1 In any search of a large LC-MS/MS dataset 2 There are always a number of spectra which get poor scores, or even no match at all. 3 Sometimes, this
Dr Alexander Henzing
Horizon 2020 Health, Demographic Change & Wellbeing EU funding, research and collaboration opportunities for 2016/17 Innovate UK funding opportunities in omics, bridging health and life sciences Dr Alexander
All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna
All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna All-in-One TM mirna First-Strand cdna Synthesis Kit AMRT-0020 (20 RT reactions), AMRT-0060 (60 RT reactions) Used in combination
Special report. Chronic Lymphocytic Leukemia (CLL) Genomic Biology 3020 April 20, 2006
Special report Chronic Lymphocytic Leukemia (CLL) Genomic Biology 3020 April 20, 2006 Gene And Protein The gene that causes the mutation is CCND1 and the protein NP_444284 The mutation deals with the cell
European Medicines Agency
European Medicines Agency July 1996 CPMP/ICH/139/95 ICH Topic Q 5 B Quality of Biotechnological Products: Analysis of the Expression Construct in Cell Lines Used for Production of r-dna Derived Protein
Understanding the immune response to bacterial infections
Understanding the immune response to bacterial infections A Ph.D. (SCIENCE) DISSERTATION SUBMITTED TO JADAVPUR UNIVERSITY SUSHIL KUMAR PATHAK DEPARTMENT OF CHEMISTRY BOSE INSTITUTE 2008 CONTENTS Page SUMMARY
MAB Solut. MABSolys Génopole Campus 1 5 rue Henri Desbruères 91030 Evry Cedex. www.mabsolut.com. is involved at each stage of your project
Mabsolus-2015-UK:Mise en page 1 03/07/15 14:13 Page1 Services provider Department of MABSolys from conception to validation MAB Solut is involved at each stage of your project Creation of antibodies Production
Control of Gene Expression
Control of Gene Expression What is Gene Expression? Gene expression is the process by which informa9on from a gene is used in the synthesis of a func9onal gene product. What is Gene Expression? Figure
HCS604.03 Exercise 1 Dr. Jones Spring 2005. Recombinant DNA (Molecular Cloning) exercise:
HCS604.03 Exercise 1 Dr. Jones Spring 2005 Recombinant DNA (Molecular Cloning) exercise: The purpose of this exercise is to learn techniques used to create recombinant DNA or clone genes. You will clone
Transfection-Transfer of non-viral genetic material into eukaryotic cells. Infection/ Transduction- Transfer of viral genetic material into cells.
Transfection Key words: Transient transfection, Stable transfection, transfection methods, vector, plasmid, origin of replication, reporter gene/ protein, cloning site, promoter and enhancer, signal peptide,
Shop! VWRBiosciences,more than just a helping hand
section line 2 BioSciences section line 1 VWRBiosciences,more than just a helping hand Proteomics round-up What can we offer? In today s world of discovery, technology is critical to a better understanding
Hormones & Chemical Signaling
Hormones & Chemical Signaling Part 2 modulation of signal pathways and hormone classification & function How are these pathways controlled? Receptors are proteins! Subject to Specificity of binding Competition
PreciseTM Whitepaper
Precise TM Whitepaper Introduction LIMITATIONS OF EXISTING RNA-SEQ METHODS Correctly designed gene expression studies require large numbers of samples, accurate results and low analysis costs. Analysis
Genes to Proteins to Antibodies
Genes to Proteins to Antibodies About Us Fusion Antibodies is a CRO established in 2001 as a spin-out from Queen s University Belfast. The company building is situated in a charming area of Springbank
FACULTY OF MEDICAL SCIENCE
Doctor of Philosophy in Biochemistry FACULTY OF MEDICAL SCIENCE Naresuan University 73 Doctor of Philosophy in Biochemistry The Biochemistry Department at Naresuan University is a leader in lower northern
Interaktionen von RNAs und Proteinen
Sonja Prohaska Computational EvoDevo Universitaet Leipzig June 9, 2015 Studying RNA-protein interactions Given: target protein known to bind to RNA problem: find binding partners and binding sites experimental
LabGenius. Technical design notes. The world s most advanced synthetic DNA libraries. [email protected] V1.5 NOV 15
LabGenius The world s most advanced synthetic DNA libraries Technical design notes [email protected] V1.5 NOV 15 Introduction OUR APPROACH LabGenius is a gene synthesis company focussed on the design and manufacture
DNA (genetic information in genes) RNA (copies of genes) proteins (functional molecules) directionality along the backbone 5 (phosphate) to 3 (OH)
DNA, RNA, replication, translation, and transcription Overview Recall the central dogma of biology: DNA (genetic information in genes) RNA (copies of genes) proteins (functional molecules) DNA structure
Activity 7.21 Transcription factors
Purpose To consolidate understanding of protein synthesis. To explain the role of transcription factors and hormones in switching genes on and off. Play the transcription initiation complex game Regulation
Speed Matters - Fast ways from template to result
qpcr Symposium 2007 - Weihenstephan Speed Matters - Fast ways from template to result March 28, 2007 Dr. Thorsten Traeger Senior Scientist, Research and Development - 1 - Overview Ạgenda Fast PCR The Challenges
GENE CLONING AND RECOMBINANT DNA TECHNOLOGY
GENE CLONING AND RECOMBINANT DNA TECHNOLOGY What is recombinant DNA? DNA from 2 different sources (often from 2 different species) are combined together in vitro. Recombinant DNA forms the basis of cloning.
Course Curriculum for Master Degree in Medical Laboratory Sciences/Clinical Biochemistry
Course Curriculum for Master Degree in Medical Laboratory Sciences/Clinical Biochemistry The Master Degree in Medical Laboratory Sciences /Clinical Biochemistry, is awarded by the Faculty of Graduate Studies
Control of Gene Expression
Home Gene Regulation Is Necessary? Control of Gene Expression By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection favoring
DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!
DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other
GenScript Antibody Services
GenScript Antibody Services Scientific experts, innovative technologies, proven performance We specialize in custom antibody production to empower your research Custom Polyclonal Antibody Production Custom
岑 祥 股 份 有 限 公 司 技 術 專 員 費 軫 尹 20100803
技 術 專 員 費 軫 尹 20100803 Overview of presentation Basic Biology of RNA interference Application of sirna for gene function? How to study mirna? How to deliver sirna and mirna? New prospects on RNAi research
Core Facility Genomics
Core Facility Genomics versatile genome or transcriptome analyses based on quantifiable highthroughput data ascertainment 1 Topics Collaboration with Harald Binder and Clemens Kreutz Project: Microarray
Vector NTI Advance 11 Quick Start Guide
Vector NTI Advance 11 Quick Start Guide Catalog no. 12605050, 12605099, 12605103 Version 11.0 December 15, 2008 12605022 Published by: Invitrogen Corporation 5791 Van Allen Way Carlsbad, CA 92008 U.S.A.
An Overview of Cells and Cell Research
An Overview of Cells and Cell Research 1 An Overview of Cells and Cell Research Chapter Outline Model Species and Cell types Cell components Tools of Cell Biology Model Species E. Coli: simplest organism
