ptune Inducible Vector
|
|
|
- Ralf Hicks
- 9 years ago
- Views:
Transcription
1 ptune Inducible Vector Application Guide Table of Contents Package contents and Storage Conditions:...2 Related products:...2 Introduction...2 Figure 1. Schematic Diagrams of ptune Inducible vector...3 Figure 2. Inducible expression of tgfp...4 Figure 3. Gene Expression in ptune inducible vector...4 ptune Inducible Vector Information...5 Figure 4. Schematic of the ptune Inducible Vector and its Multiple Cloning Sites...5 TrueORF Entry Vector Information...6 Figure 5. Schematic of the pcmv6-entry Vector and its Multiple Cloning Sites...6 Protocols...7 Destination Vector...7 Directly clone ORF into ptune Inducible vector...7 Transfer of ORF from pcmv6-entry Vector to ptune Inducible Vector...10 Protocol for sequencing Primer Re-suspension and DNA Sequencing...12 Induced expression...12 Troubleshooting...12 Frequently Asked Questions...13 References
2 Package contents and Storage Conditions: The following components are included: One (1) vial containing ptune vector as 10 ug lyophilized plasmid DNA DNA sequencing primers (100 pmol) for ptune Inducible vector; dried onto the bottom of tubes ptune-f Forward (5 TAGAGTCGACCTGCAGCCGG 3 ) ptune-r Reverse (5 TCGCTGATTTGTGTAGGGGA 3 ) A copy of application guide Store the DNA at room temperature. Once DNA is re-suspended in water or TE, store at 20 o C. The cdna clone is shipped at room temperature, but should be kept at -20 C for long-term storage. If properly stored, clones are guaranteed to be stable for 12 months. Related products: TrueORF cdna clones TrueClone cdna clones HuSH shrna Plasmids Validated Antibodies Functional Proteins Transfection Reagents Introduction ptune Inducible Gene Expression System is an engineered, tunable genetic switch that tightly regulates gene expression in mammalian cells. This switch couples repressor proteins and an RNAi target design to effectively turn any gene off described by Tara Deans et al. (Cell 130, 2007). Unlike other inducible vectors using either tetracycline (tet) repressor or small interfering RNAs and having a certain degree of leakiness, ptune Inducible vector combines repression at a lactose operon (lac) with a tet-controlled promoter using RNA interference as a means to achieve tight inhibition. 2
3 Figure 1. Schematic Diagrams of ptune Inducible vector. (A) In the switch off state, repressor proteins (LacI) are expressed and work on the lac operator sites downstream of the RSV and CMV promoters. This results in repression of gene expression (shown here as GFP). The LacI repressor proteins also work on the lac operator sites within the tetr repressor module, which results in repression of TetR expression. As the result of repression of TetR, shrna is transcribed by the U6 promoter and complementarily works on the target sequence located in the 3 end UTR of the gene as well as prevents any residual gene expression. (B) In the switch on state, isopropyl-b-thiogalactopyranoside (IPTG) binds to the LacI proteins, resulting in a conformational change in the repressor proteins. The addition of IPTG causes the release of repressor proteins from the lac operator sites, which allows for the transcription of the gene of interest and tetr. In the meantime, the Tet repressor proteins bind to the tet operator site located in the U6 promoter of the RNAi, shutting down the transcription of the inhibitory shrna. The advantages of this inducible Gene Expression System are: Tightly regulate gene expression. The gene expression can be fine-tuned with different IPTG concentrations. The switch is reversible. It can be used with any gene of interest. Express tagged protein 3
4 Compatible with OriGene s (and growing daily) TrueORF cdna clones. The gene of interest can be easily shuttled from any of the TrueORF clones. Figure 2. Inducible expression of tgfp in the ptune Inducible vector. HEK293 cells transiently transfected with 100 ng of ptune-tgfp plasmid expressing tgfp in a 96 well culture plate. (A) In the absence of the IPTG for 72 hours. (B) In the presence of the 25 µm IPTG for 72 hours. (A) No IPTG Induction (B) 25 µm IPTG Induction Figure 3. Gene Expression in ptune inducible vector can be controlled in a tunable way. ptune-tgfp was transiently transfected in HEK293 cells and incubated in the presence of IPTG of various concentrations. 0 µm IPTG 2.5 µm IPTG 25 µm IPTG 4
5 ptune Inducible Vector Information Figure 4. Schematic of the ptune Inducible Vector and its Multiple Cloning Sites. 5
6 TrueORF Entry Vector Information Figure 5. Schematic of the pcmv6-entry Vector and its Multiple Cloning Sites. ptune Inducible vector enables expression of the gene of interest as a C-terminal Myc and Flag (DDK) tagged protein, which facilitates multiple downstream applications that utilize an anti-tag antibody, such as protein detection, protein purification, subcellular localization, etc. All ORF (Open Reading Frame) inserts are cloned into an OriGene pcmv6-entry vector and therefore can be easily shuttled by a simple cut-and-paste mechanism into ptune Inducible vector.. 6
7 Protocols There are several ways you can clone the gene of interest into OriGene ptune Inducible vector. Shuttle the gene of interest from OriGene TrueORF cdna clone into ptune Inducible vector. Now, there are 37,000 TrueORF cdna clones in OriGene TrueORF collection database. These clones can be purchased and shuttled into ptune vector via a simple restriction-based cut and ligation. (PrecisionShuttle System). OriGene also provides the shuttling service. Utilize OriGene s TrueORF cloning service for our customer. If you can t find the gene of interest, please submit your request to techsupport ([email protected]), and then OriGene scientists will clone your gene of interest into your designated vector. If you choose to do it yourself, the following is detailed procedures. (Please note that this is only recommended if Sgf I and Xho I site are absent from your target ORF. Otherwise, it would be much easier to purchase the corresponding TrueORF in the pcmv6-entry vector and then shuttle the insert to ptune vector.) Cloning strategy: Restriction Site Combination Destination Vector No internal Xho I in ORF Sgf I (Asc I)/Xho I ptune inducible vector There is (are) internal Xho I Sgf I (Asc I)/Mlu I (Rsr II, Not I) PCMV6-ENTRY vector site(s) in ORF Shuttle from pcmv6-entry to ptune vectors Sgf I (Asc I)/Sac II (Fse I, Pme I) ptune inducible vector Directly clone ORF into ptune Inducible vector 1. Primer Design and PCR Amplification of ORF The open reading frame (ORF) of the clone must be PCR amplified in order to append cloning sites to the 5 and 3 ends of the sequence. Forward primer with Sgf I 5 GAGGCGATCGCCNNNNNNNNNNNNNNNNNNNNNNN 3 (Ns represent the sequence of the ORF beginning with the start codon, ATG) Reverse primer with Xho I 7
8 5 GCGCTCGAGNNNNNNNNNNNNNNNNNNNNNNNN 3 (Ns represent the last 8 codons of the ORF in reverse complement orientation. These do not include the stop codon that must be removed to generate a fusion protein for C-terminally tagged vectors, We recommend using a full-length cdna plasmid as the template for ORF cloning. The PCR error is rather high when a cdna pool is used as the template for a PCR cloning reaction. When the GC content of an ORF (or a region of the ORF longer than 100 bp) is above 75%, a special PCR buffer with DMSO or other additive should be used to improve the PCR. The recommended PCR polymerase and buffer are available from New England Biolabs (Phusion High-Fidelity PCR Kit, F-553S). PCR reaction setup: Component Volume (µl) 5X PCR Buffer 4.0 dntps (2.5 mm each) 1.6 (0.4ul each) Phusion Polymerase (2U/μl) 0.2 Nuclease Free Water 11.0 Forward Primer (10 μm) 0.6 Reverse Primer (10 μm) 0.6 cdna Template 2.0 ( ng Plasmid) Total Volume 20.0 PCR cycling conditions: Temperature/Time Cycles 95 C, 1 min 1 95 C, 10 sec, 62 C 20 sec, 72 C 4 min 2 95 C, 10 sec, 60 C 20 sec, 72 C 4 min 2 95 C, 10 sec, 58 C 20 sec, 72 C 4 min 2 95 C, 10 sec, 56 C 20 sec, 72 C 4 min C 10 min 1 min per kb 4 C Hold 2. Prepare the insert Verify that the size of the amplification product is correct by agarose gel electrophoresis, and purify the remainder of the reaction using a purification column or similar method. Elute the 8
9 DNA from the purification column in 26 μl of 10 mm Tris buffer. Set up a digestion reaction as described below, substituting other restriction enzymes as appropriate. Component Volume (µl) 10X Restriction Buffer 3.0 Sgf I (10U/μl) 0.6 Xho I (10U/μl) 0.6 Purified PCR Product 26.0 Total Volume ~ 30.0 Mix well, and incubate at 37 C for 1 hour. Purify the digestion reaction using a purification column and elute in 18 μl of 10 mm Tris buffer. 3. Prepare the vector: Digest ptune Inducible vector with the Sgf I and Xho I Component Volume (µl) 10X Restriction Buffer 3.0 Sgf I (10U/μl) 0.8 Xho I (10U/μl) 0.8 PTUNE Inducible vector 10.0 Nuclease Free Water 15.4 Total Volume 30.0 Incubate at 37 C for 1.5 hr, then add 0.5 μl alkaline phosphatase, and continue the incubation at 37ºC for another 30 min. A two hour digestion is recommended to ensure that the vector is completely digested. Dephosphorylation of the digested vector is essential to eliminate selfligation. Purify the desired vector fragment by running the digestion reaction on an agarose gel, and isolating the appropriate band using a gel purification column. Elute the digested plasmid vector in 40 μl of 10 mm Tris buffer. 4. Set up a ligation reaction with the purified vector and insert fragments: Component Volume (µl) 10X T4 DNA Ligase Buffer 1.0 Nuclease Free Water 3.5 T4 DNA Ligase (4U/µl) 0.5 Digested ptune Inducible Vector Fragment from Step
10 Digested PCR Product from Step Total Volume 10.0 Incubate the ligation reaction at 12 C overnight. 5. Transform 1 μl of the ligation mixture using 20 μl high efficiency competent E. coli cells (ideally 1x10 8 CFU/ug). Following transformation, resuspend cells in 200 ul LB. 6. Plate the entire transformation reaction on a standard LB-agar plate containing 100 μg/ml Ampicillin. Incubate at 37 C overnight. 7. Pick at least 4-8 independent colonies from each ligation. Confirm the insert by restriction digestion and/or vector primer sequencing (include in the shipment). Transfer of ORF from pcmv6-entry Vector to ptune Inducible Vector The ORF of a C-terminally tagged protein is followed by a double tag (Myc and Flag) including a short spacer (5-6 amino acid residues). The MCS of pcmv6-entry and ptune vectors are similar except some cloning sites in entry vector, such as Mlu I, Rsr II and Not I, are not unique restriction sites in ptune vector. Depending on the gene of interest, Sgf I or Asc I at 5 end of ORF and Pme I or Fse I or Sac II at 3 end ORF can be used to transfer entire ORF containing the Myc and Flag tags between pcmv6-entry and ptune vectors. The ORF transfer protocol from pcmv6-entry vector to ptune vector is detailed below. 1. Digest the TrueORF entry clone: Component Volume (µl) 10X Restriction Buffer 2.0 Sgf I or Asc I (10U/μl) 0.6 Sac II or Fse I or Pme I (10U/μl) 0.6 ORF cdna Clone in pcmv6-entry Vector ( ng) 3.0 Nuclease Free Water 13.8 Total volume 20.0 Incubate at 37 C for 1 hour. 2. Digest the ptune Inducible vector: 10
11 Component Volume (µl) 10X Restriction Buffer 2.0 Sgf I or Asc I (10U/μl) 0.6 Sac II or Fse I or Pme I (10U/μl) 0.6 ptune Inducible Vector (200ng) 3.0 Nuclease Free Water 13.8 Total Volume 20.0 Incubate at 37 C for 1 hour. Add 0.4 μl calf intestine phosphatase to the digestion, and continue to incubate at 37 C for an additional 30 minutes. 3. Purify the digestion using a commercial PCR purification column and elute in 20 ul 10 mm Tris. 4. Set up a ligation reaction: Component Volume (µl) 10X T4 DNA Ligase Buffer 1.0 Nuclease Free Water 3.25 T4 DNA Ligase (4U/μl) 0.75 Digested ORF Insert in pcmv6-entry Vector from Step Digested ptune Vector fragment from Step Total volume 10.0 Incubate the ligation reaction at 12 C overnight. 5. Transform the ligation reaction into high-efficiency, competent E. coli cells ( CFU/μg DNA) following the appropriate transformation protocol. Plate the transformants on LB-agar plates supplemented with 100 μg/ml ampicillin. 6. Pick at least six colonies for subsequent DNA purification and screening. Amplify and purify the selected clone(s) by growing overnight in liquid LB-amp media, then isolating the DNA using standard plasmid purification procedures. 7. Confirm the insert by restriction digestion and/or vector primer sequencing using the provided ptune-f for 5 end sequencing and ptune-r for 3 end sequencing. 11
12 Protocol for sequencing Primer Re-suspension and DNA Sequencing Carefully open the tube, and add 10uL of sterile, deionized H2O to the bottom to obtain a 10uM stock. Alternatively, a low TE solution (10mM Tris (8.0), 0.1mM EDTA) is advisable for long-term storage at -20 C. Close the tube and let sit for at least 10 minutes at room temperature (or overnight at 4 C). After vortexing for 10 seconds, quick spin the tube to bring the contents to the bottom of the tube. The primer stock (10uM) is now ready to be added to a DNA sequencing reaction (1ul=10pmol). Induced expression 1. Prepare IPTG Prepare 1M stock of IPTG and dilute it with sterilized water. 2. IPTG Induction For transient transfections, the cells were induced with desired amount (2.5uM -1mM) of IPTG 1-2 hours after the transfection was done. For stable transfections, linearize 5ug plasmid DNA with AhdI before transfections. The medium was changed daily containing fresh IPTG at the desired dilution. Troubleshooting For questions not addressed here, please contact OriGene s Technical Support professionals. You may dial from any US location, or outside the US. inquiries to [email protected] are also invited. No colonies or low number of colonies from transformation Cause The competent cells used in the transformation were not as efficient as necessary. Remedy Obtain a fresh batch of competent cells and ensure that the efficiency is CFU/μg DNA by performing a separate transformation reaction with a transformation-qualified control (usually a fixed amount of supercoiled plasmid such as puc19). In some extreme cases, especially for larger inserts (>5 kb), higher efficiency cells or electroporation may be required. Should a gene prove to be toxic to the cells, transforming into strains that reduce the copy number can increase the odds of 12
13 Too little DNA was used in the transformation reaction. The ligation of the ORF donor DNA into the recipient plasmid was not successful. The wrong antibiotic selection plate was used. obtaining colonies (i.e. ABLE-C or ABLE-K strains; Stratagene, La Jolla CA). Add more DNA (but not more than 10% of the volume of competent cells used). The ligase enzyme may not work properly. Repeat the reaction with fresh ligase and ligation buffer (which contains the temperature-sensitive component, ATP) or perform troubleshooting as recommended by the manufacturer of the ligase. Make sure to use an LB-agar plate containing the correct antibotics (e.g. ampicillin for ptune Inducible vector and kanamycin for entry vector. Too high self-ligation background (no insert) from destination vector Cause The ptune Inducible vector was not completely digested. The dephosphorylation of the ptune Inducible vector was not complete, and the vector religated with its own fragment. Remedy Allow the digestion reaction to continue for 1-2 hours at 37 C. Increase the concentration of CIP and/or the length of the dephosphorylation incubation as recommended by the ligase manufacturer. Frequently Asked Questions Why should I use OriGene s TrueORF clones? All TrueORF Clones are derived from OriGene s unique TrueClone Collection, and were isolated from high quality cdna libraries made from a variety of tissues. TrueORF Clones allow customers to directly apply these expression- ready, tagged ORF clones to experiments designed for protein expression, purification, protein-protein interaction and stable clone selection. TrueORF clones also serve as the entry clone for this ptune Inducible system and allow easy construction of this inducible, tagged ORFs. This saves valuable time by eliminating the need for subcloning, verification and amplification. All TrueORF and ptune Inducible vectors share the similar multiple cloning sites (MCS). Customers can easily shuffle the cdna of a TrueORF clone to ptune Inducible vector. What restriction enzymes should I use if Sgf I or Mlu I sites are present in my ORF? 13
14 While 96% of all human and mouse ORFs can use the Sgf I - Mlu I combination, some ORFs do contain internal Mlu I site(s). Most of those ORFs with an internal Mlu I site can be transferred using another rare cutter (Rsr II), whose restriction site is upstream of Mlu I, or Not I, whose site is immediately downstream of Mlu I. Using one of the four different subcloning combinations, any ORF can be cloned into pcmv6 Entry vector, and then shuttled to ptune Inducible vector using Sac II or Pme I or Fse I. Can I directly clone ORF into ptune Inducible vector? If no internal Xho I site(s) in ORF, you can use Sgf I/Xho I combination to clone the ORF into ptune Inducible vector. Has OriGene fully sequenced all TrueORF clones? Not always. When transferring the cdna into the TrueORF Entry Vector, OriGene always uses fully sequenced plasmids as templates and Phusion High-Fidelity DNA Polymerase (New England Biolabs), which has a mutation rate less than 4 x This ensures the highest fidelity of every TrueORF clone. After cloning into the entry vector, each of OriGene s TrueORF clones was sequenced at both the 5 and 3 ends, and the resulting sequence was matched to the corresponding reference sequence. For many ORFs 1 Kb or less in length, the 5 and 3 sequencing reads have covered the full ORF. For longer cdnas, the ORF was not fully covered by sequencing reads. Do TrueORF clones exactly match the reference gene sequence? All TrueORF clones are guaranteed to match the ORF of the corresponding gene sequences as published on OriGene s website. However, some clones may contain nucleotide changes compared to the published reference sequences. This is due to SNPs (single nucleotide polymorphisms) reflecting the unique differences from genes expressed in different tissues and different individuals. Published references may represent a different SNP than the OriGene transcript. Should a specific SNP be required, this can be contracted from OriGene at an additional charge. Can I transfer large ORFs using this system? It has been reported that ORFs larger than 4 Kb are unstable in recombination-based Systems. For OriGene inducible system, several ORFs ranging from 0.7 to 10 kb have been cloned into this inducible vector. The ORF larger than 10 kb has not been tested. What sites should I use to transfer a TrueORF clone into the Gateway system? There are multiple sites in pcmv6-entry than can be used to move the insert of a 14
15 TrueORF clone into any of Gateway s entry vectors (pentr-1a, -2B, -3C, -4 and -11). These sites are EcoR I, Sal I, BamH I and Kpn I at the 5' end, and Not I at the 3 end. What does your disclaimer mean? OriGene s disclaimer for the TrueORF clones reads as follows: Our molecular clone sequence data has been matched to the accession number below as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding accession number, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). The NCBI RefSeq mrna sequences are continuously being revised, as some may have been derived from aberrantly spliced transcripts or generated by incorrect prediction of intron-exon junctions in silico. These sequences are therefore used only as a reference and not as a standard. OriGene s clones are isolated from full-length cdna libraries and may differ from the reference sequence for this reason. What is the TrueORF Guarantee? OriGene warrants that the product will meet specifications listed. At OriGene s discretion, free replacement of any non-conforming product will be made if OriGene is notified within 30 days of product receipt. If you experience any difficulty with any OriGene product, please contact our Technical Support Staff at , or outside the US. References Deans, T.L. et al. A tunable genetic switch based on RNAi and repressor proteins for regulating gene expression in mammalian cells. Cell 130, (2007) Rusk, N. Switching genes off all the way, NATURE METHODS 4 (9), (2007) 15
pcmv6-neo Vector Application Guide Contents
pcmv6-neo Vector Application Guide Contents Package Contents and Storage Conditions... 2 Product Description... 2 Introduction... 2 Production and Quality Assurance... 2 Methods... 3 Other required reagents...
TransformAid Bacterial Transformation Kit
Home Contacts Order Catalog Support Search Alphabetical Index Numerical Index Restriction Endonucleases Modifying Enzymes PCR Kits Markers Nucleic Acids Nucleotides & Oligonucleotides Media Transfection
HCS604.03 Exercise 1 Dr. Jones Spring 2005. Recombinant DNA (Molecular Cloning) exercise:
HCS604.03 Exercise 1 Dr. Jones Spring 2005 Recombinant DNA (Molecular Cloning) exercise: The purpose of this exercise is to learn techniques used to create recombinant DNA or clone genes. You will clone
PCR was carried out in a reaction volume of 20 µl using the ABI AmpliTaq GOLD kit (ABI,
Supplemental Text/Tables PCR Amplification and Sequencing PCR was carried out in a reaction volume of 20 µl using the ABI AmpliTaq GOLD kit (ABI, Foster City, CA). Each PCR reaction contained 20 ng genomic
Improved methods for site-directed mutagenesis using Gibson Assembly TM Master Mix
CLONING & MAPPING DNA CLONING DNA AMPLIFICATION & PCR EPIGENETICS RNA ANALYSIS Improved methods for site-directed mutagenesis using Gibson Assembly TM Master Mix LIBRARY PREP FOR NET GEN SEQUENCING PROTEIN
qstar mirna qpcr Detection System
qstar mirna qpcr Detection System Table of Contents Table of Contents...1 Package Contents and Storage Conditions...2 For mirna cdna synthesis kit...2 For qstar mirna primer pairs...2 For qstar mirna qpcr
pcas-guide System Validation in Genome Editing
pcas-guide System Validation in Genome Editing Tagging HSP60 with HA tag genome editing The latest tool in genome editing CRISPR/Cas9 allows for specific genome disruption and replacement in a flexible
DNA ligase. ATP (or NAD+)
DNA Ligase enzyme catalysing formation of phosphodiesteric bound between group 3 -OH of one end of DNA molecule and group 5 -phosphate of the second end of DNA DNA ligase ATP (or NAD+) Ligase cofactors
Thermo Scientific Phusion Site-Directed Mutagenesis Kit #F-541
PRODUCT INFORMATION Thermo Scientific Phusion Site-Directed Mutagenesis Kit #F-541 Lot _ Store at -20 C Expiry Date _ www.thermoscientific.com/onebio CERTIFICATE OF ANALYSIS The Phusion Site-Directed Mutagenesis
First Strand cdna Synthesis
380PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 [email protected] A Geno Technology, Inc. (USA) brand name First Strand cdna Synthesis (Cat. # 786 812) think proteins! think G-Biosciences
Cloning Blunt-End Pfu DNA Polymerase- Generated PCR Fragments into pgem -T Vector Systems
Promega Notes Number 71, 1999, p. 10 Blunt-End Pfu DNA Polymerase- Generated PCR Fragments into pgem -T Vector Systems By Kimberly Knoche, Ph.D., and Dan Kephart, Ph.D. Promega Corporation Corresponding
ab185916 Hi-Fi cdna Synthesis Kit
ab185916 Hi-Fi cdna Synthesis Kit Instructions for Use For cdna synthesis from various RNA samples This product is for research use only and is not intended for diagnostic use. Version 1 Last Updated 1
The RNAi Consortium (TRC) Broad Institute
TRC Laboratory Protocols Protocol Title: One Step PCR Preparation of Samples for Illumina Sequencing Current Revision Date: 11/10/2012 RNAi Platform,, [email protected] Brief Description: This
Cloning GFP into Mammalian cells
Protocol for Cloning GFP into Mammalian cells Studiepraktik 2013 Molecular Biology and Molecular Medicine Aarhus University Produced by the instructors: Tobias Holm Bønnelykke, Rikke Mouridsen, Steffan
HiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
Integrated Protein Services
Integrated Protein Services Custom protein expression & purification Version DC04-0012 Expression strategy The first step in the recombinant protein generation process is to design an appropriate expression
PrimeSTAR HS DNA Polymerase
Cat. # R010A For Research Use PrimeSTAR HS DNA Polymerase Product Manual Table of Contents I. Description...3 II. III. IV. Components...3 Storage...3 Features...3 V. General Composition of PCR Reaction
TIANquick Mini Purification Kit
TIANquick Mini Purification Kit For purification of PCR products, 100 bp to 20 kb www.tiangen.com TIANquick Mini Purification Kit (Spin column) Cat no. DP203 Kit Contents Contents Buffer BL Buffer PB Buffer
RevertAid Premium First Strand cdna Synthesis Kit
RevertAid Premium First Strand cdna Synthesis Kit #K1651, #K1652 CERTIFICATE OF ANALYSIS #K1651 Lot QUALITY CONTROL RT-PCR using 100 fg of control GAPDH RNA and GAPDH control primers generated a prominent
PicoMaxx High Fidelity PCR System
PicoMaxx High Fidelity PCR System Instruction Manual Catalog #600420 (100 U), #600422 (500 U), and #600424 (1000 U) Revision C Research Use Only. Not for Use in Diagnostic Procedures. 600420-12 LIMITED
Bacterial Transformation and Plasmid Purification. Chapter 5: Background
Bacterial Transformation and Plasmid Purification Chapter 5: Background History of Transformation and Plasmids Bacterial methods of DNA transfer Transformation: when bacteria take up DNA from their environment
Application Guide... 2
Protocol for GenomePlex Whole Genome Amplification from Formalin-Fixed Parrafin-Embedded (FFPE) tissue Application Guide... 2 I. Description... 2 II. Product Components... 2 III. Materials to be Supplied
BacReady TM Multiplex PCR System
BacReady TM Multiplex PCR System Technical Manual No. 0191 Version 10112010 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI Detailed Experimental
PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-)
PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-) FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE Lucigen Corporation 2905 Parmenter St, Middleton, WI 53562 USA Toll Free: (888) 575-9695 (608)
Description: Molecular Biology Services and DNA Sequencing
Description: Molecular Biology s and DNA Sequencing DNA Sequencing s Single Pass Sequencing Sequence data only, for plasmids or PCR products Plasmid DNA or PCR products Plasmid DNA: 20 100 ng/μl PCR Product:
NIH Mammalian Gene Collection (MGC)
USER GUIDE NIH Mammalian Gene Collection (MGC) Catalog number FL1002 Revision date 28 November 2011 Publication Part number 25-0610 MAN0000351 For Research Use Only. Not for diagnostic procedures. ii Table
GRS Plasmid Purification Kit Transfection Grade GK73.0002 (2 MaxiPreps)
1 GRS Plasmid Purification Kit Transfection Grade GK73.0002 (2 MaxiPreps) (FOR RESEARCH ONLY) Sample : Expected Yield : Endotoxin: Format : Operation Time : Elution Volume : 50-400 ml of cultured bacterial
AffinityScript QPCR cdna Synthesis Kit
AffinityScript QPCR cdna Synthesis Kit INSTRUCTION MANUAL Catalog #600559 Revision C.01 For In Vitro Use Only 600559-12 LIMITED PRODUCT WARRANTY This warranty limits our liability to replacement of this
Introduction to cloning
1 of 14 Introduction to cloning Aim The aim of this protocol is to serve as a general guideline to mainstream molecular cloning of Gene of Interest ( GOI ). Overview GOI Sequence Transformation into Bacteria
Genomic DNA Clean & Concentrator Catalog Nos. D4010 & D4011
Page 0 INSTRUCTION MANUAL Catalog Nos. D4010 & D4011 Highlights Quick (5 minute) spin column recovery of large-sized DNA (e.g., genomic, mitochondrial, plasmid (BAC/PAC), viral, phage, (wga)dna, etc.)
NimbleGen DNA Methylation Microarrays and Services
NimbleGen DNA Methylation Microarrays and Services Sample Preparation Instructions Outline This protocol describes the process for preparing samples for NimbleGen DNA Methylation microarrays using the
Recombinant DNA Technology
Recombinant DNA Technology Dates in the Development of Gene Cloning: 1965 - plasmids 1967 - ligase 1970 - restriction endonucleases 1972 - first experiments in gene splicing 1974 - worldwide moratorium
Molecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION
Molecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION Susan Carson Heather B. Miller D.Scott Witherow ELSEVIER AMSTERDAM BOSTON HEIDELBERG LONDON NEW YORK OXFORD PARIS SAN DIEGO SAN
Mir-X mirna First-Strand Synthesis Kit User Manual
User Manual Mir-X mirna First-Strand Synthesis Kit User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories, Inc.
Introduction. Preparation of Template DNA
Procedures and Recommendations for DNA Sequencing at the Plant-Microbe Genomics Facility Ohio State University Biological Sciences Building Room 420, 484 W. 12th Ave., Columbus OH 43210 Telephone: 614/247-6204;
Taq98 Hot Start 2X Master Mix
Taq98 Hot Start 2X Master Mix Optimized for 98C Denaturation Lucigen Corporation 2905 Parmenter St, Middleton, WI 53562 USA Toll Free: (888) 575-9695 (608) 831-9011 FAX: (608) 831-9012 [email protected]
pmod2-puro A plasmid containing a synthetic Puromycin resistance gene Catalog # pmod2-puro For research use only Version # 11H29-MM
pmod2-puro A plasmid containing a synthetic Puromycin resistance gene Catalog # pmod2-puro For research use only Version # 11H29-MM PrOduct information content: - 20 mg of lyophilized pmod2-puro plasmid
TrueClone Full Length cdna Clones Application Guide
TrueClone Full Length cdna Clones Application Guide Table of Contents Package Contents and Storage Conditions 2 Other Recommended reagents 2 Related Products 2 Introduction 3 Overview 3 Production and
One Shot TOP10 Competent Cells
USER GUIDE One Shot TOP10 Competent Cells Catalog Numbers C4040-10, C4040-03, C4040-06, C4040-50, and C4040-52 Document Part Number 280126 Publication Number MAN0000633 Revision A.0 For Research Use Only.
restriction enzymes 350 Home R. Ward: Spring 2001
restriction enzymes 350 Home Restriction Enzymes (endonucleases): molecular scissors that cut DNA Properties of widely used Type II restriction enzymes: recognize a single sequence of bases in dsdna, usually
CompleteⅡ 1st strand cdna Synthesis Kit
Instruction Manual CompleteⅡ 1st strand cdna Synthesis Kit Catalog # GM30401, GM30402 Green Mountain Biosystems. LLC Web: www.greenmountainbio.com Tel: 800-942-1160 Sales: Sales@ greenmountainbio.com Support:
MGC premier Expression-Ready cdna clones TCH1103, TCM1104, TCR1105, TCB1106, TCH1203, TCM1204, TCR1205, TCB1206, TCH1303, TCM1304, TCR1305
MGC premier Expression-Ready cdna clones TCH1103, TCM1104, TCR1105, TCB1106, TCH1203, TCM1204, TCR1205, TCB1206, TCH1303, TCM1304, TCR1305 The MGC premier Expression-Ready collection has the high quality,
Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College
Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology
Genomic DNA Extraction Kit INSTRUCTION MANUAL
Genomic DNA Extraction Kit INSTRUCTION MANUAL Table of Contents Introduction 3 Kit Components 3 Storage Conditions 4 Recommended Equipment and Reagents 4 Introduction to the Protocol 4 General Overview
Troubleshooting Sequencing Data
Troubleshooting Sequencing Data Troubleshooting Sequencing Data No recognizable sequence (see page 7-10) Insufficient Quantitate the DNA. Increase the amount of DNA in the sequencing reactions. See page
PCR and Sequencing Reaction Clean-Up Kit (Magnetic Bead System) 50 preps Product #60200
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: [email protected] PCR and Sequencing Reaction Clean-Up Kit (Magnetic Bead System)
Molecular Cloning, Product Brochure
, Product Brochure Interest in any of the products, request or order them at Bio-Connect. Bio-Connect B.V. T NL +31 (0)26 326 44 50 T BE +32 (0)2 503 03 48 Begonialaan 3a F NL +31 (0)26 326 44 51 F BE
How To Use An Enzymatics Spark Dna Sample Prep Kit For Ion Torrent
SPARK DNA Sample Prep Kit Ion Torrent (SPK0002-V08) Frequently Asked Questions Under what circumstances would I use SPARK DNA Sample Prep Kit for Ion Torrent? Enzymatics SPARK DNA Sample Prep Kit for Ion
Sanger Sequencing. Troubleshooting Guide. Failed sequence
Sanger Sequencing Troubleshooting Guide Below are examples of the main problems experienced in ABI Sanger sequencing. Possible causes for failure and their solutions are listed below each example. The
In vitro analysis of pri-mirna processing. by Drosha-DGCR8 complex. (Narry Kim s lab)
In vitro analysis of pri-mirna processing by Drosha-DGCR8 complex (Narry Kim s lab) 1-1. Preparation of radiolabeled pri-mirna transcript The RNA substrate for a cropping reaction can be prepared by in
RT-PCR: Two-Step Protocol
RT-PCR: Two-Step Protocol We will provide both one-step and two-step protocols for RT-PCR. We recommend the twostep protocol for this class. In the one-step protocol, the components of RT and PCR are mixed
The fastest spin-column based procedure for purifying up to 10 mg of ultra-pure endotoxin-free transfection-grade plasmid DNA.
INSTRUCTION MANUAL ZymoPURE Plasmid Gigaprep Kit Catalog Nos. D4204 (Patent Pending) Highlights The fastest spin-column based procedure for purifying up to 10 mg of ultra-pure endotoxin-free transfection-grade
ID kit. imegen Anchovies II. and E. japonicus) DNA detection by. User manual. Anchovies species (E. encrasicolus. sequencing.
User manual imegen Anchovies II ID kit Anchovies species (E. encrasicolus and E. japonicus) DNA detection by sequencing Reference: Made in Spain The information in this guide is subject to change without
ExpressArt Bacterial H-TR cdna synthesis kit. With extreme selectivity against rrnas
ExpressArt Bacterial H-TR cdna synthesis kit With extreme selectivity against rrnas suitable for 2 to 4 µg total RNA Catalogue No. 8004-A30 (30 rxns) Reagents Materials are provided for 30 cdna synthesis
Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual
Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual F- 470S 20 cdna synthesis reactions (20 µl each) F- 470L 100 cdna synthesis reactions (20 µl each) Table of contents 1. Description...
Integrated Protein Services
Integrated Protein Services Custom protein expression & purification Last date of revision June 2015 Version DC04-0013 www.iba-lifesciences.com Expression strategy The first step in the recombinant protein
RT31-020 20 rxns. RT31-100 100 rxns TRANSCRIPTME Enzyme Mix (1) 40 µl 2 x 50 µl 5 x 40 µl
Components RT31-020 20 rxns RT31-050 50 rxns RT31-100 100 rxns TRANSCRIPTME Enzyme Mix (1) 40 µl 2 x 50 µl 5 x 40 µl 2x RT Master Mix (2) 200 µl 2 x 250 µl 5 x 200 µl RNase H (E. coli) 20 µl 2 x 25 µl
Recombinant DNA Unit Exam
Recombinant DNA Unit Exam Question 1 Restriction enzymes are extensively used in molecular biology. Below are the recognition sites of two of these enzymes, BamHI and BclI. a) BamHI, cleaves after the
Chromatin Immunoprecipitation
Chromatin Immunoprecipitation A) Prepare a yeast culture (see the Galactose Induction Protocol for details). 1) Start a small culture (e.g. 2 ml) in YEPD or selective media from a single colony. 2) Spin
Transformation Protocol
To make Glycerol Stocks of Plasmids ** To be done in the hood and use RNase/DNase free tips** 1. In a 10 ml sterile tube add 3 ml autoclaved LB broth and 1.5 ul antibiotic (@ 100 ug/ul) or 3 ul antibiotic
Bacillus Subtilis Expression Vectors. Product Information and Instructions November 2005
Bacillus Subtilis Expression Vectors Product Information and Instructions November 2005 1 Content 1. Introduction... 3 2. The pht Vectors...4 2.1. Vector Map pht01...4 2.2. Vector Map pht43...5 2.3. Location
FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE.
Instruction manual for KOD FX Neo 1103 F1100K KOD FX Neo KFX-201 200 U 200 reactions Store at -20 C Contents [1] Introduction [2] Components [3] Quality testing [4] Primer design [5] Cloning of PCR products
Table of Contents. I. Description... 2. II. Kit Components... 2. III. Storage... 2. IV. 1st Strand cdna Synthesis Reaction... 3
Table of Contents I. Description... 2 II. Kit Components... 2 III. Storage... 2 IV. 1st Strand cdna Synthesis Reaction... 3 V. RT-PCR, Real-time RT-PCR... 4 VI. Application... 5 VII. Preparation of RNA
Global MicroRNA Amplification Kit
Global MicroRNA Amplification Kit Store kit at -20 C on receipt (ver. 3-060901) A limited-use label license covers this product. By use of this product, you accept the terms and conditions outlined in
Reverse Transcription System
TECHNICAL BULLETIN Reverse Transcription System Instruc ons for use of Product A3500 Revised 1/14 TB099 Reverse Transcription System All technical literature is available on the Internet at: www.promega.com/protocols/
Investigating a Eukaryotic Genome: Cloning and Sequencing a Fragment of Yeast DNA
Investigating a Eukaryotic Genome: Cloning and Sequencing a Fragment of Yeast DNA Credits: This lab was created by Sarah C.R. Elgin and developed and written by Kathleen Weston-Hafer. Specific protocols
Real-time quantitative RT -PCR (Taqman)
Real-time quantitative RT -PCR (Taqman) Author: SC, Patti Lab, 3/03 This is performed as a 2-step reaction: 1. cdna synthesis from DNase 1-treated total RNA 2. PCR 1. cdna synthesis (Advantage RT-for-PCR
STUDIES ON SEED STORAGE PROTEINS OF SOME ECONOMICALLY MINOR PLANTS
STUDIES ON SEED STORAGE PROTEINS OF SOME ECONOMICALLY MINOR PLANTS THESIS SUBMITTED FOR THE DEGREB OF DOCTOR OF PHILOSOPHY (SCIENCE) OF THE UNIVERSITY OF CALCUTTA 1996 NRISINHA DE, M.Sc DEPARTMENT OF BIOCHEMISTRY
IP-Free E. coli Inducible Expression Vectors. E. coli Secretion Signals. IP-Free E. coli Expression Vectors with the IPTG-inducible T5 Promoter
IP-Free E. coli Inducible Expression Vectors E. coli expression vectors are available with the following promoters: T5 or T7 (IPTG-inducible), rhabad (rhamnose-inducible), ara (arabinose and IPTG-inducible)
STOP. Before using this product, please read the Limited Use License statement below:
STOP Before using this product, please read the Limited Use License statement below: Important Limited Use License information for pdrive5lucia-rgfap The purchase of the pdrive5lucia-rgfap vector conveys
FOR REFERENCE PURPOSES
BIOO LIFE SCIENCE PRODUCTS FOR REFERENCE PURPOSES This manual is for Reference Purposes Only. DO NOT use this protocol to run your assays. Periodically, optimizations and revisions are made to the kit
Troubleshooting Guide for DNA Electrophoresis
Troubleshooting Guide for Electrophoresis. ELECTROPHORESIS Protocols and Recommendations for Electrophoresis electrophoresis problem 1 Low intensity of all or some bands 2 Smeared bands 3 Atypical banding
ISOLATE II PCR and Gel Kit. Product Manual
ISOLATE II PCR and Gel Kit Product Manual 2 Product Manual www.bioline.com/isolate PCR and Gel Kit ISOLATE II PCR and Gel Kit ISOLATE II PCR and Gel Kit 1 Kit contents 04 2 Description 04 3 Storage 04
All-in-One First-Strand cdna Synthesis Kit
All-in-One First-Strand cdna Synthesis Kit For reliable first-strand cdna synthesis from all RNA sources Cat. No. AORT-0020 (20 synthesis reactions) Cat. No. AORT-0050 (50 synthesis reactions) User Manual
Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation
BDGP Resources Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation For recovery of sequences flanking PZ, PlacW and PEP elements E. Jay Rehm Berkeley Drosophila Genome Project I.
ZR DNA Sequencing Clean-up Kit
INSTRUCTION MANUAL ZR DNA Sequencing Clean-up Kit Catalog Nos. D40 & D4051 Highlights Simple 2 Minute Bind, Wash, Elute Procedure Flexible 6-20 µl Elution Volumes Allow for Direct Loading of Samples with
DNA Sequencing Troubleshooting Guide
DNA Sequencing Troubleshooting Guide Successful DNA Sequencing Read Peaks are well formed and separated with good quality scores. There is a small area at the beginning of the run before the chemistry
Bacterial Transformation with Green Fluorescent Protein. Table of Contents Fall 2012
Bacterial Transformation with Green Fluorescent Protein pglo Version Table of Contents Bacterial Transformation Introduction..1 Laboratory Exercise...3 Important Laboratory Practices 3 Protocol...... 4
SOLIDscript Solid Phase cdna Synthesis Kit Instruction Manual
Toll Free: 866-252-7771 752A Lincoln Blvd. Phone: 732-469-7771 Fax: 732-469-7782 Middlesex, NJ 08846 Web: www.purebiotechllc.com SOLIDscript Solid Phase cdna Synthesis Kit Instruction Manual Product: SOLIDscript
MEF Starter Nucleofector Kit
page 1 of 7 MEF Starter Nucleofector Kit for Mouse Embryonic Fibroblasts (MEF) MEF display significant phenotypic variations which depend on the strain, the genetic background of the mice they are isolated
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS
Classic Immunoprecipitation
292PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 [email protected] A Geno Technology, Inc. (USA) brand name Classic Immunoprecipitation Utilizes Protein A/G Agarose for Antibody Binding (Cat.
Recombinant DNA and Biotechnology
Recombinant DNA and Biotechnology Chapter 18 Lecture Objectives What Is Recombinant DNA? How Are New Genes Inserted into Cells? What Sources of DNA Are Used in Cloning? What Other Tools Are Used to Study
Protein Expression and Analysis. Vijay Yajnik, MD, PhD GI Unit MGH
Protein Expression and Analysis Vijay Yajnik, MD, PhD GI Unit MGH Identify your needs Antigen production Biochemical studies Cell Biology Protein interaction studies including proteomics Structural studies
Troubleshooting the Single-step PCR Site-directed Mutagenesis Procedure Intended to Create a Non-functional rop Gene in the pbr322 Plasmid
Troubleshooting the Single-step PCR Site-directed Mutagenesis Procedure Intended to Create a Non-functional rop Gene in the pbr322 Plasmid Lina Jew Department of Microbiology & Immunology, University of
Effects of Antibiotics on Bacterial Growth and Protein Synthesis: Student Laboratory Manual
Effects of Antibiotics on Bacterial Growth and Protein Synthesis: Student Laboratory Manual I. Purpose...1 II. Introduction...1 III. Inhibition of Bacterial Growth Protocol...2 IV. Inhibition of in vitro
All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna
All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna All-in-One TM mirna First-Strand cdna Synthesis Kit AMRT-0020 (20 RT reactions), AMRT-0060 (60 RT reactions) Used in combination
Terra PCR Direct Polymerase Mix User Manual
Clontech Laboratories, Inc. Terra PCR Direct Polymerase Mix User Manual Cat. Nos. 639269, 639270, 639271 PT5126-1 (031416) Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra Bella Avenue, Mountain
Design of conditional gene targeting vectors - a recombineering approach
Recombineering protocol #4 Design of conditional gene targeting vectors - a recombineering approach Søren Warming, Ph.D. The purpose of this protocol is to help you in the gene targeting vector design
Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation
Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna
For information regarding shipping specifications, please refer to the following link: http://dna.macrogen.com/eng/help/orderg.jsp
Macrogen Sample Submission Guide Macrogen has served over 10 years in sequencing field using the cutting edge technology and delivering fast and reliable results. We use high throughput Applied Biosystems
RIBOPROTECT. RNase Inhibitor RT33-020, RT33-100
RIBOPROTECT RT33-020, RT33-100 RT33-020, RT33-100 RIBOPROTECT The RIBOPROTECT is a recombinant protein isolated and purified from Escherichia coli. It inhibits ribonuclease (RNase) activity of enzymes
TransIT -2020 Transfection Reagent
Quick Reference Protocol, MSDS and Certificate of Analysis available at mirusbio.com/5400 INTRODUCTION TransIT -2020 Transfection Reagent is a high-performance, animal-origin free, broad spectrum reagent
mircute mirna qpcr Detection Kit (SYBR Green)
mircute mirna qpcr Detection Kit (SYBR Green) For detection of mirna using real-time RT-PCR (SYBR Green I) www.tiangen.com QP110302 mircute mirna qpcr Detection Kit (SYBR Green) Kit Contents Cat. no. FP401
QUANTITATIVE RT-PCR. A = B (1+e) n. A=amplified products, B=input templates, n=cycle number, and e=amplification efficiency.
QUANTITATIVE RT-PCR Application: Quantitative RT-PCR is used to quantify mrna in both relative and absolute terms. It can be applied for the quantification of mrna expressed from endogenous genes, and
UltraClean Soil DNA Isolation Kit
PAGE 1 UltraClean Soil DNA Isolation Kit Catalog # 12800-50 50 preps New improved PCR inhibitor removal solution (IRS) included Instruction Manual (New Alternative Protocol maximizes yields) Introduction
GenScript BloodReady TM Multiplex PCR System
GenScript BloodReady TM Multiplex PCR System Technical Manual No. 0174 Version 20040915 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI
Technical Manual No. 0173 Update Date 10112010
TissueDirect TM Multiplex PCR System Technical Manual No. 0173 Update Date 10112010 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 3 V Simplified Procedures. 3 VI Detailed
