Molecular Computing Athabasca Hall Sept. 30, 2013
|
|
|
- Jennifer Jody Walters
- 10 years ago
- Views:
Transcription
1 Molecular Computing 3-41 Athabasca Hall Sept. 30, 2013
2 What Was The World s First Computer?
3 The World s First Computer? ENIAC Antikythera Mechanism - 80 BP Babbage Analytical Engine Human Brain 1,000,000 BP
4 The World s First Computer? The Cell 2,000,000,000 BP
5 Cells versus Computers Cell Computer
6 21,000 metabolite
7 Cells versus Computers Base-4 (ACGT) DNA Bases Codons Genetic Code Gene/Protein Chromosome Genome Size Base-2 (101010) Magnetic tape/disk Bits/Transistors Bytes Instruction Set Program Hard Disk Disk Capacity
8 Data Storage Cell Computer
9 On/Off Signals Cell Computer
10 The Instruction Set Cell Computer
11 Data Transcription Computer Cell
12 Data Processing Computer Cell
13 Data Interpretation Cell Computer If light=red then turn north else continue
14 World s Most Sophisticated Computer Language AUGGUCACU (UAG) UCUGAAGUCA GCUA CUAG GGA CUUAUGC AUUCGUAU A program that codes for a self- assembling molecular machine
15 Key Differences... Cells use chemicals for information storage and transfer while computers use magnetic or electronic means In cells, proteins act as both programs and machines. In computers, programs and machines are separate with programs generally running the machines Proteins contain instructions for self-assembly, computers don t
16 DNA Computing ATGCTCGAAGCT
17 The First Turing Machine** DNA Polymerase A Turing machine is a hypothetical device that manipulates symbols on a strip of tape according to a table of rules.
18 Computing With DNA
19 Leonard Adleman** Mathematician, computer scientist, boxer Specialized in cryptography (RSA, 1983) Invented the term computer virus (1984) Became intrigued by real viruses (HIV) Published a paper on HIV in 1993 and decided to learn molecular biology Came up with DNA computing (1994) while studying Molecular Biology of the Gene Member of NAS, won Turing prize in 2002
20 Traveling Salesman Problem (7 cities, 14 air routes) A salesman must find his way from city 0 to city 6, passing through each of the remaining cities only once 7 nodes, 14 edges Correct path is marked in red
21 The Algorithm Generate Random paths through graph G From all paths created in step 1, keep only those that start at 0 and end at 6 From all remaining paths, keep only those that visit exactly 7 vertices From all remaining paths, keep only those that visit each vertex at least once If any path remains, return yes ;otherwise, return no
22 Represent Each City By A DNA Strand of 20 Bases City 1 City 2 City 3 City 4 City 5 ATGCTCAGCTACTATAGCGA!! TGCGATGTACTAGCATATAT!! GCATATGGTACACTGTACAA!! TTATTAGCGTGCGGCCTATG!! CCGCGATAGTCTAGATTTCC!! Etc.!
23 Represent Each Air Route By Mixed Complementary Strands City 1 2 City 2 3 City 3 4 City 4 5 City 5 6 TGATATCGCTACGCTACATG!! ATCGTATATACGTATACCAT!! GTGACATGTTAATAATCGCA!! CGCCGGATACGGCGCTATCA!! GATCTAAAGGTATGCATACG!! Etc.!
24 Connector DNA Links City DNA ATGCTCAGCTACTATAGCGA!TGCGATGTACTAGCATATAT! TGATATCGCTACGCTACATG! TGCGATGTACTAGCATATAT!GCATATGGTACACTGTACAA!! ATCGTATATACGTATACCAT! GCATATGGTACACTGTACAA!TTATTAGCGTGCGGCCTATG!! GTGACATGTTAATAATCGCA! TTATTAGCGTGCGGCCTATG!CCGCGATAGTCTAGATTTCC!! CGCCGGATACGGCGCTATCA! CCGCGATAGTCTAGATTTCCATACGTATGCTAGGCTATCG!! GATCTAAAGGTATGCATACG!!
25 Anneal and Ligate DNA Mix the City DNA with the Path DNA and let them randomly anneal (ligate with enzyme) After annealing/ligation they will form (7-2)! different long (150 bp) DNA molecules Select DNA molecules with the right start and ends (select by PCR) and length (gel) Sequence the DNA to determine the best pathway (defined by the DNA sequence)
26 Cartoon Summary
27 The DNA Algorithm Generate Random paths through graph G (Annealing and Ligation) From all paths created in step 1, keep only those that start at 0 and end at 6 (PCR with selected primers) From all remaining paths, keep only those that visit exactly 7 vertices (Gel purification) From all remaining paths, keep only those that visit each vertex at least once (Magnetic bead purification) If any path remains, return yes ;otherwise, return no (PCR)
28 Principles of PCR
29 Gels & PCR Not Exactly Routine Calculations
30 Advantages of DNA Computing With bases spaced at 0.35 nm along DNA, data density is 400,000 Gbits/cm compared to 3 Gbits/cm in typical high performance hard drive 1 gram of DNA can hold about 1x10 14 MB of data A test tube of DNA can contain trillions of strands. Each operation on a test tube of DNA is carried out on all strands in the tube in parallel Adleman figured his computer was running 2 x operations per joule
31 Disadvantages of Adleman s Computer NOT competitive with the state-of-the-art algorithms on electronic computers Time consuming laboratory procedures (2 weeks) Good computer programs that can solve traveling salesman problem for 100 vertices in a matter of minutes Adleman s process to solve the traveling salesman problem for 200 cities would require an amount of DNA that weighed more than the Earth
32 More Advanced DNA Computers
33 Computing with DNA Performs 330 trillion operations per second A spoonful contains 15,000 trillion computers /automatons Energy-efficiency is more than a million times that of a PC Guinness World Records recognized the computer as "the smallest biological computing device" ever constructed DNA acts as software, enzymes act as hardware Once the input, software, and hardware molecules are mixed in a solution it operates to completion without intervention The device can check whether a list of zeros and ones has an even number of ones It can only answer yes or no to a question
34 Finite Automaton Turing machine that moves in one direction Reads a series of symbols Changes its internal state according to transition rules A 2-state automaton can answer a yes-no question by alternating between states designated as 1 and 0 Its state at the end of the calculation represents the result
35 Details
36 Details
37 Details
38 Details
39 Details
40 More DNA Computing Concept has been extended to a DNA doctor computer mrna serves as the disease indicator (mrna of disease genes) Automaton starts the computation in a yes state and if all disease indicators are present it produces a yes state, if any mrna components are missing it transitions to a no state Takes about 1 hour to complete calculation
41 DNA Doctor (Computer)
42 Are There Other Kinds of Molecular Computers?
43 Digital Information Encoding
44 Digital Information Encoding
45 DNA Data Storage HTML draft of a 53,400 word book written by the lead researcher 11JPG images 1 JavaScript program All 154 of Shakespeare's sonnets 26 second audio clip of the "I Have a Dream" speech by Martin Luther King 5.5 petabits can be stored in each cubic millimeter of DNA $12,400 to encode data and $220 for retrieval (per Megabyte)
46 Other Molecular Computers: The Human Brain The world s most advanced molecular computer
47 The Human Brain There are neurons in our brains There are roughly synapses operating at about 10 impulses/second (Biggest CPUs have 10 9 transistors) Approximately synapse operations per second (Fastest super computers [TITAN] perform at FLOPS) Total energy consumption of the brain is about 25 watts (Blue Gene requires 1.5 Megawatts) h9p://
48 Neural Networks
49 How We Learn
50 How We Learn
51 How We Learn
52 How We Learn
53 How We Learn
54 How We Learn
55 How Memories Are Formed EmoBonal Reinforcement
56 Why Should I Care? Considerable interest in molecular computing from theoretical computer scientists (graduate research opps.) Source for new algorithms (fast matrix multiplication techniques, solving bounded post correspondence problem, etc.) and new concepts in computing (data storage) Source for bio-inspired algorithms (genetic algorithms, neural nets, agent-based computing, machine learning, etc.)
Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation
Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna
1. Molecular computation uses molecules to represent information and molecular processes to implement information processing.
Chapter IV Molecular Computation These lecture notes are exclusively for the use of students in Prof. MacLennan s Unconventional Computation course. c 2013, B. J. MacLennan, EECS, University of Tennessee,
CCR Biology - Chapter 9 Practice Test - Summer 2012
Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible
Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources
Appendix 2 Molecular Biology Core Curriculum Websites and Other Resources Chapter 1 - The Molecular Basis of Cancer 1. Inside Cancer http://www.insidecancer.org/ From the Dolan DNA Learning Center Cold
Molecular Genetics. RNA, Transcription, & Protein Synthesis
Molecular Genetics RNA, Transcription, & Protein Synthesis Section 1 RNA AND TRANSCRIPTION Objectives Describe the primary functions of RNA Identify how RNA differs from DNA Describe the structure and
Translation Study Guide
Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to
International Journal of Emerging Technologies in Computational and Applied Sciences (IJETCAS) www.iasir.net
International Association of Scientific Innovation and Research (IASIR) (An Association Unifying the Sciences, Engineering, and Applied Research) International Journal of Emerging Technologies in Computational
Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
Reading DNA Sequences:
Reading DNA Sequences: 18-th Century Mathematics for 21-st Century Technology Michael Waterman University of Southern California Tsinghua University DNA Genetic information of an organism Double helix,
DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA
DNA Fingerprinting Unless they are identical twins, individuals have unique DNA DNA fingerprinting The name used for the unambiguous identifying technique that takes advantage of differences in DNA sequence
DNA and the Cell. Version 2.3. English version. ELLS European Learning Laboratory for the Life Sciences
DNA and the Cell Anastasios Koutsos Alexandra Manaia Julia Willingale-Theune Version 2.3 English version ELLS European Learning Laboratory for the Life Sciences Anastasios Koutsos, Alexandra Manaia and
Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.
13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both
Replication Study Guide
Replication Study Guide This study guide is a written version of the material you have seen presented in the replication unit. Self-reproduction is a function of life that human-engineered systems have
DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!
DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other
Next Generation Sequencing
Next Generation Sequencing Technology and applications 10/1/2015 Jeroen Van Houdt - Genomics Core - KU Leuven - UZ Leuven 1 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977
a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled
Biology 101 Chapter 14 Name: Fill-in-the-Blanks Which base follows the next in a strand of DNA is referred to. as the base (1) Sequence. The region of DNA that calls for the assembly of specific amino
Crime Scenes and Genes
Glossary Agarose Biotechnology Cell Chromosome DNA (deoxyribonucleic acid) Electrophoresis Gene Micro-pipette Mutation Nucleotide Nucleus PCR (Polymerase chain reaction) Primer STR (short tandem repeats)
The Techniques of Molecular Biology: Forensic DNA Fingerprinting
Revised Fall 2011 The Techniques of Molecular Biology: Forensic DNA Fingerprinting The techniques of molecular biology are used to manipulate the structure and function of molecules such as DNA and proteins
HiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
13.2 Ribosomes & Protein Synthesis
13.2 Ribosomes & Protein Synthesis Introduction: *A specific sequence of bases in DNA carries the directions for forming a polypeptide, a chain of amino acids (there are 20 different types of amino acid).
Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS)
Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) A typical RNA Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,
Quantum and Non-deterministic computers facing NP-completeness
Quantum and Non-deterministic computers facing NP-completeness Thibaut University of Vienna Dept. of Business Administration Austria Vienna January 29th, 2013 Some pictures come from Wikipedia Introduction
Protein Synthesis How Genes Become Constituent Molecules
Protein Synthesis Protein Synthesis How Genes Become Constituent Molecules Mendel and The Idea of Gene What is a Chromosome? A chromosome is a molecule of DNA 50% 50% 1. True 2. False True False Protein
2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.
1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence
The Steps. 1. Transcription. 2. Transferal. 3. Translation
Protein Synthesis Protein synthesis is simply the "making of proteins." Although the term itself is easy to understand, the multiple steps that a cell in a plant or animal must go through are not. In order
Structure and Function of DNA
Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four
Basic Concepts of DNA, Proteins, Genes and Genomes
Basic Concepts of DNA, Proteins, Genes and Genomes Kun-Mao Chao 1,2,3 1 Graduate Institute of Biomedical Electronics and Bioinformatics 2 Department of Computer Science and Information Engineering 3 Graduate
Thymine = orange Adenine = dark green Guanine = purple Cytosine = yellow Uracil = brown
1 DNA Coloring - Transcription & Translation Transcription RNA, Ribonucleic Acid is very similar to DNA. RNA normally exists as a single strand (and not the double stranded double helix of DNA). It contains
IIID 14. Biotechnology in Fish Disease Diagnostics: Application of the Polymerase Chain Reaction (PCR)
IIID 14. Biotechnology in Fish Disease Diagnostics: Application of the Polymerase Chain Reaction (PCR) Background Infectious diseases caused by pathogenic organisms such as bacteria, viruses, protozoa,
Activity 4 Long-Term Effects of Drug Addiction
Activity 4 Long-Term Effects of Drug Addiction Core Concept: Addictive drugs may lead to long-term changes in brain function. Class time required: Approximately 60-80 minutes Teacher Provides: Copy of
Searching Nucleotide Databases
Searching Nucleotide Databases 1 When we search a nucleic acid databases, Mascot always performs a 6 frame translation on the fly. That is, 3 reading frames from the forward strand and 3 reading frames
Doctor of Philosophy in Computer Science
Doctor of Philosophy in Computer Science Background/Rationale The program aims to develop computer scientists who are armed with methods, tools and techniques from both theoretical and systems aspects
Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )
Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins
13.4 Gene Regulation and Expression
13.4 Gene Regulation and Expression Lesson Objectives Describe gene regulation in prokaryotes. Explain how most eukaryotic genes are regulated. Relate gene regulation to development in multicellular organisms.
From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains
Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes
Activity 7.21 Transcription factors
Purpose To consolidate understanding of protein synthesis. To explain the role of transcription factors and hormones in switching genes on and off. Play the transcription initiation complex game Regulation
Biotechnology: DNA Technology & Genomics
Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 The BIG Questions How can we use our knowledge of DNA to: diagnose disease or defect? cure disease or defect? change/improve organisms? What
Name: Date: Period: DNA Unit: DNA Webquest
Name: Date: Period: DNA Unit: DNA Webquest Part 1 History, DNA Structure, DNA Replication DNA History http://www.dnaftb.org/dnaftb/1/concept/index.html Read the text and answer the following questions.
Genetic Testing in Research & Healthcare
We Innovate Healthcare Genetic Testing in Research & Healthcare We Innovate Healthcare Genetic Testing in Research and Healthcare Human genetic testing is a growing science. It is used to study genes
Big Data Challenges. technology basics for data scientists. Spring - 2014. Jordi Torres, UPC - BSC www.jorditorres.
Big Data Challenges technology basics for data scientists Spring - 2014 Jordi Torres, UPC - BSC www.jorditorres.eu @JordiTorresBCN Data Deluge: Due to the changes in big data generation Example: Biomedicine
restriction enzymes 350 Home R. Ward: Spring 2001
restriction enzymes 350 Home Restriction Enzymes (endonucleases): molecular scissors that cut DNA Properties of widely used Type II restriction enzymes: recognize a single sequence of bases in dsdna, usually
Lecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides
Lecture Series 7 From DNA to Protein: Genotype to Phenotype Reading Assignments Read Chapter 7 From DNA to Protein A. Genes and the Synthesis of Polypeptides Genes are made up of DNA and are expressed
EPIGENETICS DNA and Histone Model
EPIGENETICS ABSTRACT A 3-D cut-and-paste model depicting how histone, acetyl and methyl molecules control access to DNA and affect gene expression. LOGISTICS TIME REQUIRED LEARNING OBJECTIVES DNA is coiled
Transcription and Translation of DNA
Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes
Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in
DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results
Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College
Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology
Nanocomputer & Architecture
Nanocomputer & Architecture Yingjie Wei Western Michigan University Department of Computer Science CS 603 - Dr. Elise dedonckor Febrary 4 th, 2004 Nanocomputer Architecture Contents Overview of Nanotechnology
Amazing DNA facts. Hands-on DNA: A Question of Taste Amazing facts and quiz questions
Amazing DNA facts These facts can form the basis of a quiz (for example, how many base pairs are there in the human genome?). Students should be familiar with most of this material, so the quiz could be
Control of Gene Expression
Control of Gene Expression What is Gene Expression? Gene expression is the process by which informa9on from a gene is used in the synthesis of a func9onal gene product. What is Gene Expression? Figure
DNA and Forensic Science
DNA and Forensic Science Micah A. Luftig * Stephen Richey ** I. INTRODUCTION This paper represents a discussion of the fundamental principles of DNA technology as it applies to forensic testing. A brief
Human Genome and Human Genome Project. Louxin Zhang
Human Genome and Human Genome Project Louxin Zhang A Primer to Genomics Cells are the fundamental working units of every living systems. DNA is made of 4 nucleotide bases. The DNA sequence is the particular
DNA, RNA, Protein synthesis, and Mutations. Chapters 12-13.3
DNA, RNA, Protein synthesis, and Mutations Chapters 12-13.3 1A)Identify the components of DNA and explain its role in heredity. DNA s Role in heredity: Contains the genetic information of a cell that can
DNA Sequence Analysis
DNA Sequence Analysis Two general kinds of analysis Screen for one of a set of known sequences Determine the sequence even if it is novel Screening for a known sequence usually involves an oligonucleotide
From DNA to Protein
Nucleus Control center of the cell contains the genetic library encoded in the sequences of nucleotides in molecules of DNA code for the amino acid sequences of all proteins determines which specific proteins
D A T A M I N I N G C L A S S I F I C A T I O N
D A T A M I N I N G C L A S S I F I C A T I O N FABRICIO VOZNIKA LEO NARDO VIA NA INTRODUCTION Nowadays there is huge amount of data being collected and stored in databases everywhere across the globe.
Algorithms in Computational Biology (236522) spring 2007 Lecture #1
Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office
2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three
Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,
Gene Models & Bed format: What they represent.
GeneModels&Bedformat:Whattheyrepresent. Gene models are hypotheses about the structure of transcripts produced by a gene. Like all models, they may be correct, partly correct, or entirely wrong. Typically,
Integrating Bioinformatics, Medical Sciences and Drug Discovery
Integrating Bioinformatics, Medical Sciences and Drug Discovery M. Madan Babu Centre for Biotechnology, Anna University, Chennai - 600025 phone: 44-4332179 :: email: [email protected] Bioinformatics
Analysis of Computer Algorithms. Algorithm. Algorithm, Data Structure, Program
Analysis of Computer Algorithms Hiroaki Kobayashi Input Algorithm Output 12/13/02 Algorithm Theory 1 Algorithm, Data Structure, Program Algorithm Well-defined, a finite step-by-step computational procedure
14.3 Studying the Human Genome
14.3 Studying the Human Genome Lesson Objectives Summarize the methods of DNA analysis. State the goals of the Human Genome Project and explain what we have learned so far. Lesson Summary Manipulating
Bioinformatics Resources at a Glance
Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences
Manipulating Nature: Limitations of Silicon Computers and the Rise of DNA Computing
Travis Yoshimoto [email protected] Manipulating Nature: Limitations of Silicon Computers and the Rise of DNA Computing Abstract: Computers run the world in which we live. However, as current computer
Long-Term Effects of Drug Addiction
Long-Term Effects of Drug Addiction Part 1: Addiction is a chronic disease Drug addiction is considered a chronic brain disease because drugs cause long-lasting changes in brain structure and function.
International Language Character Code
, pp.161-166 http://dx.doi.org/10.14257/astl.2015.81.33 International Language Character Code with DNA Molecules Wei Wang, Zhengxu Zhao, Qian Xu School of Information Science and Technology, Shijiazhuang
Asking Hard Graph Questions. Paul Burkhardt. February 3, 2014
Beyond Watson: Predictive Analytics and Big Data U.S. National Security Agency Research Directorate - R6 Technical Report February 3, 2014 300 years before Watson there was Euler! The first (Jeopardy!)
Provincial Exam Questions. 9. Give one role of each of the following nucleic acids in the production of an enzyme.
Provincial Exam Questions Unit: Cell Biology: Protein Synthesis (B7 & B8) 2010 Jan 3. Describe the process of translation. (4 marks) 2009 Sample 8. What is the role of ribosomes in protein synthesis? A.
Using Digital Photography to Supplement Learning of Biotechnology. Methods
RESEARCH ON LEARNING Using Digital Photography to Supplement Learning of Biotechnology Fran n orf l u s AbstrAct The author used digital photography to supplement learning of biotechnology by students
Regents Biology REGENTS REVIEW: PROTEIN SYNTHESIS
Period Date REGENTS REVIEW: PROTEIN SYNTHESIS 1. The diagram at the right represents a portion of a type of organic molecule present in the cells of organisms. What will most likely happen if there is
Course Curriculum for Master Degree in Medical Laboratory Sciences/Clinical Microbiology, Immunology and Serology
Course Curriculum for Master Degree in Medical Laboratory Sciences/Clinical Microbiology, Immunology and Serology The Master Degree in Medical Laboratory Sciences / Clinical Microbiology, Immunology or
How many of you have checked out the web site on protein-dna interactions?
How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss
Primary Memory. Input Units CPU (Central Processing Unit)
Basic Concepts of Computer Hardware Primary Memory Input Units CPU (Central Processing Unit) Output Units This model of the typical digital computer is often called the von Neuman compute Programs and
Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals
Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals Xiaohui Xie 1, Jun Lu 1, E. J. Kulbokas 1, Todd R. Golub 1, Vamsi Mootha 1, Kerstin Lindblad-Toh
Management Challenge. Managing Hardware Assets. Central Processing Unit. What is a Computer System?
Management Challenge Managing Hardware Assets What computer processing and storage capability does our organization need to handle its information and business transactions? What arrangement of computers
VLLM0421c Medical Microbiology I, practical sessions. Protocol to topic J10
Topic J10+11: Molecular-biological methods + Clinical virology I (hepatitis A, B & C, HIV) To study: PCR, ELISA, your own notes from serology reactions Task J10/1: DNA isolation of the etiological agent
Molecular Computation Of Solutions To Combinatorial. Problems
1 Molecular Computation Of Solutions To Combinatorial Problems Leonard M. Adleman Professor Leonard M. Adleman Department of Computer Science and Institute for Molecular Medicine and Technology University
DNA Scissors: Introduction to Restriction Enzymes
DNA Scissors: Introduction to Restriction Enzymes Objectives At the end of this activity, students should be able to 1. Describe a typical restriction site as a 4- or 6-base- pair palindrome; 2. Describe
Hidden Markov Models in Bioinformatics. By Máthé Zoltán Kőrösi Zoltán 2006
Hidden Markov Models in Bioinformatics By Máthé Zoltán Kőrösi Zoltán 2006 Outline Markov Chain HMM (Hidden Markov Model) Hidden Markov Models in Bioinformatics Gene Finding Gene Finding Model Viterbi algorithm
CCR Biology - Chapter 8 Practice Test - Summer 2012
Name: Class: Date: CCR Biology - Chapter 8 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. What did Hershey and Chase know
Bob Jesberg. Boston, MA April 3, 2014
DNA, Replication and Transcription Bob Jesberg NSTA Conference Boston, MA April 3, 2014 1 Workshop Agenda Looking at DNA and Forensics The DNA, Replication i and Transcription i Set DNA Ladder The Double
To be able to describe polypeptide synthesis including transcription and splicing
Thursday 8th March COPY LO: To be able to describe polypeptide synthesis including transcription and splicing Starter Explain the difference between transcription and translation BATS Describe and explain
Forensic DNA Testing Terminology
Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.
Beginner s Guide to Real-Time PCR
Beginner s Guide to Real-Time PCR 02 Real-time PCR basic principles PCR or the Polymerase Chain Reaction has become the cornerstone of modern molecular biology the world over. Real-time PCR is an advanced
CELLS IN THE NERVOUS SYSTEM
NEURONS AND GLIA CELLS IN THE NERVOUS SYSTEM Glia Insulates, supports, and nourishes neurons Neurons Process information Sense environmental changes Communicate changes to other neurons Command body response
Scottish Qualifications Authority
National Unit specification: general information Unit code: FH2G 12 Superclass: RH Publication date: March 2011 Source: Scottish Qualifications Authority Version: 01 Summary This Unit is a mandatory Unit
RNA Structure and folding
RNA Structure and folding Overview: The main functional biomolecules in cells are polymers DNA, RNA and proteins For RNA and Proteins, the specific sequence of the polymer dictates its final structure
Mitochondrial DNA Analysis
Mitochondrial DNA Analysis Lineage Markers Lineage markers are passed down from generation to generation without changing Except for rare mutation events They can help determine the lineage (family tree)
Lab # 12: DNA and RNA
115 116 Concepts to be explored: Structure of DNA Nucleotides Amino Acids Proteins Genetic Code Mutation RNA Transcription to RNA Translation to a Protein Figure 12. 1: DNA double helix Introduction Long
Gene Expression Assays
APPLICATION NOTE TaqMan Gene Expression Assays A mpl i fic ationef ficienc yof TaqMan Gene Expression Assays Assays tested extensively for qpcr efficiency Key factors that affect efficiency Efficiency
PreciseTM Whitepaper
Precise TM Whitepaper Introduction LIMITATIONS OF EXISTING RNA-SEQ METHODS Correctly designed gene expression studies require large numbers of samples, accurate results and low analysis costs. Analysis
Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis
Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype
Introduction To Real Time Quantitative PCR (qpcr)
Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors
Graph theoretic approach to analyze amino acid network
Int. J. Adv. Appl. Math. and Mech. 2(3) (2015) 31-37 (ISSN: 2347-2529) Journal homepage: www.ijaamm.com International Journal of Advances in Applied Mathematics and Mechanics Graph theoretic approach to
IMBB 2013. Genomic DNA purifica8on
IMBB 2013 Genomic DNA purifica8on Why purify DNA? The purpose of DNA purifica8on from the cell/8ssue is to ensure it performs well in subsequent downstream applica8ons, e.g. Polymerase Chain Reac8on (PCR),
