The Techniques of Molecular Biology: Forensic DNA Fingerprinting
|
|
|
- Neal Terence Miller
- 9 years ago
- Views:
Transcription
1 Revised Fall 2011 The Techniques of Molecular Biology: Forensic DNA Fingerprinting The techniques of molecular biology are used to manipulate the structure and function of molecules such as DNA and proteins in order to understand more about how they function. These molecular biology techniques are not limited to fields such as genetics and cell biology, but they are now commonplace in all areas of biological research including microbiology, evolutionary biology, and botany. For this reason it is important for you to begin to gain experience with the basic fundamentals of molecular biology in the laboratory. One of the most widely publicized uses of molecular biology techniques is for the purpose of identification of criminals through what is commonly called Forensic DNA fingerprinting. DNA Fingerprinting Overview DNA fingerprinting can be used to help identify individuals by revealing the differences in the DNA sequence among different people. Certain non-coding regions of DNA exhibit significant differences in base pair sequence among individuals. Such regions are called polymorphisms (meaning many forms). Thus, you can compare the base pair sequence of a polymorphic region of DNA found at a crime scene with the base pair sequence of a polymorphic region of DNA obtained from the suspects. If the sequence of one of the suspects matches the sequence found at the crime scene, then you can be certain that the suspect was present at the crime scene. In order to simulate this process we must carry-out the following four procedures. 1. Isolate genomic DNA from the crime scene and from the suspects. 2. Amplify (make many copies of) a polymorphic region of the DNA using a technique called polymerase chain reaction (PCR). 3. Treat the DNA obtained in step 2 with enzymes called restriction endonucleases which will cut the DNA into smaller fragments. 4. Subject the fragments of DNA produced from step 3 to agarose gel electrophoresis which will allow you to visualize the DNA fragments and determine their size. Steps 1 and 2 will be conducted by the instructor before your lab begins. You will carry out step 3 the first week, and then step 4 will be conducted during a later lab period. Equipment Needed Almost all of the equipment needed for this lab will be provided to you; however, you will be required to wear gloves throughout all of the lab procedures. Latex and nonlatex gloves are available in the ASU Bookstore and can also be purchased at local drug or discount stores. You will also need to wear protective eyewear for some portions of the lab. We have goggles available for use in the lab, but if you would prefer to purchase your own, they are also available in the ASU Bookstore.
2 DNA Fingerprinting Lab 1: Genomic DNA Isolation & PCR Part 1: DNA Isolation DNA can be obtained from almost any tissue or biological fluid that is left at a crime scene. A hair, blood, and saliva are all possible sources of genomic DNA because all three will contain a few cells with nuclei. Isolating and purifying DNA from these cells is a very common technique in today s world of biotechnology. However, the quantity of DNA obtained from samples such as these will be very small; therefore, the next step in the process is to increase the quantity of DNA using a technique called the polymerase chain reaction (PCR). Part 2: Polymerase Chain Reaction (PCR) The polymerase chain reaction is one of the most important research techniques ever developed, and it has revolutionized most fields of biological research. Its development started in 1983 by Kary Mullis and his colleagues at Cetus Corporation, and in 1993 Mullis won the Nobel prize for this work. In short, the technique uses the enzyme DNA polymerase to make virtually unlimited copies of a piece of DNA. This polymerase enzyme takes monomers (deoxyribonucleoside triphosphates (datp, dgtp, dctp, dttp)), and links them together to make the polymer DNA. Only tiny amounts of the original piece of DNA, known as the template, are required, and millions of copies can be produced in just a few hours. This template is placed in tube along with the DNA polymerase, the monomers, and very short DNA pieces called primers. There are 3 basic steps to the PCR reaction, and these steps are repeated over and over to make millions of copies of the DNA product. Step 1 is to separate the double stranded template DNA into two single stranded DNA molecules. This step is called denaturating or melting the DNA. Because the double stranded DNA is held together by hydrogen bonds, the two strands are easily separated by heat (melted). Step 2 is to allow two short DNA primers to anneal (form base pairs) with the two single stranded templates. These primers must be present in order for the DNA polymerase to make a new DNA strand. The enzyme cannot start synthesizing a new DNA strand from scratch, but if bases are already present (the primers), it can add new nucleotides to it and thus synthesize a whole new strand. Step 3 is the actual synthesis of the new DNA strands which is called elongation. The DNA polymerase enzymatically joins new nucleotides first to the primers, and then to the growing DNA strand. The rate of nucleotide addition is very rapid; several hundred nucleotides will be polymerized within a minute. This process can be repeated many times. The rate of synthesis of new DNA strands is exponential because with each repetition the number of DNA molecules doubles. By the end of the 30 cycles the region you are amplifying will have replicated over a billion times. To see a great animation about PCR please visit the Dolan DNA Learning Center at: The polymerase chain reaction is also described in chapter 19 of your textbook on p
3 Part 3: Restriction Endonuclease Digestion The goal of this exercise is to differentiate between different DNA samples based on differences in base pair sequence. While it is possible to determine the entire linear sequences of bases in DNA, it is a laborious and potentially expensive process. However, thanks to modern molecular biology techniques there is an easier way to determine small differences in base pair sequence between two or more DNA samples. One way is through the use of enzymes called restriction endonucleases. These enzymes, which were discovered in bacteria, recognize specific sequences of base pairs and cut the DNA only at those specific recognition sites. You will use two enzymes called EcoR1 and Sal1, and they cut DNA at the following recognition sites which are indicated in bold: EcoR1 cuts here: GAATTC CTTAAG Whenever the EcoR1 enzyme encounters this pattern of six base pairs, it will cut the DNA at that site. CTGTGCAAGCATGACGTGAATTCGAGGTCAACACATG GACACGTTCGTACTGCACTTAAGCTCCAGTTGTGTAC 3
4 How many pieces of DNA would result from this cut? What differences are there in the pieces? Sal1 cuts here: GTCGAC CAGCTG Whenever the Sal1 enzyme encounters this pattern of six base pairs, it will cut the DNA at that site. TTCTGCACGTCGACAGATGCAGTGAGTGCACACAAGT CCGACGTGCAGCTGTCTACGTCACTCGTGTGTGTTCA How many pieces of DNA would result from this cut? What differences are there in the pieces? Compare the following two DNA fragments. Identify the recognition sites for EcoR1 and Sal1 in the fragments only single strands are shown for simplicity. GTGACACGTCTCGATGAATTCCAGGTGCCATGCAACGAGGTCGACGCTGGAC GACTGAATTCTGACAGTATGAAGTCGACCACACTTACACGGTCGACACTCAT How many pieces of DNA would result from the cuts? Sample 1: # of fragments Sample 2: # of fragments List the fragment sizes from sample 1 in order from largest to smallest. List the fragment sizes form sample 2 in order from largest to smallest. 4
5 Because polymorphic regions of the genome may differ significantly in base pair sequence among individuals, restriction sites may also differ among individuals. Sites that are present in one person s DNA may be absent in another person s DNA. Thus, restriction digestion of a polymorphic region from two different individuals will result in different numbers and sizes of DNA fragments. Therefore, if the DNA fragments obtained from a suspect s DNA exactly match the fragments obtained from DNA found at a crime scene, you can be certain that the suspect was at the crime scene. Restriction Endonuclease Digestion Protocol Each lab bench will be provided with a sample of DNA that was obtained from a crime scene and samples that were obtained from 8 different suspects. Each of the samples has already been amplified by PCR and is now ready to be digested with the restriction endonucleases. Each lab bench will also receive a tube containing the restriction enzymes EcoR1 and Sal1 in the appropriate buffer to allow the enzymes to function. You will pipet 5μl of the enzyme mixture into each of the tubes containing the suspects DNA samples and to the tube containing the crime scene sample. Be sure to use a clean pipet tip each time. 5
6 Part 4: DNA Fingerprinting Lab 2: Agarose Gel Electrophoresis We will purify our PCR products using a common procedure called agarose gel electrophoresis. Agarose is a polysaccharide that is purified from seaweed. The powdered agarose is mixed with a buffer solution and then dissolved by heating the mixture in a microwave. The molten agarose is then poured into a small plastic tray, and as the agarose cools it solidifies to form a gel. A small plastic comb is inserted in the tray while the agarose is still in its molten state, and after the gel solidifies the comb is removed leaving behind small wells. The DNA sample will be mixed with a loading dye and pipeted into the wells, and an electric current will then be applied to the gel which will cause the negatively charged DNA molecules to migrate through the gel toward the positive terminal. Specifically, the DNA will weave its way through tiny pores in the gel as it is pushed/pulled along by the electric current. Because electrophoresis is just a modified form of chromatography, the rate of migration of the DNA molecules is determined by the size of the molecules. Thus, the smaller molecules will migrate faster than larger molecules. In the figure the band of DNA indicated as B is the smallest and the band of DNA indicated as D is the largest. In this example, the rank order of size from smallest to largest is B < C < A < D. In order to see the DNA in the gel, a chemical called ethidium bromide (EtBr) was added to the agarose while it was still in its molten state. Ethidium bromide is a molecule that inserts or intercalates between the bases of double stranded DNA. Under UV light EtBr fluoresces, therefore DNA becomes visible under UV light in the presence of EtBr. EtBr is a potent mutagen (may cause genetic damage) and is moderately toxic. Always wear appropriate protective equipment, such as gloves and safety goggles, when handling EtBr or the agarose gels that contain EtBr. In addition, UV light is damaging to skin and eyes. Please use caution when near the UV light source and always wear safety glasses or a protective face mask. Ethidium intercalates between base pairs of DNA. (images from Dr. Steven Berg, Winona State University) Smaller molecules of DNA will migrate through the pores of the agarose toward the positive terminal faster than larger molecules of DNA. After a period of time, molecules of DNA of different sizes will be spread out within the gel. We will identify our bands of DNA under UV light when we compare our sample to the standard DNA markers we will also place in the gel. 6
7 Electrophoresis Protocol You will have about 10μl of each suspect and crime scene sample to which you will add a loading dye (your instructor will tell you the exact volume). The loading dye contains several dyes which will migrate through the gel when the electric current is applied. The smallest of these dyes is designed to migrate through the gel at least as fast as any small fragments of DNA. Therefore, when the first dye is nearing the end of the gel, you will know that the DNA is not far behind. It also contains a complex carbohydrate called ficoll that helps the DNA settle to the bottom when the sample is pipetted into the well. This dye comes as a 6x stock, and you want its final concentration to be approximately 1x. Check with your instructor to determine the appropriate volume to add to your samples and follow the instructions they provide. Your professor will pipet standard DNA markers, known as a ladder, into the first well on the left side of the gel. Next, you will pipet the suspects DNA (tubes 1-8) into wells 2-9. Finally, add the crime scene DNA into the last well. The gel will run at 100V for approximately 45 minutes and then the DNA bands will be identified by placing the gel on the UV light box. Interpreting the Gel Your professor will take a picture of the gel and either print it or post it online for you to download. Using the gel picture, estimate the sizes of all the bands by comparing them to sizes of the bands in the DNA ladder. Write that information into the following table. List DNA fragments by size: largest to smallest crime scene suspects Do any of the suspects DNA bands exactly match those from the DNA found at the crime scene? Which one(s)? 7
Crime Scenes and Genes
Glossary Agarose Biotechnology Cell Chromosome DNA (deoxyribonucleic acid) Electrophoresis Gene Micro-pipette Mutation Nucleotide Nucleus PCR (Polymerase chain reaction) Primer STR (short tandem repeats)
Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology
Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,
Objectives: Vocabulary:
Introduction to Agarose Gel Electrophoresis: A Precursor to Cornell Institute for Biology Teacher s lab Author: Jennifer Weiser and Laura Austen Date Created: 2010 Subject: Molecular Biology and Genetics
DNA: A Person s Ultimate Fingerprint
A partnership between the UAB Center for Community Outreach Development and McWane Center DNA: A Person s Ultimate Fingerprint This project is supported by a Science Education Partnership Award (SEPA)
DNA and Forensic Science
DNA and Forensic Science Micah A. Luftig * Stephen Richey ** I. INTRODUCTION This paper represents a discussion of the fundamental principles of DNA technology as it applies to forensic testing. A brief
RESTRICTION ENZYME ANALYSIS OF DNA
University of Massachusetts Medical School Regional Science Resource Center SUPPORTING MATHEMATICS, SCIENCE AND TECHNOLOGY EDUCATION 222 Maple Avenue, Stoddard Building Shrewsbury, MA 01545-2732 508.856.5097
Lab 5: DNA Fingerprinting
Lab 5: DNA Fingerprinting You are about to perform a procedure known as DNA fingerprinting. The data obtained may allow you to determine if the samples of DNA that you will be provided with are from the
DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA
DNA Fingerprinting Unless they are identical twins, individuals have unique DNA DNA fingerprinting The name used for the unambiguous identifying technique that takes advantage of differences in DNA sequence
DNA Fingerprinting. Biotechnology - Electrophoresis & DNA Fingerprinting Biology 100 - Concepts of Biology 8.1. Name Instructor Lab Section.
Biotechnology - Electrophoresis & DNA Fingerprinting Biology 100 - Concepts of Biology 8.1 Name Instructor Lab Section Objectives: To gain a better understanding of: Fundamental Biotechnology Techniques
Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA
Page 1 of 5 Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA Genetics Exercise: Understanding how meiosis affects genetic inheritance and DNA patterns
HiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
IIID 14. Biotechnology in Fish Disease Diagnostics: Application of the Polymerase Chain Reaction (PCR)
IIID 14. Biotechnology in Fish Disease Diagnostics: Application of the Polymerase Chain Reaction (PCR) Background Infectious diseases caused by pathogenic organisms such as bacteria, viruses, protozoa,
Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation
Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna
Cloning GFP into Mammalian cells
Protocol for Cloning GFP into Mammalian cells Studiepraktik 2013 Molecular Biology and Molecular Medicine Aarhus University Produced by the instructors: Tobias Holm Bønnelykke, Rikke Mouridsen, Steffan
DNA Technology Mapping a plasmid digesting How do restriction enzymes work?
DNA Technology Mapping a plasmid A first step in working with DNA is mapping the DNA molecule. One way to do this is to use restriction enzymes (restriction endonucleases) that are naturally found in bacteria
The Chinese University of Hong Kong School of Life Sciences Biochemistry Program CUGEN Ltd.
The Chinese University of Hong Kong School of Life Sciences Biochemistry Program CUGEN Ltd. DNA Forensic and Agarose Gel Electrophoresis 1 OBJECTIVES Prof. Stephen K.W. Tsui, Dr. Patrick Law and Miss Fion
Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College
Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology
AGAROSE GEL ELECTROPHORESIS:
AGAROSE GEL ELECTROPHORESIS: BEST PRACTICES (BACK TO THE BASICS) Unit of Tropical Laboratory Medicine April 2009 Marcella Mori WORKFLOW OF AGAROSE GEL ELECTROPHORESIS: THREE STEPS Agarose gel electrophoresis
DNA Electrophoresis Lesson Plan
DNA Electrophoresis Lesson Plan Primary Learning Outcomes: Students will learn how to properly load a well in an agarose gel. Students will learn how to analyze the results of DNA electrophoresis. Students
1/12 Dideoxy DNA Sequencing
1/12 Dideoxy DNA Sequencing Dideoxy DNA sequencing utilizes two steps: PCR (polymerase chain reaction) amplification of DNA using dideoxy nucleoside triphosphates (Figures 1 and 2)and denaturing polyacrylamide
LAB 7 DNA RESTRICTION for CLONING
BIOTECHNOLOGY I DNA RESTRICTION FOR CLONING LAB 7 DNA RESTRICTION for CLONING STUDENT GUIDE GOALS The goals of this lab are to provide the biotech student with experience in DNA digestion with restriction
CCR Biology - Chapter 9 Practice Test - Summer 2012
Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible
VLLM0421c Medical Microbiology I, practical sessions. Protocol to topic J10
Topic J10+11: Molecular-biological methods + Clinical virology I (hepatitis A, B & C, HIV) To study: PCR, ELISA, your own notes from serology reactions Task J10/1: DNA isolation of the etiological agent
The Biotechnology Education Company
EDVTEK P.. Box 1232 West Bethesda, MD 20827-1232 The Biotechnology 106 EDV-Kit # Principles of DNA Sequencing Experiment bjective: The objective of this experiment is to develop an understanding of DNA
2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.
1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence
Real-Time PCR Vs. Traditional PCR
Real-Time PCR Vs. Traditional PCR Description This tutorial will discuss the evolution of traditional PCR methods towards the use of Real-Time chemistry and instrumentation for accurate quantitation. Objectives
Transformation Protocol
To make Glycerol Stocks of Plasmids ** To be done in the hood and use RNase/DNase free tips** 1. In a 10 ml sterile tube add 3 ml autoclaved LB broth and 1.5 ul antibiotic (@ 100 ug/ul) or 3 ul antibiotic
Forensic DNA Testing Terminology
Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.
DNA PROFILING IN FORENSIC SCIENCE
DA PROFILIG I FORESIC SCIECE DA is the chemical code that is found in every cell of an individual's body, and is unique to each individual. Because it is unique, the ability to examine DA found at a crime
How Does a Genetic Counselor Detect Mutant Genes? SECTION E. How Genes and the Environment Influence Our Health CHAPTER 3
CHAPTER 3 How Genes and the Environment Influence Our Health SECTION E How Does a Genetic Counselor Detect Mutant Genes? Chapter 3 Modern Genetics for All Students T 211 Chapter 3: Section E Background
DNA Separation Methods. Chapter 12
DNA Separation Methods Chapter 12 DNA molecules After PCR reaction produces many copies of DNA molecules Need a way to separate the DNA molecules from similar sized molecules Only way to genotype samples
Beginner s Guide to Real-Time PCR
Beginner s Guide to Real-Time PCR 02 Real-time PCR basic principles PCR or the Polymerase Chain Reaction has become the cornerstone of modern molecular biology the world over. Real-time PCR is an advanced
1. Molecular computation uses molecules to represent information and molecular processes to implement information processing.
Chapter IV Molecular Computation These lecture notes are exclusively for the use of students in Prof. MacLennan s Unconventional Computation course. c 2013, B. J. MacLennan, EECS, University of Tennessee,
A STUDY ON THE EFFECTIVENESS OF PEER TUTORING AS A TEACHING METHOD IN HIGH SCHOOL BIOTECHNOLOGY LABS. June Camerlengo. Santa Fe High School
A STUDY ON THE EFFECTIVENESS OF PEER TUTORING AS A TEACHING METHOD IN HIGH SCHOOL BIOTECHNOLOGY LABS. 1 June Camerlengo Santa Fe High School A STUDY ON THE EFFECTIVENESS OF PEER TUTORING AS A TEACHING
PCR Optimization. Table of Contents Fall 2012
Table of Contents Optimizing the Polymerase Chain Reaction Introduction.....1 Review of Mathematics........ 3 Solving Problems of Dilution and Concentration: Two Approaches.. 4 Experiment Overview 7 Calculations
Protocol. Introduction to TaqMan and SYBR Green Chemistries for Real-Time PCR
Protocol Introduction to TaqMan and SYBR Green Chemistries for Real-Time PCR Copyright 2008, 2010 Applied Biosystems. All rights reserved. Ambion and Applied Biosystems products are for Research Use Only.
Computer 6B. Forensic DNA Fingerprinting
Forensic DNA Fingerprinting Computer 6B Scientists working in forensic labs are often asked to perform DNA profiling or fingerprinting to analyze evidence in law enforcement, mass disasters, and paternity
Amazing DNA facts. Hands-on DNA: A Question of Taste Amazing facts and quiz questions
Amazing DNA facts These facts can form the basis of a quiz (for example, how many base pairs are there in the human genome?). Students should be familiar with most of this material, so the quiz could be
Electrophoresis, cleaning up on spin-columns, labeling of PCR products and preparation extended products for sequencing
Electrophoresis, cleaning up on spin-columns, labeling of PCR products and preparation extended products for sequencing PAGE electrophoresis Polyacrylamide gel electrophoresis (PAGE) is used for separating
Gene Mapping Techniques
Gene Mapping Techniques OBJECTIVES By the end of this session the student should be able to: Define genetic linkage and recombinant frequency State how genetic distance may be estimated State how restriction
Crime Scene Investigator PCR Basics Kit
Biotechnology Explorer Crime Scene Investigator PCR Basics Kit Catalog #166-2600EDU explorer.bio-rad.com Note: Kit contains temperature-sensitive reagents. pen immediately upon arrival and store components
GENOTYPING ASSAYS AT ZIRC
GENOTYPING ASSAYS AT ZIRC A. READ THIS FIRST - DISCLAIMER Dear ZIRC user, We now provide detailed genotyping protocols for a number of zebrafish lines distributed by ZIRC. These protocols were developed
Identification of the VTEC serogroups mainly associated with human infections by conventional PCR amplification of O-associated genes
Identification of the VTEC serogroups mainly associated with human infections by conventional PCR amplification of O-associated genes 1. Aim and field of application The present method concerns the identification
PTC DNA Fingerprint Gel
BIO 141 PTC DNA Fingerprint Analysis (Modified 3/14) PTC DNA Fingerprint Gel taster non- non- non- non- 100 bp taster taster taster taster taster taster taster ladder Tt tt Tt TT tt tt Tt tt 500 bp 300
Mitochondrial DNA Analysis
Mitochondrial DNA Analysis Lineage Markers Lineage markers are passed down from generation to generation without changing Except for rare mutation events They can help determine the lineage (family tree)
Willmar Public Schools Curriculum Map
Subject Area Science Senior High Course Name Forensics Date June 2010 Timeline Content Standards Addressed Skills/Benchmarks Essential Questions Assessments 1-2 Introduction History and Development of
CURRICULUM GUIDE. When this Forensics course has been completed successfully, students should be able to:
CURRICULUM GUIDE NAME OF COURSE: FORENSICS COURSE NUMBER: SCI 40 WRITTEN / REVISED: SEPTEMBER, 2011 LEVEL OF COURSE: REPLACMENT NUMBER OF CREDITS: SIX (6) PREREQUISITES: BIOLOGY GRADE LEVELS OFFERED TO:
Application Note. Biotechnology Explorer Crime Scene Investigator PCR Basics. Kit: A Real-Time PCR Extension
Biotechnology Explorer Crime Scene Investigator PCR Basics Kit: Table of Contents Introduction.............................................. 2 Learning Objectives......................................
Troubleshooting Guide for DNA Electrophoresis
Troubleshooting Guide for Electrophoresis. ELECTROPHORESIS Protocols and Recommendations for Electrophoresis electrophoresis problem 1 Low intensity of all or some bands 2 Smeared bands 3 Atypical banding
Troubleshooting Sequencing Data
Troubleshooting Sequencing Data Troubleshooting Sequencing Data No recognizable sequence (see page 7-10) Insufficient Quantitate the DNA. Increase the amount of DNA in the sequencing reactions. See page
Genomic DNA Clean & Concentrator Catalog Nos. D4010 & D4011
Page 0 INSTRUCTION MANUAL Catalog Nos. D4010 & D4011 Highlights Quick (5 minute) spin column recovery of large-sized DNA (e.g., genomic, mitochondrial, plasmid (BAC/PAC), viral, phage, (wga)dna, etc.)
Bio 3A Lab: DNA Isolation and the Polymerase Chain Reaction
Bio 3A Lab: DNA Isolation and the Polymerase Chain Reaction Objectives Understand the process of DNA isolation Perform DNA isolation using cheek cells Use thermal cycler and Taq polymerase to perform DNA
DNA Scissors: Introduction to Restriction Enzymes
DNA Scissors: Introduction to Restriction Enzymes Objectives At the end of this activity, students should be able to 1. Describe a typical restriction site as a 4- or 6-base- pair palindrome; 2. Describe
Biotechnology Explorer
Biotechnology Explorer Chromosome 16: PV92 PCR Informatics Kit Catalog #166-2100EDU explorer.bio-rad.com Note: Kit contains temperature-sensitive reagents. Open immediately upon arrival and store components
Bob Jesberg. Boston, MA April 3, 2014
DNA, Replication and Transcription Bob Jesberg NSTA Conference Boston, MA April 3, 2014 1 Workshop Agenda Looking at DNA and Forensics The DNA, Replication i and Transcription i Set DNA Ladder The Double
How is genome sequencing done?
How is genome sequencing done? Using 454 Sequencing on the Genome Sequencer FLX System, DNA from a genome is converted into sequence data through four primary steps: Step One DNA sample preparation; Step
Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources
Appendix 2 Molecular Biology Core Curriculum Websites and Other Resources Chapter 1 - The Molecular Basis of Cancer 1. Inside Cancer http://www.insidecancer.org/ From the Dolan DNA Learning Center Cold
PLB161A Laboratory XI a Genome Mapping
PLB161A Laboratory XI a Genome Mapping Restriction Digests and Agarose Gel Electrophoresis of Genomic DNA. A. Restriction Digests. Introduction Restriction enzymes are a class of DNA endonucleases, which
IMBB 2013. Genomic DNA purifica8on
IMBB 2013 Genomic DNA purifica8on Why purify DNA? The purpose of DNA purifica8on from the cell/8ssue is to ensure it performs well in subsequent downstream applica8ons, e.g. Polymerase Chain Reac8on (PCR),
Intended Use: The kit is designed to detect the 5 different mutations found in Asian population using seven different primers.
Unzipping Genes MBPCR014 Beta-Thalassemia Detection Kit P r o d u c t I n f o r m a t i o n Description: Thalassemia is a group of genetic disorders characterized by quantitative defects in globin chain
RAINBOW ELECTROPHORESIS 1 An Introduction to Gel Electrophoresis
RAINBOW ELECTROPHORESIS 1 An Introduction to Gel Electrophoresis INTRODUCTION This laboratory will demonstrate the basics of electrophoresis and the theory behind the separation of molecules on an agarose
Introduction To Real Time Quantitative PCR (qpcr)
Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors
Taq98 Hot Start 2X Master Mix
Taq98 Hot Start 2X Master Mix Optimized for 98C Denaturation Lucigen Corporation 2905 Parmenter St, Middleton, WI 53562 USA Toll Free: (888) 575-9695 (608) 831-9011 FAX: (608) 831-9012 [email protected]
Evidence Sheets. Fingerprint #1 Fingerprint #2 Fingerprint #3 Fingerprint #4 Fingerprint #5
Evidence Sheets Name: EXHIBIT A: FINGERPRINTS The following fingerprints were found at the crime scene Fingerprint #1 Fingerprint #2 Fingerprint #3 Fingerprint #4 Fingerprint #5 Description: Description:
Recombinant DNA and Biotechnology
Recombinant DNA and Biotechnology Chapter 18 Lecture Objectives What Is Recombinant DNA? How Are New Genes Inserted into Cells? What Sources of DNA Are Used in Cloning? What Other Tools Are Used to Study
Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
14.3 Studying the Human Genome
14.3 Studying the Human Genome Lesson Objectives Summarize the methods of DNA analysis. State the goals of the Human Genome Project and explain what we have learned so far. Lesson Summary Manipulating
Sanger Sequencing and Quality Assurance. Zbigniew Rudzki Department of Pathology University of Melbourne
Sanger Sequencing and Quality Assurance Zbigniew Rudzki Department of Pathology University of Melbourne Sanger DNA sequencing The era of DNA sequencing essentially started with the publication of the enzymatic
4. DNA replication Pages: 979-984 Difficulty: 2 Ans: C Which one of the following statements about enzymes that interact with DNA is true?
Chapter 25 DNA Metabolism Multiple Choice Questions 1. DNA replication Page: 977 Difficulty: 2 Ans: C The Meselson-Stahl experiment established that: A) DNA polymerase has a crucial role in DNA synthesis.
Genetic Technology. Name: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question.
Name: Class: Date: Genetic Technology Multiple Choice Identify the choice that best completes the statement or answers the question. 1. An application of using DNA technology to help environmental scientists
CRIME SCENE FORENSICS
CRIME SCENE FORENSICS Description Crime Scene Forensics, which is a laboratory-based course, will promote and cultivate the development of student s scientific inquiry and scientific method skills, which
Guidelines for Ethidium Bromide Waste Management & Disposal. University of Tennessee-Knoxville
1. Background Guidelines for Ethidium Bromide Waste Management & Disposal University of Tennessee-Knoxville Ethidium bromide (3,8 diamino-5-ethyl-6-phenyl phenanthridinium bromide, dromilac, CAS #1239-45-8),
Chapter 6 DNA Replication
Chapter 6 DNA Replication Each strand of the DNA double helix contains a sequence of nucleotides that is exactly complementary to the nucleotide sequence of its partner strand. Each strand can therefore
Reduced Representation Bisulfite Sequencing for Methylation Analysis Preparing Samples for the Illumina Sequencing Platform
Reduced Representation Bisulfite Sequencing for Methylation Analysis Preparing Samples for the Illumina Sequencing Platform Introduction, 3 Sample Prep Workflow, 4 Best Practices, 5 DNA Input Recommendations,
ABSTRACT. Promega Corporation, Updated September 2008. http://www.promega.com/pubhub. 1 Campbell-Staton, S.
A Modified Wizard SV Genomic DNA Purification System Protocol to Purify Genomic DNA... A Modified Wizard SV Genomic DNA Purification System Protocol to Purify Genomic DNA from Shed Reptile Skin ABSTRACT
Denaturing Gradient Gel Electrophoresis (DGGE)
Laboratory for Microbial Ecology Department of Earth, Ecological and Environmental Sciences University of Toledo Denaturing Gradient Gel Electrophoresis (DGGE) Background information Denaturing gradient
Southern Blot Analysis (from Baker lab, university of Florida)
Southern Blot Analysis (from Baker lab, university of Florida) DNA Prep Prepare DNA via your favorite method. You may find a protocol under Mini Yeast Genomic Prep. Restriction Digest 1.Digest DNA with
The Central Dogma of Molecular Biology
Vierstraete Andy (version 1.01) 1/02/2000 -Page 1 - The Central Dogma of Molecular Biology Figure 1 : The Central Dogma of molecular biology. DNA contains the complete genetic information that defines
STA DARD OPERATI G PROCEDURE FOR THE DETECTIO OF AFRICA SWI E FEVER VIRUS (ASFV) BY CO VE TIO AL POLYMERASE CHAI REACTIO (PCR)
STA DARD OPERATI G PROCEDURE FOR THE DETECTIO OF AFRICA SWI E FEVER VIRUS (ASFV) BY CO VE TIO AL POLYMERASE CHAI REACTIO (PCR) [email protected] Av/ Puerta de Hierro s/n. 28040 Madrid. Tel: (34) 913944082
DNA Replication in Prokaryotes
OpenStax-CNX module: m44488 1 DNA Replication in Prokaryotes OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section,
Plant Genomic DNA Extraction using CTAB
Plant Genomic DNA Extraction using CTAB Introduction The search for a more efficient means of extracting DNA of both higher quality and yield has lead to the development of a variety of protocols, however
Forensic Science TEKS/LINKS Student Objectives One Credit
First Six Weeks Intro/Observation FS 4(A) The student will distinguish between forensic science and criminalistics in law, public safety, corrections, and security. FS 5(D) The student will apply knowledge
DNA SPOOLING 1 ISOLATION OF DNA FROM ONION
DNA SPOOLING 1 ISOLATION OF DNA FROM ONION INTRODUCTION This laboratory protocol will demonstrate several basic steps required for isolation of chromosomal DNA from cells. To extract the chromosomal DNA,
Agarose Gel Electrophoresis
Treseder Lab Protocol Molecular Techniques Rev. 08/2007 Agarose Gel Electrophoresis Introduction Agarose gel electrophoresis is a quick and easy molecular technique used to analyze and separate nucleic
PrimeSTAR HS DNA Polymerase
Cat. # R010A For Research Use PrimeSTAR HS DNA Polymerase Product Manual Table of Contents I. Description...3 II. III. IV. Components...3 Storage...3 Features...3 V. General Composition of PCR Reaction
Investigating a Eukaryotic Genome: Cloning and Sequencing a Fragment of Yeast DNA
Investigating a Eukaryotic Genome: Cloning and Sequencing a Fragment of Yeast DNA Credits: This lab was created by Sarah C.R. Elgin and developed and written by Kathleen Weston-Hafer. Specific protocols
Description: Molecular Biology Services and DNA Sequencing
Description: Molecular Biology s and DNA Sequencing DNA Sequencing s Single Pass Sequencing Sequence data only, for plasmids or PCR products Plasmid DNA or PCR products Plasmid DNA: 20 100 ng/μl PCR Product:
Beware that ordinary prescription glasses do not provide adequate protection. This is also true with poorly fitting safety glasses.
Ethidium Bromide Introduction Ethidium bromide (EtBr) is widely used for visualization of nucleic acids in electrophoretic gels. EtBr forms fluorescent complexes, by intercalation of DNA, which are readily
ZR DNA Sequencing Clean-up Kit
INSTRUCTION MANUAL ZR DNA Sequencing Clean-up Kit Catalog Nos. D40 & D4051 Highlights Simple 2 Minute Bind, Wash, Elute Procedure Flexible 6-20 µl Elution Volumes Allow for Direct Loading of Samples with
Essentials of Real Time PCR. About Sequence Detection Chemistries
Essentials of Real Time PCR About Real-Time PCR Assays Real-time Polymerase Chain Reaction (PCR) is the ability to monitor the progress of the PCR as it occurs (i.e., in real time). Data is therefore collected
The Analysis of Food Samples for the Presence of Genetically Modified Organisms
The Analysis of Food Samples for the Presence of Genetically Modified Organisms Session 5 Agarose Gel Electrophoresis M. Somma, M. Querci WORLD HEALTH ORGANIZATION REGIONAL OFFICE FOR EUROPE ORGANISATION
- In 1976 1977, Allan Maxam and walter Gilbert devised the first method for sequencing DNA fragments containing up to ~ 500 nucleotides.
DNA Sequencing - DNA sequencing includes several methods and technologies that are used for determining the order of the nucleotide bases adenine, guanine, cytosine, and thymine in a molecule of DNA. -
PicoMaxx High Fidelity PCR System
PicoMaxx High Fidelity PCR System Instruction Manual Catalog #600420 (100 U), #600422 (500 U), and #600424 (1000 U) Revision C Research Use Only. Not for Use in Diagnostic Procedures. 600420-12 LIMITED
Bio 6 Restriction Enzyme Digestion Lab
Bio 6 Restriction Enzyme Digestion Lab Objectives Upon completion of this laboratory you will understand how to: 1) set up and carry out a restriction enzyme digest of DNA, 2) carry out agarose gel electrophoresis
Blood Stain Analysis Part One
Hughes Undergraduate Biological Science Education Initiative HHMI Blood Stain Analysis Part One Investigators often find blood stains during their examination of a crime scene. They also find stains that
First Strand cdna Synthesis
380PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 [email protected] A Geno Technology, Inc. (USA) brand name First Strand cdna Synthesis (Cat. # 786 812) think proteins! think G-Biosciences
DNA quality: electrophoresis, spectrophotometry and fluorometry
DNA quality: electrophoresis, spectrophotometry and fluorometry Ambika B Gaikwad [email protected] After isolation of DNA, quantification and analysis of quality are necessary to ascertain the approximate
Touch DNA and DNA Recovery. H. Miller Coyle
Touch DNA and DNA Recovery 1 2 What is the link between cell biology & forensic science? Cells are the trace substances left behind that can identify an individual. Cells contain DNA. There are two forms
Innocent or Guilty: A Lab on DNA Gel Electrophoresis JoAnn Smith, California Studio Teacher, North Hills, CA
Innocent or Guilty: A Lab on DNA Gel Electrophoresis JoAnn Smith, California Studio Teacher, North Hills, CA INTRODUCTION Description This lesson, based on EDVOTEK Kit #109, DNA Fingerprinting I: Identification
