14/12/2012. HLA typing - problem #1. Applications for NGS. HLA typing - problem #1 HLA typing - problem #2

Transcription

1 Routine HLA typing by Next Generation Sequencing Kaimo Hirv Center for Human Genetics and Laboratory Medicine Dr. Klein & Dr. Rost Lochhamer Str. 9 D-8 Martinsried Tel: 0800-GENETIK or info@medical-genetics.de Applications for NGS HLA typing - problem # HLA Chimerism Analysis Registry Donor Search MRD Cord Blood Molecular Oncology HLA typing - problem # HLA typing - problem # - work-intensive - time-consuming - cost-intensive

2 HLA typing - problem # NGS Technologies Advantages of the NGS technology - clonal amplification less ambiguities - multiplexing high throughput - reduced sequencing costs per base Requirements - high number of samples - not time critical analysis - identical requests MiSeq Roche GS FLX Ion Torrent Read length 0 bp bp 00 bp Output/run GB 0,8 GB GB (8) Indexing > 00 0 > 00 Accuracy high-moderate high-moderate moderate Cost/run Tissue Antigens 009, 7, 9-0 of - 7 HLA Loci (A, B, C, DRB, DQB, DQA, DPB) - up to 8 DNA samples in one sequencing run Applications for NGS Registry HLA Chimerism Analysis Registry Donor Search MRD Cord Blood Molecular Oncology

3 GS FLX Titanium Chemistry Process Steps - Overview TS-Primer = Target-Specific Primer Library Preparation ACACTGACGACATGGTTCTACACSGCCTCTGYGGGGAGAAGCA. Rapid Library Construction * gdna. h. empcr h hands on h amplification. Sequencing h prep 9 h run Data output Tag Seq MID-Primer = Barcode Primer TS-Primer DNA Library Preparation Prepare double-stranded DNA library with adapters Emulsion Titrations** empcr dstdna with adaptors attached to bead Clonally amplified sstdna in emulsion Sequencing Prepare sequencing run Quality filtered bases Forward CGTATCGCCTCCCTCGCGCCATCAGACGAGTGCGTACACTGACGACATGGTTCTACA Adaptor-Sequence Key Seq MID Seq Tag Seq sstdna ready to sequence ACACTGACGACATGGTTCTACACSGCCTCTGYGGGGAGAAGCA... TGTGACTGCTGTACCAAGATGTGSCGGAGACYCCCCTCTTCGT... CGTATCGCCTCCCTCGCGCCATCAGACGAGTGCGTACACTGACGACATGGTTCTACACSGCCTCTGYGGGGAGAAGCA... * One library provides enough DNA for thousands of sequencing runs. ** Only one titration is required for each sample. Pos., Matrix Mastermix 80µl 8 Tubes in Spalte Pos., Matrix Forward MID 0µl 9 Tubes PCR Setup Pos., PCR 9 Forward Primer 0µl B-8 in 8 Spalten Pos., PCR 9 Reverse Primer 0µl C-8 in 8 Spalten 9 DNA samples + neg-control PCR-Plates x 8 Pos., Matrix Reverse MID 0µl 9 Tubes Pos. & leere PCR 8 Platten Pos., Matrix DNA 0µl 9 Tubes - workstation with 9 Probe Head - 8-well Thermocycler Pooling PCR Purification PCR-Platte x second workstation with 8 channels - third workstation with 8 channels - Agencourt AmPure XP system

4 PCR Purification Process Steps. Emulsion PCR gdna. DNA Library Construction *. h. empcr h hands on. Sequencing h prep Data output h amp 9 h run Mix denatured dstdna library with DNA Capture beads Emulsify DNA Capture beads and PCR reagents in waterin-oil microreactors Clonal amplification occurs inside microreactors Break microreactors and enrich for DNA- positive beads sstdna library Clonally-amplified sstdna attached to bead 0 Bead Enrichment Process Steps a. Bead Deposition into PicoTiterPlate gdna. DNA Library Construction *. h. empcr h hands on. Sequencing h prep Data output h amp 9 h run Well diameter average for PicoTiterPlate is 9 µm A single clonally amplified sstdna bead (0 µm diameter) is deposited per well. Layers of packing, enzyme and PPiase Beads are deposited Plate is loaded into instrument for sequencing - second workstation with integrated REMe system - enrichment rate ~ -0% Amplified sstdna library beads PTP ready for sequencing GS FLX Titanium Bead Deposition Loading Beads into PicoTiterPlate Each region can be loaded separately Several gaskets can be used (,, 8 and regions) for the same PTP type

5 Ambiguities Ambiguities - Results, n=7 Unambiguous Resultswith G Ambiguous HLA-A 0 0,0% 7 00% 0 0% HLA-B 0,% 7 98,%,% HLA-DRB 77,% 98 8,8% 0 0% B*:0 B*:0 B*:0 Exon Exon Exon Exon Exon Exon Unambiguous: e. g. DRB*0:0:0 B*: Exon Exon Ambiguities outside of exon and : B*:0:0G Ambiguities outside of exon : DRB*:0:0G cis-trans Ambiguities inside of exon and : B*:0:0G, *:0:0G / B*:0, *::0G B*07:0, *:0 / B*0:, *:0 B*:0, *0:0 / B*:, *0: Ambiguities Summary - HLA - HLA typing by Next Generation Sequencing is feasible in a routine usage - 80 samples can be typed for HLA-A, -B and -DRB / run - high resolution can be achieved - most of the results can be reported with suffix G - by high number of samples, the costs are at least comparable with Sanger sequencing - lab automation is needed for high throughput (high costs) - standards must be defined by HLA community Ehrlich et al. BMC Genomics 0

6 Center for Human Genetics and Laboratory Medicine, Dr. Klein & Dr. Rost Lochhamer Street 9 D-8 Martinsried Germany Tel: GENETIK or info@medical-genetics.de Ehrlich et al. BMC Genomics 0