Names for MNS Blood Group Alleles
|
|
|
- Linda Hudson
- 9 years ago
- Views:
Transcription
1 Names for MNS Blood Group Alleles General description: The MNS blood group system consists of 46 antigens carried on glycophorin A (GPA), glycophorin B (GPB) or on hybrids of these glycophorins. These proteins are single pass type I membrane glycoproteins that are heavily O-glycosylated. GPA carries an N- glycan. GPA consists of 131 amino acids, GPB of 7 amino acids and both have a leader sequence of 19 amino acids that is cleaved from the membrane bound protein. The hybrid proteins vary in length based on their composition but also have a 19 amino acid leader sequence. GPA is encoded by GYPA, GPB by GYPB. A third gene in this family, GYPE, normally does not encode detectable protein at the red cell surface but the gene has been shown to be involved in some gene rearrangements that encode cell-surface borne hybrid proteins. As described above, the proteins are encoded by GYPA or GYPB, or MNS if analysis is to predict a blood group antigen. Gene name: GYPA GYPB GYPE Number of exons: 7 5 plus 1 pseudoexon 4 plus pseudoexons Initiation Exon Exon Exon codon: Stop codon: Exon 7 Exon 6 Exon 6 GenBank #: NM_00099 NM_00100 NM_0010 Entrez GeneID: Exon numbering accounts for the presence of pseudoexons in GYPB and GYPE. Thus, GYPB pseudoexon 3 corresponds to the GYPA exon 3 sequence. This GYPB pseudoexon is involved in many gene rearrangements encoding hybrid glycophorins in this blood group system. Similarly, GYPE pseudoexons 3 and 4 correspond to GYPA exon 3 and 4 sequences. These GYPE pseudoexons are involved in gene rearrangements encoding hybrids. Reference allele for GYPA: Accession number: Preferred: Acceptable: Reference allele for GYPB: Accession number: Preferred: Acceptable: L31860 GYPA*01 GYPA*01, GYPA*M or M if inferred by hemagglutination J098 GYPB*04 GYPB*04, GYPB*s or s if inferred by hemagglutination Page 1 of 10
2 Table 1. MNS alleles with single nucleotide polymorphisms that generate blood group antigens. A. GYPA: Reference allele MNS*01 encodes M, En a, ENEH, ENEP, ENAV, ENDA, ENEV. Note: In most cases, the nucleotide changes also can occur on an N allele; these nucleotide changes are not given. Phenotype Allele name Nucleotide change Intron/ Exon MNS:1 or M+ MNS: N+ MNS:1,-,8 M c + MNS:7,9, 40 Vw+ MNS:-1,-,11 M g + MNS:1 Vr+ MNS:14 Mt(a+) MNS:16 Ri(a+); GYPA*01 Amino acid change GYPA*M 59C; 71G; 7T Ser0, Gly4 GYPA*0 GYPA*N 59C>T; 71G>A; 7T>G Ser0Leu, Gly4Glu GYPA*08 GYP.Mc 71G>A,7T>G Gly4Glu GYPA*09 GYPA*Vw 140C>T 3 Thr47Met GYPA*11 GYPA*Mg 68C>A Thr3Asn GYPA*1 GYPA*Vr 197C>A 3 Ser66Tyr GYPA*14 GYPA*Mta 30C>T 3 Thr77Ile GYPA*16 GYPA*Ria 6G>A 3 Glu76Lys MNS:18 Ny(a+) GYPA*18 138T>A 3 Gln46Glu MNS:7,19, 40 Hut+ MNS:31 Or+ MNS:37 ERIK+ GYPA*19 GYPA*Hut 140C>A 3 Thr47Lys GYPA*31 GYPA*Or 148C>T 3 Arg50Trp GYPA*37 GYPA*ERIK 3G>A 4 Gly78Arg MNS:38 GYPA*38 17C>T 3 Pro73Ser Comments See alsogyp.ebh in hybrid table Page of 10
3 Phenotype Allele name Nucleotide change Intron/ Exon Os(a+) GYPA*Osa MNS: 39,41 HAG+ MNS: 4,43 MARS+ GYPA*41 GYPA*HAG 50G>C 4 Ala84Pro GYPA*43 GYPA*MARS 44C>A 4 Glu8Lys MNS: 45 ENEV GYPA* 45 4T>G 4 Val81Gly MNS:46 MNTD+ GYPA*46 GYPA*MNTD 107C>G 3 Thr36Arg Amino acid change Comments Most anti-m but only few anti-n react with M c + RBCs Page 3 of 10
4 Table 1. MNS alleles with single nucleotide polymorphisms that generate blood group antigens. B. GYPB: Reference allele GYPB*04 encodes N, s. Expression of the U antigen involves GPB and another protein, probably RhAG. Phenotype Allele name Nucleotide change MNS:4 s+ MNS :3 S+ MNS:6 s+, He+ MNS:3,6 S+, He+ GYPB*04 GYPB*s Intron/ Exon GYPB*03 GYPB*S 143C>T 4 Thr48Met GYPB*06.01 GYPB* T>G, 60A>G, 67A>T, 71A>G, 7G>T 59T>G, 60A>G, 67A>T, 71A>G, 7G>T, 143C>T MNS:1 M v + GYPB*1 65C>G ThrSer MNS:4 Mit+ GYPB*4 161G>A 4 Arg54His MNS:3 S D + GYPB*3 173C>G 4 Pro58Arg MNS: 3,5W S U+ w MNS: 3,5W S U+ w GYPB*03N.01 GYPB.NY GYPB*03N.0 GYP.He(NY) 143C>T 08G>T; 30C>T; 51C>G; 59T>G; 60A>G; 67A>T; 71A>G; Amino acid change Leu0Trp, Thr3Ser, Glu4Gly; Leu0Trp, Thr3Ser, Glu4Gly; Thr48Met Thr48Met, Ser84Thr Leu0Trp, Thr3Ser, Glu4Gly, Comments Page 4 of 10
5 Phenotype Allele name Nucleotide change MNS: 3,5W S U+ w MNS: 3,5W S U+ w GYPB*03N.03 GYPB.P GYPB*03N.04 GYP.He(P) 7G>T; 143C>T; 08G>T; 30C>T; 51C>G Intron/ Exon C>T; 4 Intron 5+5g>t 59T>G; 60A>G; 67A>T; 71A>G; 7G>T; 143C>T ; 4; Intron 5 +5g>t Amino acid change Thr48Met, Ser84Thr Thr48Met Leu0Trp, Thr3Ser, Glu4Gly, Thr48Met Comments Page 5 of 10
6 Table. MNS alleles created by gene rearrangement events within the GYPA gene family A: parent allele GYPA. Phenotype Allele name Nucleotide Protein Comments GYP(A-A) hybrid series MNS:15 St(a+), MNS:15 St(a+) MNS:15 St(a+) MNS:6,15 He+, St(a+) GYP(A-B) series MNS:- 3,4,0,34 S-s+, Hil+, MINY+ MNS:3,- 4,3,33 S+s-, TSEN+, MINY+ MNS:-1,,-3,- 4,-5,36 M-N+S-s-U-, SAT+ GYP(A-B-A) series GYP* GYP.Zan GYP*101.0 GYP.EBH GYP* GYP.Mar GYP* GYP.Cal GYP*01.01 GYP.Hil GYP*0.01 GYP.JL GYP*03.01 GYP.SAT GYPA del exon 3 GPA del46-77 GYP(A1--BΨ3-A4-7) GYPA 3G>A del exon 3 GPA del46-77 Nucleotide change at 3 destabilises normal splicing. St a is encoded by a GYPA transcript that lacks exon 3. Full-length transcript encodes ERIK (MNS37; see table 1). GYPA del exon 3 GPA del46-77 GYP(A1--EΨ3-A4-7) GYPA 58G>T, 67A>T GPA Gly0Trp, Thr3Ser GPA del GYP(A1-3 B33-31) GP(A1-77-B78-104) GYP(A1-3 B33-31) 39C>T GYP(A1-71 B7-369) 59C>T; 71G>A; 7T>G GP(A1-77-B78-104) Thr80Met GYPA(1-90-B91-13) Ser0Leu, Gly4Glu GYP(A1--BΨ3-A4-7) breakpoint in intron 4 not defined Previously GYP.TK Page 6 of 10
7 Phenotype Allele name Nucleotide Protein Comments MNS:10,3 Mur +, Dane+ MNS:10,3, 44 Mur +, Dane+, ENDA MNS:6, 7 Hop+,Nob+ MNS: 6,7 Hop,Nob+ MNS:0, 34 Hil+, MINY GYP.Vw Numbers have not been assigned to these GYP.Hut alleles in this series and they are included in table 1. It has been proposed that they are GYP.Mc derived from hybrid genes but the crossover GYP.Mg points have not been determined experimentally. GYP* GYP.Dane GYP*301.0 GYP.Dane GYP*30.01 GYP.Joh GYP*30.0 GYP.Nob GYP*303 GYP.KI GYP(A1-159 BΨ A ); 191T>A GYP(A1-159 BΨ A ) GYP(A1-0 BΨ03 A04-450) GYP(A1-0 BΨ03-1 A13-450) 03G>C; 1A>C GYP(A1-38 B39-4 A43-450) 39G>C; 4T>G GP(A1-5-B53-58-A59-149); Ile46Asn GP(A1-5-B53-58-A59-149) GPA(1-67)-B(68)-GPA(69-150) Arg68Thr GPA(1-67)-B(68-7)-GPA(73-150) Arg68Thr; Tyr71Ser GPA(1-79)-B(80-81)-GPA(8-150) Arg80Thr;Val81Gly Also expresses Mur antigen Also expresses Mur antigen; does not express ENDA Gene conversion in exon 3 replaces GYPA nucleotide 03 with the corresponding nucleotide from GYPBΨ3. This is the minimum but the breakpoint is not defined. Gene conversion in exon 3 replaces GYPA nucleotides (03-1) with corresponding nucleotides from GYPBΨ3. This is the minimum but the breakpoint is not defined. Gene conversion in exon 4 replaces GYPA nucleotides (39-4) with corresponding nucleotides from GYPB. This is the minimum but the breakpoint is not defined. Page 7 of 10
8 Table. MNS alleles created by gene rearrangement events within the GYPA gene family: B: parent allele GYPB Phenotype Allele name Nucleotide Amino acid Comments GYP(B-A) hybrid series MNS:15 St(a+) MNS: 3,4,4 Dantu+ GYP(B-A-B) hybrid series MNS: 3,4,8,10,0,34,35 S s+, Mi(a+), Mur+, Hil+, MUT+, MINY+ MNS:3, 4,8,10,6,33,3 4,35 S+s, Mi(a+), Mur+, Hop+, TSEN+, MUT+, MINY+ MNS: 3,4,8,10,0,6 34,35 S s+, Mi(a+), Mur+, Hil+, MUT+, MINY+ MNS: 3,4,8, 0,34,35 S s+, Mi(a+), GYP*401 GYP.Sch GYP.40 GYP.Dantu GYP.501 GYP.Mur GYP.50 GYP.Hop GYP.503 GYP.Bun GYP.504 GYP.HF GYP(B1-136-A ) GPB(1-46)-A(47-118) Reciprocal product is GYP.Hil GYP(B1-175-A ) GPB(1-58)-A(59-118) Reciprocal product is GYP.Tk GYP(B1-136-Bψ A05-9-B30-366) GYP(B1-136-Bψ A05-9-B30-366) 36C>G GYP(B1-136-Bψ A11-9-B30-366) GYP(B1-136-Bψ A160-3-B33-369) GP(B1-69-A B78-1) GPB s ins DKHKRDTYPAHTAN EVSEISVRTVYPPEE ET GP(B1-69-A B78-1) GPB S ins DKHKRDTYPAHTAN EVSEISVRTVYPPEE ET Thr80Met GP(B1-71-A7-77- B78-1) GPB s ins DKHKRDTYPAHTAN EVSEISVRTVYPPEE ET GP(B1-53-A B79-13) in GPB s Novel sequence derived from composite exon; GYPB 5' pseudoexon 3 + GYPA 3' exon 3 Novel sequence derived from composite exon; GYPB 5' pseudoexon 3 + GYPA 3' exon 3 Novel sequence derived from composite exon; GYPB 5' pseudoexon 3 + GYPA 3' exon 3 Novel sequence derived from composite exon; GYPB 5' pseudoexon 3 + GYPA 3' exon 3 Page 8 of 10
9 Phenotype Allele name Nucleotide Amino acid Comments Hil+, MUT+, MINY+ DKHKRDTYAATPRA HEVSEISVRTVYPPE EET46-77ins MNS: etc He+ GYP*505 GYP.He(GL) Page 9 of 10
10 Phenotype Allele name Nucleotide Amino acid Comments GYP deletion hybrids MNS: 1, En(a ) M N MNS: 3, 4, 5 S s U MNS: 1,, 3, 4, 5 M k M k M N S s GYPA*01N Del GYPA exons -7 : GYPB exon 1 GYPB*01N Del GYPB exons -5 ; GYPE exon 1 GYP*01N Del GYPA exons -7 ; GYPB exons 1-5 GPA absent GPB absent GPA and GPB absent Page 10 of 10
Names for H (ISBT 018) Blood Group Alleles
Names for H (ISBT 018) Blood Group Alleles v4.0_141126 1(5) Names for H (ISBT 018) Blood Group Alleles General description: The H blood group system consists of one antigen, H, that is carried on glycolipids
Immunohematology. Journal of Blood Group Serology and Education. Volume 25, Number 3, 2009
Immunohematology Journal of Blood Group Serology and Education 25 C eleb r a t i n g Yea r s Volume 25, Number 3, 2009 89 90 95 102 107 112 119 125 Immunohematology Journal of Blood Group Serology and
Milk protein genetic variation in Butana cattle
Milk protein genetic variation in Butana cattle Ammar Said Ahmed Züchtungsbiologie und molekulare Genetik, Humboldt Universität zu Berlin, Invalidenstraβe 42, 10115 Berlin, Deutschland 1 Outline Background
Transcription and Translation of DNA
Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes
Gene Models & Bed format: What they represent.
GeneModels&Bedformat:Whattheyrepresent. Gene models are hypotheses about the structure of transcripts produced by a gene. Like all models, they may be correct, partly correct, or entirely wrong. Typically,
Genomes and SNPs in Malaria and Sickle Cell Anemia
Genomes and SNPs in Malaria and Sickle Cell Anemia Introduction to Genome Browsing with Ensembl Ensembl The vast amount of information in biological databases today demands a way of organising and accessing
SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE
AP Biology Date SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE LEARNING OBJECTIVES Students will gain an appreciation of the physical effects of sickle cell anemia, its prevalence in the population,
Bioinformatics Resources at a Glance
Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences
Chapter 5: Organization and Expression of Immunoglobulin Genes
Chapter 5: Organization and Expression of Immunoglobulin Genes I. Genetic Model Compatible with Ig Structure A. Two models for Ab structure diversity 1. Germ-line theory: maintained that the genome contributed
Biological Sequence Data Formats
Biological Sequence Data Formats Here we present three standard formats in which biological sequence data (DNA, RNA and protein) can be stored and presented. Raw Sequence: Data without description. FASTA
1 Mutation and Genetic Change
CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds
Recombinant DNA Technology
Recombinant DNA Technology Stephen B. Gruber, MD, PhD Division of Molecular Medicine and Genetics November 4, 2002 Learning Objectives Know the basics of gene structure, function and regulation. Be familiar
Protein Synthesis How Genes Become Constituent Molecules
Protein Synthesis Protein Synthesis How Genes Become Constituent Molecules Mendel and The Idea of Gene What is a Chromosome? A chromosome is a molecule of DNA 50% 50% 1. True 2. False True False Protein
AP BIOLOGY 2010 SCORING GUIDELINES (Form B)
AP BIOLOGY 2010 SCORING GUIDELINES (Form B) Question 2 Certain human genetic conditions, such as sickle cell anemia, result from single base-pair mutations in DNA. (a) Explain how a single base-pair mutation
Lecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides
Lecture Series 7 From DNA to Protein: Genotype to Phenotype Reading Assignments Read Chapter 7 From DNA to Protein A. Genes and the Synthesis of Polypeptides Genes are made up of DNA and are expressed
Protein Synthesis. Page 41 Page 44 Page 47 Page 42 Page 45 Page 48 Page 43 Page 46 Page 49. Page 41. DNA RNA Protein. Vocabulary
Protein Synthesis Vocabulary Transcription Translation Translocation Chromosomal mutation Deoxyribonucleic acid Frame shift mutation Gene expression Mutation Point mutation Page 41 Page 41 Page 44 Page
BioBoot Camp Genetics
BioBoot Camp Genetics BIO.B.1.2.1 Describe how the process of DNA replication results in the transmission and/or conservation of genetic information DNA Replication is the process of DNA being copied before
amplification tech A Practical Guide to High Resolution Melt Analysis Genotyping
amplification tech note 6004 A Practical Guide to High Resolution Melt Analysis Genotyping Sean Taylor, Rachel Scott, Richard Kurtz, Carl Fisher, Viresh Patel, and Frank Bizouarn, Bio-Rad Laboratories,
Structure and Function of DNA
Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four
MUTATION, DNA REPAIR AND CANCER
MUTATION, DNA REPAIR AND CANCER 1 Mutation A heritable change in the genetic material Essential to the continuity of life Source of variation for natural selection New mutations are more likely to be harmful
2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three
Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,
SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications
Product Bulletin Sequencing Software SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications Comprehensive reference sequence handling Helps interpret the role of each
Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs)
Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs) Single nucleotide polymorphisms or SNPs (pronounced "snips") are DNA sequence variations that occur
RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison
RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the
Sickle cell anemia: Altered beta chain Single AA change (#6 Glu to Val) Consequence: Protein polymerizes Change in RBC shape ---> phenotypes
Protein Structure Polypeptide: Protein: Therefore: Example: Single chain of amino acids 1 or more polypeptide chains All polypeptides are proteins Some proteins contain >1 polypeptide Hemoglobin (O 2 binding
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS
Blood Stains at the Crime Scene Forensic Investigation
Blood Stains at the Crime Scene Forensic Investigation Introduction Blood stains at a crime scene can be crucial in solving the crime. Numerous analytical techniques can be used to study blood stains.
The Steps. 1. Transcription. 2. Transferal. 3. Translation
Protein Synthesis Protein synthesis is simply the "making of proteins." Although the term itself is easy to understand, the multiple steps that a cell in a plant or animal must go through are not. In order
DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!
DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other
2006 7.012 Problem Set 3 KEY
2006 7.012 Problem Set 3 KEY Due before 5 PM on FRIDAY, October 13, 2006. Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. Which reaction is catalyzed by each
Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )
Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins
Introduction to Genome Annotation
Introduction to Genome Annotation AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT
GENETICS OF HUMAN BLOOD TYPE
GENETICS OF HUMAN BLOOD TYPE Introduction The genetics of blood types is relatively simple when considering any one blood protein. However, the complexity increases when one considers all the different
Can receive blood from: * I A I A and I A i o Type A Yes No A or AB A or O I B I B and I B i o Type B No Yes B or AB B or O
Genetics of the ABO Blood Groups written by J. D. Hendrix Learning Objectives Upon completing the exercise, each student should be able: to explain the concept of blood group antigens; to list the genotypes
RNA & Protein Synthesis
RNA & Protein Synthesis Genes send messages to cellular machinery RNA Plays a major role in process Process has three phases (Genetic) Transcription (Genetic) Translation Protein Synthesis RNA Synthesis
Characteristics and Serologic Determination of Antibodies to High Frequency Antigens
Characteristics and Serologic Determination of Antibodies to High Frequency Antigens Nicole Thornton The International Blood Group Reference Laboratory Bristol, United Kingdom. 23 rd Regional Congress
CCR Biology - Chapter 8 Practice Test - Summer 2012
Name: Class: Date: CCR Biology - Chapter 8 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. What did Hershey and Chase know
Molecular Genetics. RNA, Transcription, & Protein Synthesis
Molecular Genetics RNA, Transcription, & Protein Synthesis Section 1 RNA AND TRANSCRIPTION Objectives Describe the primary functions of RNA Identify how RNA differs from DNA Describe the structure and
Human Genome Organization: An Update. Genome Organization: An Update
Human Genome Organization: An Update Genome Organization: An Update Highlights of Human Genome Project Timetable Proposed in 1990 as 3 billion dollar joint venture between DOE and NIH with 15 year completion
Bio 102 Practice Problems Genetic Code and Mutation
Bio 102 Practice Problems Genetic Code and Mutation Multiple choice: Unless otherwise directed, circle the one best answer: 1. Beadle and Tatum mutagenized Neurospora to find strains that required arginine
European Medicines Agency
European Medicines Agency July 1996 CPMP/ICH/139/95 ICH Topic Q 5 B Quality of Biotechnological Products: Analysis of the Expression Construct in Cell Lines Used for Production of r-dna Derived Protein
PrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID papillary renal cell carcinoma (translocation-associated) PRCC Human This gene
Hidden Markov Models in Bioinformatics. By Máthé Zoltán Kőrösi Zoltán 2006
Hidden Markov Models in Bioinformatics By Máthé Zoltán Kőrösi Zoltán 2006 Outline Markov Chain HMM (Hidden Markov Model) Hidden Markov Models in Bioinformatics Gene Finding Gene Finding Model Viterbi algorithm
Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein
Assignment 3 Michele Owens Vocabulary Gene: A sequence of DNA that instructs a cell to produce a particular protein Promoter a control sequence near the start of a gene Coding sequence the sequence of
Multiple Choice Write the letter that best answers the question or completes the statement on the line provided.
Name lass Date hapter 12 DN and RN hapter Test Multiple hoice Write the letter that best answers the question or completes the statement on the line provided. Pearson Education, Inc. ll rights reserved.
Human Leukocyte Antigens - HLA
Human Leukocyte Antigens - HLA Human Leukocyte Antigens (HLA) are cell surface proteins involved in immune function. HLA molecules present antigenic peptides to generate immune defense reactions. HLA-class
Introduction. What is Ecological Genetics?
1 Introduction What is Ecological enetics? Ecological genetics is at the interface of ecology, evolution, and genetics, and thus includes important elements from each of these fields. We can use two closely
BCOR101 Midterm II Wednesday, October 26, 2005
BCOR101 Midterm II Wednesday, October 26, 2005 Name Key Please show all of your work. 1. A donor strain is trp+, pro+, met+ and a recipient strain is trp-, pro-, met-. The donor strain is infected with
Genetics Test Biology I
Genetics Test Biology I Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Avery s experiments showed that bacteria are transformed by a. RNA. c. proteins.
Gene and Chromosome Mutation Worksheet (reference pgs. 239-240 in Modern Biology textbook)
Name Date Per Look at the diagrams, then answer the questions. Gene Mutations affect a single gene by changing its base sequence, resulting in an incorrect, or nonfunctional, protein being made. (a) A
RNA and Protein Synthesis
Name lass Date RN and Protein Synthesis Information and Heredity Q: How does information fl ow from DN to RN to direct the synthesis of proteins? 13.1 What is RN? WHT I KNOW SMPLE NSWER: RN is a nucleic
Biology Final Exam Study Guide: Semester 2
Biology Final Exam Study Guide: Semester 2 Questions 1. Scientific method: What does each of these entail? Investigation and Experimentation Problem Hypothesis Methods Results/Data Discussion/Conclusion
Gene mutation and molecular medicine Chapter 15
Gene mutation and molecular medicine Chapter 15 Lecture Objectives What Are Mutations? How Are DNA Molecules and Mutations Analyzed? How Do Defective Proteins Lead to Diseases? What DNA Changes Lead to
Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in
DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results
Lecture 3: Mutations
Lecture 3: Mutations Recall that the flow of information within a cell involves the transcription of DNA to mrna and the translation of mrna to protein. Recall also, that the flow of information between
GenBank, Entrez, & FASTA
GenBank, Entrez, & FASTA Nucleotide Sequence Databases First generation GenBank is a representative example started as sort of a museum to preserve knowledge of a sequence from first discovery great repositories,
DNA and the Cell. Version 2.3. English version. ELLS European Learning Laboratory for the Life Sciences
DNA and the Cell Anastasios Koutsos Alexandra Manaia Julia Willingale-Theune Version 2.3 English version ELLS European Learning Laboratory for the Life Sciences Anastasios Koutsos, Alexandra Manaia and
To be able to describe polypeptide synthesis including transcription and splicing
Thursday 8th March COPY LO: To be able to describe polypeptide synthesis including transcription and splicing Starter Explain the difference between transcription and translation BATS Describe and explain
Focusing on results not data comprehensive data analysis for targeted next generation sequencing
Focusing on results not data comprehensive data analysis for targeted next generation sequencing Daniel Swan, Jolyon Holdstock, Angela Matchan, Richard Stark, John Shovelton, Duarte Mohla and Simon Hughes
Genetics Lecture Notes 7.03 2005. Lectures 1 2
Genetics Lecture Notes 7.03 2005 Lectures 1 2 Lecture 1 We will begin this course with the question: What is a gene? This question will take us four lectures to answer because there are actually several
mrna EDITING Watson et al., BIOLOGIA MOLECOLARE DEL GENE, Zanichelli editore S.p.A. Copyright 2005
mrna EDITING mrna EDITING http://dbb.urmc.rochester.edu/labs/smith/research_2.htm The number of A to I sites in the human transcriptome >15;000 the vast majority of these sites occurring in Alu repeats
Genetics 301 Sample Final Examination Spring 2003
Genetics 301 Sample Final Examination Spring 2003 50 Multiple Choice Questions-(Choose the best answer) 1. A cross between two true breeding lines one with dark blue flowers and one with bright white flowers
a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled
Biology 101 Chapter 14 Name: Fill-in-the-Blanks Which base follows the next in a strand of DNA is referred to. as the base (1) Sequence. The region of DNA that calls for the assembly of specific amino
Genetics Module B, Anchor 3
Genetics Module B, Anchor 3 Key Concepts: - An individual s characteristics are determines by factors that are passed from one parental generation to the next. - During gamete formation, the alleles for
Antigenic variation in Plasmodium falciparum : Erythrocyte invasion and immune escape mechanisms
Antigenic variation in Plasmodium falciparum : Erythrocyte invasion and immune escape mechanisms Introduction Why does immunity to malaria take so long to develop? The parasite s survival depends on its
Becker Muscular Dystrophy
Muscular Dystrophy A Case Study of Positional Cloning Described by Benjamin Duchenne (1868) X-linked recessive disease causing severe muscular degeneration. 100 % penetrance X d Y affected male Frequency
Information leaflet. Centrum voor Medische Genetica. Version 1/20150504 Design by Ben Caljon, UZ Brussel. Universitair Ziekenhuis Brussel
Information on genome-wide genetic testing Array Comparative Genomic Hybridization (array CGH) Single Nucleotide Polymorphism array (SNP array) Massive Parallel Sequencing (MPS) Version 120150504 Design
Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION. Professor Bharat Patel Office: Science 2, 2.36 Email: [email protected].
Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION Professor Bharat Patel Office: Science 2, 2.36 Email: [email protected] What is Gene Expression & Gene Regulation? 1. Gene Expression
How many of you have checked out the web site on protein-dna interactions?
How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss
Next Generation Sequencing: Technology, Mapping, and Analysis
Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University [email protected] http://tandem.bu.edu/ The Human Genome Project took
Hidden Markov models in gene finding. Bioinformatics research group David R. Cheriton School of Computer Science University of Waterloo
Hidden Markov models in gene finding Broňa Brejová Bioinformatics research group David R. Cheriton School of Computer Science University of Waterloo 1 Topics for today What is gene finding (biological
Module 3 Questions. 7. Chemotaxis is an example of signal transduction. Explain, with the use of diagrams.
Module 3 Questions Section 1. Essay and Short Answers. Use diagrams wherever possible 1. With the use of a diagram, provide an overview of the general regulation strategies available to a bacterial cell.
Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
CCR Biology - Chapter 9 Practice Test - Summer 2012
Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible
1. BLOOD GROUP SYSTEMS. Page 1. Haematology LECTURE 10. BLOOD GROUPS AND TRANSFUSIONS OVERVIEW. 1. Blood Group Systems
Undergraduate Course in Veterinary Clinical PathologySocrates Programme Haematology LECTURE 10. BLOOD GROUPS AND TRANSFUSIONS 10-1 OVERVIEW 1. Blood Group Systems 2. Blood group testing and cross-matching
Algorithms in Computational Biology (236522) spring 2007 Lecture #1
Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office
AP BIOLOGY 2009 SCORING GUIDELINES
AP BIOLOGY 2009 SCORING GUIDELINES Question 4 The flow of genetic information from DNA to protein in eukaryotic cells is called the central dogma of biology. (a) Explain the role of each of the following
From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains
Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes
Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.
13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both
Data File Formats. File format v1.3 Software v1.8.0
Data File Formats File format v1.3 Software v1.8.0 Copyright 2010 Complete Genomics Incorporated. All rights reserved. cpal and DNB are trademarks of Complete Genomics, Inc. in the US and certain other
Special report. Chronic Lymphocytic Leukemia (CLL) Genomic Biology 3020 April 20, 2006
Special report Chronic Lymphocytic Leukemia (CLL) Genomic Biology 3020 April 20, 2006 Gene And Protein The gene that causes the mutation is CCND1 and the protein NP_444284 The mutation deals with the cell
CHAPTER 9 IMMUNOGLOBULIN BIOSYNTHESIS
CHAPTER 9 IMMUNOGLOBULIN BIOSYNTHESIS Although the process by which a functional gene for immunoglobulin HEAVY and LIGHT CHAINS is formed is highly unusual, the SYNTHESIS, POST- TRANSLATIONAL PROCESSING
Umm AL Qura University MUTATIONS. Dr Neda M Bogari
Umm AL Qura University MUTATIONS Dr Neda M Bogari CONTACTS www.bogari.net http://web.me.com/bogari/bogari.net/ From DNA to Mutations MUTATION Definition: Permanent change in nucleotide sequence. It can
Control of Gene Expression
Control of Gene Expression What is Gene Expression? Gene expression is the process by which informa9on from a gene is used in the synthesis of a func9onal gene product. What is Gene Expression? Figure
Chapter 18 Regulation of Gene Expression
Chapter 18 Regulation of Gene Expression 18.1. Gene Regulation Is Necessary By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection
Translation Study Guide
Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to
Overview of Eukaryotic Gene Prediction
Overview of Eukaryotic Gene Prediction CBB 231 / COMPSCI 261 W.H. Majoros What is DNA? Nucleus Chromosome Telomere Centromere Cell Telomere base pairs histones DNA (double helix) DNA is a Double Helix
MCAS Biology. Review Packet
MCAS Biology Review Packet 1 Name Class Date 1. Define organic. THE CHEMISTRY OF LIFE 2. All living things are made up of 6 essential elements: SPONCH. Name the six elements of life. S N P C O H 3. Elements
The Human Genome Project
The Human Genome Project Brief History of the Human Genome Project Physical Chromosome Maps Genetic (or Linkage) Maps DNA Markers Sequencing and Annotating Genomic DNA What Have We learned from the HGP?
Question 4 /29 points. Total /100 points
MIT Department of Biology 7.28, Spring 2005 - Molecular Biology 7.28 Spring 2005 Exam Three Question 1 Question 2 Question 3 /30 points /20 points /21 points Question 4 /29 points Total /100 points 1 Question
Luísa Romão. Instituto Nacional de Saúde Dr. Ricardo Jorge Av. Padre Cruz, 1649-016 Lisboa, Portugal. Cooper et al (2009) Cell 136: 777
Luísa Romão Instituto Nacional de Saúde Dr. Ricardo Jorge Av. Padre Cruz, 1649-016 Lisboa, Portugal Cooper et al (2009) Cell 136: 777 PTC = nonsense or stop codon = UAA, UAG, UGA PTCs can arise in a variety
Figure 14.2 Overview of Innate and Adaptive Immunity
I M M U N I T Y Innate (inborn) Immunity does not distinguish one pathogen from another Figure 14.2 Overview of Innate and Adaptive Immunity Our first line of defense includes physical and chemical barriers
How To Understand How Gene Expression Is Regulated
What makes cells different from each other? How do cells respond to information from environment? Regulation of: - Transcription - prokaryotes - eukaryotes - mrna splicing - mrna localisation and translation
7.012 Quiz 3 practice
MIT Biology Department 7.012: Introductory Biology - Fall 2004 Instructors: Professor Eric Lander, Professor Robert A. Weinberg, Dr. Claudette Gardel 7.012 Quiz 3 practice Quiz 3 on Friday, November 12th
The sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized:
Module 3F Protein Synthesis So far in this unit, we have examined: How genes are transmitted from one generation to the next Where genes are located What genes are made of How genes are replicated How
somatic cell egg genotype gamete polar body phenotype homologous chromosome trait dominant autosome genetics recessive
CHAPTER 6 MEIOSIS AND MENDEL Vocabulary Practice somatic cell egg genotype gamete polar body phenotype homologous chromosome trait dominant autosome genetics recessive CHAPTER 6 Meiosis and Mendel sex
