genes have been proposed and studied in recent years [6 12] and, among them, genes encoding ethanol and acetaldehyde-metabolizing 1.

Transcription

1 Journal of Hepatology 41 (2004) Genetic polymorphisms of ADH 2, ADH 3, CYP 450 2E1 Dra-I and Pst-I, and ALDH 2 in Spanish men: lack of association with alcoholism and alcoholic Francesc Vidal 1,4, *, Alfons Lorenzo 1, Teresa Auguet 1,4, Montserrat Olona 2, Montserrat Broch 3,4, Cristina Gutiérrez 3,4, Carmen Aguilar 3, Pere Estupiñà 3, Mauro Santos 5, Cristóbal Richart 1,4 1 Department of Internal Medicine, Hospital Universitari de Tarragona Joan XXIII, C/Dr. Mallafré Guasch, 4, Tarragona, Spain 2 Department of Epidemiology and Preventive Medicine, Hospital Universitari de Tarragona Joan XXIII, Tarragona, Spain 3 Research Unit, Hospital Universitari de Tarragona Joan XXIII, Tarragona, Spain 4 Department of Medicine and Surgery, University Rovira i Virgili, Tarragona, Spain 5 Department of Genetics and Microbiology, Universitat Autònoma de Barcelona, Bellaterra, Spain Background/Aims: The relationship between polymorphisms at the alcohol dehydrogenase 2 (ADH 2 ), ADH 3, CYP 450 2E1 and aldehyde dehydrogenase 2 (ALDH 2 ) loci and the individual predisposition to alcoholism and alcoholic in Caucasians is controversial. Methods: We determined the genotypes of ADH 2, ADH 3, CYP 450 2E1 (Pst-I and Dra-I) and ALDH 2 in 519 male Spaniards: 264 alcoholic subjects (47 without, 118 with non-cirrhotic and 99 with cirrhosis) and 255 non-alcoholic subjects (64 healthy controls, 110 with non-cirrhotic non-alcoholic and 81 with cirrhosis unrelated to alcohol). Genotyping was performed using PCR-RFLP methods on white cell DNA. Results: The distribution of the allelic variants (allele *1 and allele *2) in the whole subjects analyzed was: ADH % and 6.9%; ADH and 44.3%; CYP 450 2E1 Dra-I 11.2 and 88.8%; CYP 450 2E1 Pst-I 96.2 and 3.8% and ALDH2 100 and 0%, respectively. No differences were observed in the allelic distributions of the alcoholic and nonalcoholic subjects for the loci examined. Allele distribution in alcoholics with no, with alcoholic steatosis or hepatitis, and with cirrhosis was also similar. Conclusions: ADH 2, ADH 3, and CYP 450 2E1 Pst-I and Dra-I genetic variations are not related to alcoholism or susceptibility to alcoholic in our male population. ALDH 2 locus is monomorphic. q 2004 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved. Keywords: Alcohol; Alcohol dehydrogenase; Aldehyde dehydrogenase; Cytochrome P 450 2E1; Alcoholic ; Cirrhosis 1. Introduction Alcoholism and alcohol-induced liver damage are clinically heterogenous diseases which result from a likely multiplicity of interactive genetic and environmental influences, rather than a major single gene effect [1 5]. In order to study this genetic approach, several genes must be analyzed in a susceptible population. Several candidate Received 1 October 2002; received in revised form 1 May 2003; accepted 1 June 2003; available online 11 September 2004 * Corresponding author. Tel.: C ; fax: C address: fvidal@comt.es (F. Vidal). genes have been proposed and studied in recent years [6 12] and, among them, genes encoding ethanol and acetaldehyde-metabolizing enzymes such as alcohol dehydrogenase (ADH), cytochrome P 450 2E1 (CYP 450 2E1), and aldehyde dehydrogenase (ALDH) have been extensively studied, often with controversial or non-conclusive results, especially in whites [6,7,10,13,15]. ALDH 2 is the most important alcohol-metabolizing gene that affects predisposition to alcoholism and alcoholic liver disease in Asians populations. The ALDH 2 *2 allele, which encodes for an inactive ALDH form, appears to protect against alcoholism [4,7,10]. Furthermore, alcoholics with this inactive allele may be at a greater risk of advanced /$30.00 q 2004 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved. doi: /j.jhep

2 F. Vidal et al. / Journal of Hepatology 41 (2004) alcoholic [15 21]. However, the ALDH 2 *2 allele has not been found in Caucasians [10 22]. ADH presents genetic variability at the ADH 2 and ADH 3 loci. Two alleles in both loci (*1 and *2) have been described [23]. It has been reported that the prevalence of the more active alleles ADH 2 *2 [13,14,16 21,24,25] and ADH 3 *1 [13 15,19] is low in alcoholic Asians. Likewise, alcoholics with the highly active ADH 2 *2 or ADH 3 *1 may be at increased risk of organ damage [26], as has been shown in Asians [15,18,25,27]. A similar relationship has been reported for Jewish and Australian men [28,29]. Studies regarding ADH 3 *1 in whites are more controversial, showing no correlation [30 36], protection against alcoholism [37], or non-conclusive results [22,29,38]. CYP 450 2E1 is responsible for 10% of total ethanol metabolism, but it can be induced by chronic alcohol administration [39]. The CYP 450 2E1 gene also exhibits polymorphism. Two point mutations in the 5 0 flanking region of the gene (Pst-I, Rsa-I) are in close linkage disequilibrium and alter the transcriptional activity of the gene [40]. So far, studies have failed to demonstrate that this polymorphism is related to an increased risk of alcohol dependence [41]. An association with alcoholic has been documented in the Japanese [18], but only one report has been able to find a similar association in Caucasians [42]. Less information is available regarding other mutations that affect this gene (Dra-I, Msp-I) [41,43]. In the present work, we have studied the frequency of ADH 2,ADH 3, ALDH 2, and CYP 450 2E1 Dra-I and Pst-I polymorphisms and their relation to alcoholism and alcoholic (ALD) in 519 subjects living in Tarragona (Catalonia, Spain), a region with a long tradition of producing and consuming alcoholic beverages, specially wine. 2. Material and methods 2.1. Subjects We studied 519 Spanish white men between 20 and 84 years of age at the Hospital Universitari de Tarragona Joan XXIII (Spain). Immigrants from other countries and their descendents were excluded. Subjects were classified into two groups according to their alcohol intake: alcoholics and non-alcoholics. Each group was divided further into the following subgroups: controls, non-cirrhotic, and cirrhosis of the liver. People who drank a total amount of alcohol in the beverages ingested greater than 100 g/day for more than 10 years were considered alcoholics. The drinking history was obtained by a face-to-face interview based on a standardized questionnaire. In doubtful cases, relatives were also interviewed. Ninety-six percent of alcoholics met the DSM-IV diagnostic criteria for alcoholism [44]. Alcoholic subjects included patients with alcohol-induced cirrhosis, non-cirrhotic alcoholic (hepatitis and/or steatosis) and heavy drinkers without. The different types of ALD were diagnosed by examination of a liver biopsy. Alcoholics with no were diagnosed by means of percutaneous needle biopsy of the liver, usually done because of the presence of an enlarged liver and/or abnormalities in the liver enzyme levels, or during elective abdominal surgery. Histologic examination of these samples indicated a normal liver. Non-alcoholic subjects were people who drank less than 10 g/day of alcohol. They included healthy controls and patients with non-alcoholic chronic (in most cases chronic hepatitis or cirrhosis due to HCV infection, diagnosed by liver biopsy examination). Healthy controls were people with no history of alcoholism or chronic disease, no evidence of at physical examination, and normal liver function tests. Information about toxic and medical history was collected through a short standardized questionnaire. The study protocol was approved by the Ethical Committee of our hospital. Informed consent was obtained from each subject Blood samples A 10 ml sample of blood was drawn in an EDTA vacutainer by venipuncture. Within 1 h of drawing, buffy coat was separated from the blood by centrifugation at 800 g for 10 min. Genomic DNA was isolated from the buffy coat using QiaAMP spin columns (Qiagen, Chatsworth, CA) Analytical methods: genotype determination Restriction fragment length polymorphisms (RFLP) in the ADH 2, ADH 3, CYP 450 2E1, and ALDH 2 genes were detected by digesting PCRamplified DNA [19,40,41]. For each PCR analysis, 100 ng of DNA was used. PCR analyses were performed with a Perkin Elmer 9700 Thermal Cycler. RFLP were detected by ethidium bromide staining after agarose gel electrophoresis ADH 2 and ADH 3 genotypes The amplification reactions were carried out in a final volume of 15 ml containing 1.5 mm of MgCl 2, 0.2 mm of each nucleotide (Boehringer Mannheim, Germany), 0.2 mm of each primer and 2 units of Thermus aquaticus (Taq) DNA polymerase (Gibco BRL). DNA was amplified for 35 cycles. Each cycle consisted of 1 min denaturation at 94 8C, 45 s annealing at 55 8C and 5 min extension at 72 8C. The primers used were: 5 0 ATTCTTTTCTGAATCTGAACA3 0 and 5 0 GAAGGGGGGTCACCAG- GTTG3 0 for ADH 2 genotypes, and 5 0 GCTTTAAGAGTAAATAATCTG- TCCCC3 0 and 5 0 AATCTACCTCTTTCCAGAGC3 0 for ADH 3 genotypes (Gibco BRL). For allele detection, aliquots of the amplified DNA products were digested with MaeIII at 55 8C for ADH 2, or with SspI at 37 8C (Roche Molecular Biochemicals) for ADH 3. Digestion products were run on 2.5% high resolution agarose gels and stained with ethidium bromide. The genotypes identified were named according to the presence or absence of the enzyme restriction sites. So MaeIII G/GZ*1/*1, G/AZ*1/*2 and A/AZ2*/*2 are homozygotes for the absence of site (95 bp), heterozygotes (60/35/95 bp), and homozygotes for the presence of site (60/35 bp). SpsI G/GZ*1/*1, G/AZ*1/*2 and A/AZ*2/*2 are homozygotes for the absence of site (130 pb), heterozygotes (67/63/130 bp), and homozygotes for the presence of site (67/63 bp) CYP 450 2E1 genotypes The amplification reactions were conducted in a final volume of 50 ml containing 1.5 mm of MgCl 2, 0.2 mm of each nucleotide (Boehringer Mannheim, Germany), 0.2 mm of each primer and 2 units of Taq DNA polymerase (Gibco BRL). DNA was amplified for 35 cycles. Each cycle consisted of 30 s denaturation at 95 8C, 30 s annealing at 54 8C for the Pst-I polymorphism and at 63 8C for the Dra-I polymorphism, and 45 s extension at 72 8C. The primers used were 5 0 TTCATTCTGTCT- TCTAACTGG3 0 and 5 0 CCAGTCGAGTCTACATTGTCA3 0 for Pst-I, and 5 0 AGTCGACATGTGATGGATCCA3 0 and 5 0 GACAGGGTTT- CATCATGTTGG3 0 for Dra-I (Gibco BRL). For allele detection, aliquots of the amplified DNA products were digested with PstI and DraI, both at 37 8C for each polymorphism (Roche Molecular Biochemicals). Digestion products were run on 4% agarose gels and stained with ethidium bromide. The genotypes identified were named according to the presence or absence of the enzyme restriction sites. So, Pst-I *1/*1, *1/*2 and 2*/*2 were homozygotes for the absence of site (410 bp), heterozygotes (290/120/410 bp), and homozygotes for the presence of site (290/120 bp). Dra-I *1/*1, *1/*2 and *2/*2 were homozygotes for the absence of site (375 bp), heterozygotes (249/126/375 bp), and homozygotes for the presence of site (249/126 bp).

3 746 F. Vidal et al. / Journal of Hepatology 41 (2004) Table 1 Main characteristics of the groups defined Alcoholics (nz264) No n (%) Non-cirrhotic liver disease n (%) Cirrhosis n (%) Non-alcoholics (nz255) No n (%) Non-cirrhotic n (%) Cirrhosis n (%) Population 47 (17.8) 118 (44.7) 99 (37.5) 64 (25.1) 110 (43.1) 81 (31.8) Alcohol consumption (meangsd) g/day 130G32 132G47 167G59 9G4.1 N * N * years 11G G7.6 16G8.5 Mean age 56.8G G G G G G12.9 * N, negligible ALDH 2 genotypes An amplification created restriction site was performed by introducing a single base mismatch into the 3 0 -end of an antisense primer, which is immediately adjacent to the mutation site (G/C-A/T) in exon 12 and can create an MboII recognition site in the wild type nucleotide sequences after amplification. In accordance with the principle mentioned above the primers used in the PCR were 5 0 CAAATTACAGGGTCAAGGGCT3 0 and 5 0 CCACACTCACAGTTTTCTCTT3 0. Amplification was performed in a final volume of 50 ml containing 0.2 mm of each nucleotide (Boehringer Mannheim), 1 mm MgCl 2,1mM of each oligonucleotide and 1 U of Taq polymerase (Gibco BRL). The reaction was carried out using 30 thermal cycles in the following conditions: an initial denaturation of 5 min at 94 8C and a final extension of 10 min at 72 8C. The cycle program consisted of a 1 min denaturation at 94 8C, 3 min annealing at 53 8C and a 1 min extension at 72 8C. PCR products were digested with MboII restriction enzyme at 37 8C overnight and electrophoresed on a 4% agarose gel. A 135 bp band corresponded to the mutant allele (AZ*2) and a set of 125 and 10 bp bands corresponded to the wild-type allele (GZ*1) Statistical analysis The descriptive analysis of the different variables analyzed has been performed by means of absolute and relative frequencies for categoric variables, and mean and standard deviation (SD) for continuous variables. The variation in the allele frequencies of different groups was analyzed by means of the population genetics software GENEPOP [45]. Differences between groups were analyzed through the Pearson c 2 test or Fisher s exact test for categoric variables. For continuous variables, one-factor analysis of variance (ANOVA) was used. c 2 goodness of fit tests were used to study agreement with Hardy-Weinberg expectations. Linkage disequilibrium between ADH 2 and ADH 3 was estimated by means of the composite digenic disequilibrium coefficient D AB [46,47]. 3. Results 3.1. General The main characteristics of the subjects studied are shown in Table 1. All alcoholic subjects (nz264) were white Spaniards. Ninety-nine (37.5%) alcoholic subjects had cirrhosis, 118 (44.7%) had non-cirrhotic, and 47 (17.8%) showed no evidence of ALD. All non-alcoholic subjects (nz255) were also white Spaniards. Sixty-four (25.1%) were healthy controls; the non-alcoholic non-cirrhotic was made up of 110 subjects (43.3%); and 81 (31.8%) had viral cirrhosis. The allelic frequencies for each gene analyzed in this series is shown in Table 2. The genotype distribution of all groups fits the expected Hardy-Weinberg equilibrium (Tables 3 6) ADH 2 gene polymorphisms The allelic distribution of the ADH 2 *1 and ADH 2 *2 genotypes in the whole population analyzed was 93.1 and 6.9%, respectively (Table 2). We compared the allelic frequencies observed in the different groups defined (alcoholics vs. non-alcoholics, controls vs. patients), and, in no cases were the differences found to be significant (Table 3) ADH 3 gene polymorphisms The allele distribution in the whole series was 55.7% for ADH 3 *1 and 44.3% for ADH 3 *2. Table 4 shows the ADH 3 allele distribution according to alcoholism and/or liver disease. Differences were not significant when the control group was compared with the different groups of patients with alcoholism and/or. Likewise, when individuals were put in groups of alcoholics and non-alcoholics, as had previously been done for ADH 2, no differences were found regarding the ADH 3 allele frequencies (Table 4) Linkage disequilibrium between ADH 2 and ADH 3 loci An association in the direction ADH 2 *2 ADH 3 *1 was observed, but no significant linkage disequilibrium could be demonstrated. The digenic disequilibrium coefficients were D AB ZK0.0143, PZ0.21, for the non-alcoholic group and D AB ZK0.0064, PZ0.45, for the alcoholics. Table 2 Genotype number and allele frequencies (%) of ADH 2, ADH 3, CYP 450 2E1 Dra-I and Pst-I, and ALDH 2 in the series analyzed Gene n Genotype Allele *1/*1 *1/*2 *2/*2 *1 *2 ADH ADH CYP4502E Dra-I CYP4502E Pst-I ALDH

4 F. Vidal et al. / Journal of Hepatology 41 (2004) Table 3 Genotype number and allele frequencies (%) of ADH 2 according to drinking habits and presence and type of Group N Genotype Allele *1/*1 *1/*2 *2/*2 *1 *2 Alcoholics No Non-cirrhotic Cirrhosis Non-alcoholics No Non-cirrhotic Cirrhosis Table 5 Genotype number and allele frequencies (%) of CYP 450 2E1 Dra-I according to drinking habits and presence and type of Group n Genotype Allele *1/*1 *1/*2 *2/*2 d1 d2 Alcoholics No Non-cirrhotic Cirrhosis Non-alcoholics No Non-cirrhotic Cirrhosis CYP 450 2E1 gene polymorphisms in the Dra-I locus The overall allele frequencies for the rare d1 and common d2 alleles in the Dra-I locus were 11.2 and 88.8%, respectively. The rare d1 allele was slightly more common among subjects with alcohol-related cirrhosis than among heavy drinkers without alcohol-related, but the differences were not The mutation was less frequent in the non-alcoholic cirrhosis group (8%), but it was not statistically significative (Table 5). The distribution of the CYP 450 2E1 genotypes for the Dra-I rare d1 allele was also similar in alcoholics and non-alcoholics (Table 5) CYP 450 2E1 gene polymorphisms in the Pst-I locus The global allelic frequencies for the common c1 and rare c2 alleles in the Pst-I locus were 96.2 and 3.8%, respectively (Table 2). The results of allelic and genotypic distributions observed in the groups defined are shown in Table 6. The rare c2 allele was slightly more common among heavy drinkers without ALD than among subjects with alcohol-related cirrhosis and healthy controls, but the differences were not The frequency of the rare c2 allele was comparable for alcoholics and non-alcoholics, as is reflected in Table Analysis of ADH-CYP 450 2E1 polymorphism associations No evidence of gene gene interaction was observed in relation to alcohol consumption or the development of ALD, when the polymorphic ADH and CYP 450 2E1 systems were analyzed together ALDH 2 gene polymorphisms We evaluated these polymorphisms in 100 individuals, 50 alcoholics and 50 non-alcoholics, either with and without liver disease. All subjects expressed the 1/1 genotype (Table 2). Table 4 Genotype number and allele frequencies (%) of ADH 3 according to drinking habits and presence and type of Group n Genotype Allele *1/*1 *1/*2 *2/*2 *1 *2 Alcoholics No Non-cirrhotic Cirrhosis Non-alcoholics No Non-cirrhotic Cirrhosis Table 6 Genotype number and allele frequencies (%) of CYP 450 2E1 Pst-I according to drinking habits and presence and type of Group n Genotype Allele *1/*1 *1/*2 *2/*2 c1 c2 Alcoholics No Non cirrhotic Cirrhosis Non-alcoholics No Non cirrhotic Cirrhosis

5 748 F. Vidal et al. / Journal of Hepatology 41 (2004) Discussion The results of the present work indicate, for a large and homogeneous Spanish male sample, that ADH 2, ADH 3 and CYP 450 2E1 Dra-I and Pst-I genotypes are not related to the individual risk of alcoholism or the development of advanced alcoholic. We have not detected polymorphism at the ALDH 2 locus. The highly active ADH 2 *2 allele is very frequent in Asians (60 80%) but not in whites (0 10%) [10]. Our results showed an ADH 2 *2 allele frequency of 7.8% for our healthy Spanish controls, higher than the one reported in French [33], Americans [48], Germans, Swedes and Finns [10,49], but lower than in Turks [10] and Swiss [50]. Itis similar to frequencies described in other Spanish samples [51,52]. It is difficult to find an explanation for the higher ADH 2 *2 frequency in our population, but perhaps reflects migration patterns and the occupation of Spain historically by eastern populations. It has been reported in Asians that the risk of alcohol dependence and alcoholic associated with ADH 2 *1 is greater than the risk associated with ADH 2 *2 [13,14,16,17,19 21,24,25]. Our results suggest that there is no relationship between the atypical ADH 2 and alcohol abuse in Spaniards, because the frequencies of ADH 2 *2 obtained in alcoholics and non-alcoholics are very similar (7.4% vs. 6.5%, respectively). These results are in agreement with most previous studies in whites [48,52]. Only two reports in Jewish from Israel [28] and in Australian whites [29] have found a relationship similar to that found in Asians. The two ADH 2 alleles encode for dimeric isoenzymes with different metabolic ratios of ethanol to acetaldehyde. The ADH 2 *2 encodes a very active enzyme and may be expected to generate more acetaldehyde because of the higher activity. So, it could be expected that alcoholics with the more active b 2 b 2 isoenzyme were at greater risk of ethanol intake causing tissular damage due to an increased accumulation of acetaldehyde. However, our results do not confirm this hypothesis for the development of alcoholic cirrhosis, because the allelic frequencies observed are similar for alcoholics, either with or without. These results agree with other results in Caucasians and Asians [30,31]. Only one research group has reported that alcoholics expressing the allele *2 are at greater risk [18, 25,27]. Moreover, the high frequency of the ALDH 2 *2 allele in Asians overshadows the effects of ADH variability. This strong influence could be provided in Europeans, since the ALDH 2 *2 is virtually absent in Caucasians, as demonstrated in the present work. Regarding ADH 3, important differences are also observed in allelic distribution between Asian and white populations: ADH 3 *1 is more prevalent in Asians (O90%) than in whites (50 60%) [12,48]. Our genotype distribution is consistent with previous reports in whites [21,23, 34,37,46]. Several reports in Asians have suggested that alcoholics with the more active ADH 3 *1 may be at greater risk for developing alcoholic [15,18]. This correlation has not been proved in whites [22,29 38]. The allelic frequencies are very similar for all the groups studied, and among alcoholics and non-alcoholics. So, in our population, ADH 3 variation does not play a causative role in the predisposition to alcoholism or ALD. The fact that class I ADH genes all lie within 80 kb on chromosome 4 led to the hypothesis that variants were not inherited independently. ADH 2 and ADH 3 genes are contiguous in the region 4q21-23 [53], and evidence of allele linkage has been found in Asians [13,21,54]. Recently, this linkage has also been reported in Europeans [37]. Our results show that the ADH 2 *2 and ADH 3 *1 alleles are associated, but they do not demonstrate a significant disequilibrium linkage in our population. However, the low ADH 2 *2 frequency in Caucasians means that the effect of the allele linkage on the ADH 3 distribution must be smaller than in Asians. In oriental populations, the excess of ADH 3 *1 observed in non-alcoholics could be influenced by the association with ADH 2 *2 [13,15 17]. Polymorphism of CYP 450 2E1 has been shown to influence the risk for ALD in some reports [43,55], but others have failed to find such an association [56]. Additionally, to date, no evidence of influence on alcoholism and alcohol dependence has been reported [41]. In the population analyzed, the allelic distribution for the CYP 450 2E1 Dra-I polymorphism among alcoholic and non-alcoholic subjects did not show differences. The frequencies of the rare Dra-I d1 allele were comparable in non-alcoholic population and alcoholics, and similar to those reported for Caucasians by other authors [31,41,43]. Nevertheless, we were unable to confirm the lower frequency of the d1 allele in alcoholics with liver cirrhosis commented on in some reports [43]. Regarding the CYP 450 2E1 Pst-I polymorphism, we found no association between the c2 mutation in the flanking region of the gene and a higher risk of alcoholism, since the mutant allele was detected in a comparable percent of alcoholic and non-alcoholic population. A relationship with alcoholic cirrhosis has been suggested in Asians, but results are controversial [16,57]. Although rare in Caucasians, this allele has been found to increase the risk of advanced alcoholic liver disease, particularly in patients with the less active isoenzymes of ADH 3 [42]. Our results do not confirm this but demonstrated that the c2 allele is less frequent in alcoholics with liver cirrhosis than in alcoholics without cirrhosis or advanced. The combination study between the CYP 450 2E1/ADH 3 genotypes and risk of alcohol-related was also negative. CYP 450 2E1 variants were not seen to be associated with alcoholism or risk of alcoholic, perhaps because of their low prevalence, which may explain why different reports have come up with different results.

6 F. Vidal et al. / Journal of Hepatology 41 (2004) We can conclude that polymorphisms of ADH 2, ADH 3, and CYP 450 2E1 are not related to the risk for developing alcoholism and/or alcoholic, at least in a large Caucasian population such as the one presented here, and that the allele ALDH 2 *2 is not expressed in the population analyzed. Acknowledgements This study has been partially financed by a grant from the Fondo de Investigaciones Sanitarias (FIS 97/0245 and 00/0988) and a grant from the Fundación Biociencia. References [1] Couzigou P, Begleiter H, Kiianmaa K. Alcohol and genetics. In: MacDonald I, editor. Health Issues Related to Alcohol Consumption. Brussels: ILSI Europe; p [2] Schuckit MA. Biological, psychological and environmental predictors of the alcoholism risk: a longitudinal study. J Stud Alcohol 1998;59: [3] Rodés J, Salaspuro M, Sorensen TIA. Alcohol and. In: MacDonald I, editor. Health Issues Related to Alcohol Consumption. Brussels: ILSI Europe; p [4] Day CP, Bassendine MF. Genetic predisposition to alcoholic liver disease. Gut 1992;33: [5] Savolainen VT, Perola M, Lalu K, Penttilä A, Virtanen I, Karhunen PJ. Early centrolobular fibrogenesis-precirrhotic lesions among moderate alcohol consumers and chronic alcoholics. J Hepatol 1995;23: [6] Lumeng L, Crabb DW. Genetic aspects and risk factors in alcoholism and alcoholic. Gastroenterology 1994;107: [7] Yoshida A, Hsu L-C, Yasunami M. Genetics of human alcoholmetabolizing enzymes. Prog Nucl Acid Res Mol Biol 1991;40: [8] Noble EP, Blum K, Ritchie T, Montgomery A, Sheridan PJ. Allelic association of the D2 dopamine receptor gene with receptor-binding characteristics in alcoholism. Arch Gen Psychiatry 1991;48: [9] Hallikainen T, Saito T, Lachman H, Volakva J, Pohjalainen T, Ryynänen OP, et al. Association between low activity serotonin transporter promoter genotype and early onset of alcoholism with habitual impulsive violent behaviour. Mol Psychiatry 1999;4: [10] Goedde HW, Agarwal DP, Fritze G, Meier-Tackmann D, Singh S, Beckmann G, et al. Distribution of ADH2 and ALDH2 genotypes in different populations. Hum Genet 1992;88: [11] Shibuya A, Yoshida A. Genotypes of alcohol metabolizing enzymes in Japanese with alcohol s: a strong association of the usual Caucasian-type aldehyde dehydrogenase gene (ALDH2 1 ) with the disease. Am J Hum Genet 1988;43: [12] Agarwal DP, Goedde HW, editors. Alcohol metabolism, alcohol intolerance, and alcoholism. Biochemical and pharmacological approaches. Berlin: Springer; [13] Thomasson HR, Edenberg HJ, Crabb DW, Mai XL, Jerome RE, Li TK, et al. Alcohol and aldehyde dehydrogenase genotypes and alcoholism in Chinese men. Am J Hum Genet 1991;48: [14] Thomasson HR, Crabb DW, Edenberg HJ, Li TK. Alcohol and aldehyde dehydrogenase polymorphisms and alcoholism. Behav Gen 1993;23: [15] Chao YC, Liou SR, Chung YY, Tang HS, Hsu CT, Li TK, et al. Polymorphism of alcohol and aldehyde dehydrogenase genes and alcoholic cirrhosis in Chinese patients. Hepatology 1994;19: [16] Maezawa Y, Yamauchi M, Toda G, Suzuki H, Sakurai S. Alcoholmetabolizing enzyme polymorphisms and alcoholism in Japan. Alcohol Clin Exp Res 1995;19: [17] Muramatsu T, Zu-Cheng W, Yi-Ru F, Kou-Bao H, Heqin Y, Yamada K, et al. Alcohol and aldehyde dehydrogenase genotypes and drinking behavior of Chinese living in Shangai. Hum Genet 1995; 96: [18] Yamauchi M, Maezawa Y, Mizuhara Ohata M, Hirakawa J, Nakajima H, Toda G. Polymorphisms in alcohol metabolizing enzyme genes and alcoholic cirrhosis in Japanese patients: a multivariate analysis. Hepatology 1995;22: [19] Nakamura K, Iwahashi K, Matsuo Y, Miyatake R, Ichikawa Y, Suwaki H. Characteristics of Japanese alcoholics with the atypical aldehyde dehyodrogenase 2*2. I. A comparison of the genotypes of ALDH2, ADH2, ADH3, and cytochrome P-4502E1 between alcoholics and non-alcoholics. Alcohol Clin Exp Res 1996;20: [20] Tanaka F, Shiratori Y, Yokosuka O, Imazeki F, Tsukada Y, Omata M. High incidence of ADH2*1/ALDH2*1 genes among Japanese alcohol dependents and patients with alcoholic. Hepatology 1996;23: [21] Chen CC, Lu RB, Chen YC, Wang MF, Chang YC, Li TK, et al. Interaction between the functional polymorphisms of the alcohol metabolism genes in protection against alcoholism. Am J Hum Genet 1999;65: [22] Day CP, Bashir R, James OFW, Bassendine MJ, Crabb DW, Thomasson HR, et al. Investigation of the role of polymorphisms at the alcohol and aldehyde dehydrogenase loci in genetic predisposition to alcohol-related end-organ damage. Hepatology 1991;14: [23] Bosron WF, Li T-K. Catalytic properties of human liver alcohol dehydrogenase isoenzymes. Enzyme 1987;37: [24] Thomasson HR, Crabb DW, Edenberg HJ, Li TK, Hwu HJ, Chen CC, et al. Low frequency of the ADH2*2 allele among Atayal natives of Taiwan with alcohol use disorders. Alcohol Clin Exp Res 1994;18: [25] Yamauchi M, Maezawa Y, Toda G, Suzuki H, Sakurai S. Association of a restriction fragment length polymorphism in the alcohol dehydrogenase 2 gene with Japanese alcoholic liver cirrhosis. J Hepatol 1995;23: [26] Couzigou P, Coutelle C, Fleury B, Iron A. Alcohol and aldehyde dehydrogenase genotypes, alcoholism and alcohol related disease. Alcohol Alcohol 1994;2: [27] Yamauchi M. Association of polymorphism in the alcohol dehydrogenase 2 gene with alcohol-related organ injuries, especially liver cirrhosis. Addict Biol 1998;3: [28] Neumark YD, Friedlander Y, Thomasson HR, Li TK. Association of the ADH2*2 allele with reduced ethanol consumption in Jewish men in Israel: a pilot study. J Stud Alcohol 1998;59: [29] Whitfield JB, Nightingale BN, Bucholz KK, Madden PAF, Heath AC, Martin NG. ADH genotypes and alcohol use and dependence in Europeans. Alcohol Clin Exp Res 1998;22: [30] Couzigou P, Fleury B, Groppi A, Cassaigne A, Begueret J. Genotyping study of alcohol dehydrogenase class I polymorphism in French patients with alcoholic cirrhosis. Alcohol Alcohol 1990;25: [31] Ceni E, Galli A, Casini A. Genetics, alcohol and cirrhosis. Ann Intern Med 1997;126:1000 letter. [32] Ricciardi BR, Saunders JB, Williams R, Hopkinson DA. Hepatic ADH and ALDH isoenzymes in different racial groups and in chronic alcoholism. Pharmacol Biochem Behav 1983;18: [33] Poupon RE, Nalpas B, Coutelle C, Fleury B, Couzogou P, Higueret D. Polymorphism of alcohol dehydrogenase, alcohol and aldehyde dehydrogenase activities: implication in alcoholic cirrhosis in white patients. Hepatology 1992;15:

7 750 F. Vidal et al. / Journal of Hepatology 41 (2004) [34] Gilder FJ, Hodgkinson S, Murray RM. ADH and ALDH genotype profiles in Caucasians with alcohol-related problems and controls. Addiction 1993;88: [35] Parés X, Farrés J, Parés A, Soler X, Panés J, Ferré LJ, et al. Genetic polymorphism of liver alcohol dehydrogenase in Spanish subjects: significance of alcohol consumption and. Alcohol Alcohol 1994;29: [36] Espinós C, Sánchez F, Ramírez C, Juan F, Nájera C. Polymorphism of alcohol dehydrogenase genes in alcoholic and non-alcoholic individuals from Valencia (Spain). Hereditas 1997;126: [37] Borràs E, Coutelle C, Rosell A, Fernández-Muixí F, Broch M, Crosas B, et al. Genetic polymorphism of alcohol dehydrogenase in Europeans: the ADH2*2 allele decreases the risk of alcoholism and is associated with ADH3*1. Hepatology 2000;31: [38] Poupon RE, Ward P, Balkau B. Alcohol dehydrogenase polymorphisms and predisposition to alcoholic cirrhosis. Hepatology 1993;18: [39] Takahashi T, Lasker JM, Rosman AS, Lieber CS. Induction of cytochrome P-4502E1 in the human liver by ethanol is caused by a corresponding increase in encoding messenger RNA. Hepatology 1993;17: [40] Hayashi S, Watanabe J, Kawajiri K. Genetic polymorphisms in the flanking region change transcriptional regulation of the human cytochrome P450IIE1 gene. J Biochem 1991;110: [41] Pastorelli R, Bardazzi G, Saieva C, Cerri A, Gestri D, Allamani A, et al. Genetic determinants of alcohol addiction and metabolism: a survey in Italy. Alcohol Clin Exp Res 2001;25: [42] Grove J, Brown ASJM, Daly AK, Bassendine MF, James OF, Day CP. The RsaI polymorphism of CYP2E1 and susceptibility to alcoholic in Caucasians: effect on age of presentation and dependence on alcohol dehydrogenase genotype. Pharmacogenetics 1998;8: [43] Ingelman-Sundberg M, Johansson I, Yin H, Terelius Y, Eliasson E, Clot P, et al. Ethanol-inducible cytochrome P4502E2: genetic polymorphism, regulation and possible role in the etiology of alcohol-induced. Alcohol 1993;10: [44] Grant BF, Hardford TC, Hasin DS, Chou P, Pickering R. DSM-III-R and the proposed DSM-IV alcohol use disorders, United States 1988: A nosological comparison. Alcohol Clin Exp Res 1992;16: [45] Raymond M, Rousset F. GENEPOP (version 1.2): population genetics software for exact tests and ecumenicism. J Heredity 1995;86: [46] Weir BS, Cockerham CC. Complete characterization of disequilibrium at two loci. In: Feldman ME, editor. Mathematical Evolutionary Theory. Princeton: Princeton Univ. Press; p [47] Weir BS. Genetic data analysis. Sunderland, MA: Sinauer; [48] Bosron WF, Li T-K. Genetic polymorphism of human liver alcohol and aldehyde dehydrogenase, and their relationship to alcohol metabolism and alcoholism. Hepatology 1986;6: [49] Nuutinen HU. Activities of ethanol-metabolizing enzymes in liver diseases. Scand J Gastroenterol 1986;21: [50] von Wartburg JP, Papenberg J, Aebi H. An atypical human alcohol dehydrogenase. Can J Biochem 1965;43: [51] Panés J, Soler X, Parés A, Caballería J, Farrés J, Rodés J, et al. Influence of on hepatic alcohol and aldehyde dehydrogenases. Gastroenterology 1989;97: [52] Vidal F, Pérez J, Panisello J, Toda R, Gutiérrez C, Richart C. Atypical liver alcohol dehydrogenase in the Spanish population: its relation with the development of alcoholic. Alcohol Clin Exp Res 1993;17: [53] Yasunami M, Kikuchi I, Sarapata D, Yoshida A. The human class I alcohol dehydrogenase gene cluster: three genes are tandemly organized in an 80-kb-long segment of the genome. Genomics 1990; 7: [54] Osier M, Patstis AJ, Kidd JR, Lee JF, Yin SJ, Ko HC, et al. Linkage disequilibrium at the ADH2 and ADH3 loci and risk of alcoholism. Am J Hum Genet 1999;64: [55] Pirmohamed M, Kitteringham NR, Quets LJ, Allot LR, Green VJ, Gilmore IT, et al. Genetic polymorphism of cytochrome P4502E1 and risk of alcoholic in Caucasians. Pharmacogenetics 1995; 5: [56] Savolainen VT, Pajarinen J, Perola M, Penttilä A, Karhunen PJ. Polymorphism in the cytochrome P450 2E1 gene and the risk of alcoholic. J Hepatol 1997;26: [57] Tsutsumi M, Takada A, Wang JS. Genetic polymorphisms of cytochrome P4502E1 related to the development of alcoholic liver disease. Gastroenterology 1994;107: