An Investigation of Alcohol Metabolizing Enzyme Genes in Chinese Alcoholics With Pancreatitis,, Cirrhosis of Liver, and Avascular Necrosis of Hip

Transcription

1 An Investigation of Alcohol Metabolizing Enzyme Genes in Chinese Alcoholics With Pancreatitis,, Cirrhosis of Liver, and Avascular Necrosis of Hip Joints

2 Introduction Maezawa et al., have reported that Japanese alcoholic patients with more severe brain atrophy had a lower incidence of liver cirrhosis. The ADH2*1 allele frequencies were different for the alcohol induced brain atrophy and cirrhosis subpopulations. Alcohol Clin Exp Res 1996;20,29A-32A Chao et al., ALDH2*1 is the most important alcohol metabolizing gene affecting predisposition to alcoholism whereas the ADH2*2 gene may influence susceptibility to acute alcoholic pancreatitis. Hepatology 1997;25:112-7 Chao et al., The chinese alcoholic patients with the ADH2*1 and ALDH 2*2 allele are more susceptible to esophageal Ca. Am J Gastroenterol 2000;95:

3 Introduction Avascular necrosis of the hip joint (AVN) is a specific complication of chronic alcoholism. Clinically, we have noted that this complication was more common for alcoholic patients with liver disease than for those with acute pancreatitis. In this study, we wanted to establish the allele frequencies for the alcohol metabolizing enzyme genes of the alcoholic AVN subgroup and other subgroups.

4 Material and Method A total 302 alcoholic and 280 nonalcoholic patients at TSGH from Oct 2000 to Sep 2002 Alcoholics had consumed in excess of 60 g of ethanol per day, on average, for at least 6 years 302 alcoholic patients 51 with AVN, 159 with cirrhosis, 92 with acute pancreatitis 280 nonalcoholic patients

5 Age Gender and Alcohol Consumption in the Different Groups Groups(No. of patients) Age Alcohol Consumption Sex Daily Duration (M/F) (g) (yr) Alcoholic AVN(51) a 51/ d f Alcoholic pancreatitis(92) b 87/ Alcoholic cirrhosis(159) c 150/ d Alcoholic esophageal Ca(59) / Nonalcoholic AVN(38) /9 Gall stone pancreatitis(74) /38 Viral cirrhosis(68) /26 Nonalcoholic controls(100) /29 a P<0.003 vs. alcoholic cirrhosis group. P<0.022 vs. alcoholic pancreatitis group. P< vs. alcoholic esophageal Ca group. b P< vs. alcoholic cirrhosis group. P< vs. alcoholic esophageal Ca group. c P< vs. alcoholic esophageal Ca group. d P>0.05 vs. other groups. e P<0.001 vs. alcoholic cirrhosis group. f P<0.002 vs. alcoholic cirrhosis group. P< vs. alcoholic esophageal Ca group. P>0.05 vs. alcoholic pancreatitis group.

6 Detection of the alleles ALDH2*1 and ALDH2*2 Primers YC 3: 5 CCCTTTGGTGGCTAGAAGATG Primers YC 4: 5 CCACACTCACAGTTTTCTCTT Arrows indicate MboII cutting sites GAAGA(N)8, MboII recognition sequence Lane 1, undigested PCR products Lane 2, homozygous ALDH2*1/*1 Lane 3, heterozygous ALDH2*1/*2 Lane 4, homozygous ALDH2*2/*2

7 Prevalence of ADH2 Genotypes ADH2 Genotypes Allele e Frequency Groups(No. of patients) *1/*1 *1/*2 *2/*2 *1 *2 Alcoholic AVN(51) Alcoholic pancreatitis(92) d 0.65 Alcoholic cirrhosis(159) b 0.56 Alcoholic esophageal Ca(59) c 0.49 Nonalcoholic AVN(38) d 0.71 Gall stone pancreatitis(74) d 0.72 Viral cirrhosis(68) d 0.73 Nonalcoholic controls(100) d 0.74 a P<0.01 vs. alcoholic cirrhosis group. P<0.001 vs. alcoholic esophageal Ca group. b P<0.05 vs. alcoholic pancreatitis group. P<0.025 vs. viral cirrhosis group, nonalcoholic AVN group and gall stone pancreatitis group. P<0.001 vs. nonalcoholic control group. c P<0.001 vs. nonalcoholic control group and gall stone pancreatitis group. P<0.005 vs. viral cirrhosis group. P<0.025 vs.alcoholic pancreatitis group, nonalcoholic AVN group and nonalcoholic esophageal Ca group. d P>0.05 vs. other groups.

8 Prevalence of ALDH2 Genotypes ALDH2 Allele Genotypes Frequency Groups(No. of patients) *1/*1 *1/*2 *2/*2 *1 *2 Alcoholic AVN(51) a 0.10 Alcoholic pancreatitis(92) c 0.09 Alcoholic cirrhosis(159) c 0.09 Alcoholic esophageal Ca(59) Nonalcoholic AVN(38) d 0.25 Gallstone pancreatitis(74) d 0.24 Viral cirrhosis(68) d 0.22 Nonalcoholic controls(100) d 0.27 a P<0.001 vs. Alcoholic esophageal Ca group. P<0.005 vs. Nonalcoholic controls and viral cirrhosis group. P<0.025 vs. Nonalcoholic AVN and gallstone pancreatitis group. b P<0.001 vs. Alcoholic pancreatitis group and alcoholic cirrhosis s group. c P<0.001 vs. viral cirrhosis group, gall stone pancreatitis group, nonalcoholic AVN group and nonalcoholic control group. P<0.005 vs. nonalcoholic esophageal Ca group. d P>0.05 vs. other groups

9 Prevalence of ADH2, ALDH2 Genotypes ADH2 AlleleA Groups Genotypes Frequency (No. of patients) *1/*1 *1/*2 *2/*2 *1 *2 Alcoholic AVN (35) Alcoholic pancreatitis b 0.65 (92) Alcoholic cirrhosis b 0.56 (159) Alcoholic AVN b 0.59 plus cirrhosis (11) ALDH2 Allele Genotypes Frequency *1/*1 *1/*2 *2/*2 *1 * c d 0.09 Alcoholic esophageal b 0.49 Ca (59) a P<0.001 vs. Alcoholic esophageal Ca group. P<0.005 vs. Alcoholic cirrhosis group. b P>0.05 vs. other groups c P<0.001 vs. Alcoholic esophageal Ca group. d P<0.05 vs. Alcoholic esophageal Ca group.

10 Conclusion % of alcoholic AVN patients also suffered from alcoholic liver disease, but only 6.5% of these also experiencing episodes of acute alcoholic pancreatitis 2. The ADH2 allele frequencies for the alcoholic AVN and acute pancreatitis subgroups were more similar than for the alcoholic AVN and cirrhosis subgroups 3. In addition to alcohol metabolizing enzyme genes we studied, other genetic variations may also influence the type of organ complications in alcoholic patients