B D B D 3 PCR-RFLP T/T B B. Occult HBV Infection (OBI) B. HBsAg. kazemi24@yahoo.com

Size: px
Start display at page:

Download "B D B D 3 PCR-RFLP T/T B B. Occult HBV Infection (OBI) B. HBsAg. e-mail: kazemi24@yahoo.com"

Transcription

1 3 anti-hc HsAg HV- anti-hc HsAg TT anti-hc HV- anti-hc t/t HsAg HV- -RFLP Occult HV Infection (OI) HV- HsAg HsAg

2 HsAg (RAIM, Italy) anti-hc anti-hiv anti-hcv clearance ehring, Italy 3 HV- mm MgCl2 mm tris-hcl KCl dntp Taq polymerase. 5 -TCGTGGTGGACTTCTCTC-3 5 -ACAGTGGGGGAAAGCCCAT-3 3 S HsAg HV ladder S cc (FFP) ETA MgCl2 mm tris-hcl KCl M dntp Taq. polymerase F 5 ' - CAGAGCATGGACAGGGAGCAA -3 ' R: 5 ' -CACTTCGAGCACAAGGGGCGTTAG-3 ' / RFLP HV- anti-hc anti- HsAg HsAg HsAg HV- Hc HV- anti-hc ETA (ehring, Germany) HsAg

3 Exon 9 of Vitamin Receptor J abol Univ Med Sci; 11(4); Oct-Nov 2009 ; M. Kazemi Arababadi, et al (FERMENTAS, Vilnius, Lithuania) UV transilluminator ladder t-test t/t HsAg HIV HTLV-1 HCV HsAg anti-hc HsAg TT HsAg anti-hc HV- anti-hc HV HsAg anti-hc HV anti-hc HsAg Taq1 HV t/t HV- anti-hc HsAg ladder HV- ladder /t ± ± CC

4 HV HV- Real Time Li Fok-1 Shan asymptomatic TT

5 Exon 9 of Vitamin Receptor J abol Univ Med Sci; 11(4); Oct-Nov 2009 ; M. Kazemi Arababadi, et al Exon 9 of Vitamin Receptor Association with Occult Hepatitis Virus Infection M. Kazemi Arababadi (Ph) 1, A.A. Pourfathollah (Ph) 2, A. Jafarzadeh (Ph) 1, Gh.H. Hassanshahi (Ph) 1, M.E. Rezvani (Ph) 3 1. Assistant Professor of Immunology, Molecular-Medicine Research Center, Rafsanjan University of Medical Sciences, Rafsanjan, Iran 2. Professor of Immunology, Tarbiat Modarres University, Tehran, Iran 3. Assistant Professor of Physiology, Rafsanjan University of Medical Sciences, Rafsanjan, Iran Received: Jan 17 th 2009, Revised: Feb 18 th 2009, Accepted: May 13 th ASTRACT ACKGROUN AN OJECTIVE: Immune system is unable to complete clearance of hepatitis virus in occult hepatitis infection (OI). Some of immune response is defect against hepatitis virus in these patients. Scientists believed the involvement of genetic and immunological factors in etiology of OI. ue to the regulatory impact of vitamin 3 on immune system, study of vitamin receptor () polymorphisms aid to better understanding of disease. Therefore, in this study we examined exon 9 polymorphisms of in OI patients. METHOS: In this experimental study, 3700 samples were examined for anti-hc and HsAg by ELISA. The HsAg negative and anti-hc positive samples were screened for HV- by. OI patients (57 cases) (HsAg negative and anti-hc positive, HV- positive) and 100 healthy controls (HsAg negative and anti- Hc positive, HV- negative) were analyzed for exon 9 polymorphisms of by -RFLP techniques. FININGS: Our findings demonstrated that 57 cases had OI among 3700 studied cases. Polymorphisms analysis showed that 3.5% (2 cases) of OI patients and 18% (18 cases) of controls had alleles in this region which the difference was statistically significant in patients and controls (0.049). There was not also a significant difference between OI patients and controls regarding and t/t alleles of this region of. CONCLUSION: Regarding results of this study we can be concluded that the allele in exon 9 of may play key role in ability of immune system in clearance of HV in OI patients. KEY WORS: Hepatitis, Vitamin receptor, Polymorphism. Corresponding Author; Address: Microbiology & Immunology epartment, Medical Faculty, Rafsanjan University of Medical Sciences, Rafsanjan, Iran kazemi24@yahoo.com

6 References 1. Arababadi MK, Hassanshahi G, Yousefi H, Zarandi ER, Moradi M, Mahmoodi M. No detected hepatitis virus- in thalassemic patients infected by hepatitis C virus in Kerman province of Iran. Pak J iol Sci 2008; 11(13): ehzad-ehbahani A, Mafi-Nejad A, Tabei SZ, Lankarani K, Torab A, Moaddeb A. Anti-Hc & HV- detection in blood donors negative for hepatitis virus surface antigen in reducing risk of transfusion associated HV infection. Indian J Med Res 2006; 123(1): Kocazeybek, Arabaci U, Sezgic M. Investigation of transfusion transmitted viruses in cases clinically suspected of posttransfusion hepatitis with undetermined etiology. Transfus Apher Sci 2002; 26(3): Jafarzadeh A, Arababadi MK, Mirzaee M, Pourazar A. Occult hepatitis virus infection among blood donors with antibodies to hepatitis core antigen. Acta Medica Iranica 2008; 46(1): Pourazar A, Salehi M, Jafarzadeh A, Arababadi MK, Oreizi F, Shariatinezhad K. etection of HV in HsAg negative normal blood donors. Iran J Immunol 2005; 2(3): ikle. Nonclassic Actions of Vitamin. J Clin Endocrinol Metab 2009; 94(1): Yu S, Cantorna MT. The vitamin receptor is required for inkt cell development. Proc Natl Acad Sci U S A 2008; 105(13): Adorini L, Penna G. Control of autoimmune diseases by the vitamin endocrine system. Nat Clin Pract Rheumatol 2008; 4(8): Shan J, Wang L, Li Z, et al. Relationship between polymorphisms of vitamin receptor gene and familial aggregation of HsAg carriers. Zhongguo Yi Xue Ke Xue Yuan Xue ao 2006; 28(2): Larcombe LA, Orr PH, Lodge AM, et al. Functional gene polymorphisms in canadian aboriginal populations with high rates of tuberculosis. J Infect is 2008; 198(8): Hu KQ. Occult hepatitis virus infection and its clinical implications. J Viral Hepat 2002; 9(4): Suneetha PV, Sarin SK, Goyal A, Kumar GT, Shukla K, Hissar S. Association between vitamin receptor, CCR5, TNF-alpha and TNF-beta gene polymorphisms and HV infection and severity of liver disease. J Hepatol 2006; 44(5): Arababadi MK, Naghavi N, Hassanshahi G, Mahmoodi M. Is CCR5 32 mutation associated with diabetic nephropathies in type 2 diabetes? Ann Saudi Med 2009; 29(5): Li JH, Chen M, Li Z, et al. Study on association between vitamin receptor gene polymorphisms and the outcomes of HV infection. Zhonghua Yi Xue Yi Chuan Xue Za Zhi 2006; 23(4): Li JH, Li HQ, Li Z, et al. Association of Taq I T/C and Fok I C/T polymorphisms of vitamin receptor gene with outcome of hepatitis virus infection. Zhonghua Yi Xue Za Zhi 2006; 86(28):

7 This document was created with Win2PF available at The unregistered version of Win2PF is for evaluation or non-commercial use only.

Occult Hepatitis B Virus (HBV) Infection: a Global Challenge for Medicine

Occult Hepatitis B Virus (HBV) Infection: a Global Challenge for Medicine Clin. Lab. 2012;58:1225-1230 Copyright ORIGINAL ARTICLE Occult Hepatitis B Virus (HBV) Infection: a Global Challenge for Medicine SHOKROLLAH ASSAR 1, MOHAMMAD KAZEMI ARABABADI 1, BEHZAD NASIRI AHMADABADI

More information

Detection of HBV DNA in HBsAg Negative Normal Blood Donors

Detection of HBV DNA in HBsAg Negative Normal Blood Donors Detection of HBV DNA in HBsAg Negative Normal Blood Donors Abbasali Pourazar 1*, Mansoor Salehi 1, Aabdollah Jafarzadeh 2, Mohammad Kazemi Arababadi 2, Farzad Oreizi 1, Keivan Shariatinezhad 1 1 Immunology

More information

IDENTIFICATION OF HEPATITIS B VIRUS BY POLYMERASE CHAIN REACTION TECHNIQUE: PERFORMANCE STUDY AND COMPARISON WITH ENZYME LINKED IMMUNOSORBENT ASSAY

IDENTIFICATION OF HEPATITIS B VIRUS BY POLYMERASE CHAIN REACTION TECHNIQUE: PERFORMANCE STUDY AND COMPARISON WITH ENZYME LINKED IMMUNOSORBENT ASSAY IDENTIFICATION OF HEPATITIS B VIRUS BY POLYMERASE CHAIN REACTION TECHNIQUE: PERFORMANCE STUDY AND COMPARISON WITH ENZYME LINKED IMMUNOSORBENT ASSAY Gaza F. Salih * and Kameran M. Ali** ABSTRACT Background

More information

CASL Symposium Hepatitis B Co-chairs: Carla Coffin and Mang Ma

CASL Symposium Hepatitis B Co-chairs: Carla Coffin and Mang Ma CASL Symposium Hepatitis B Co-chairs: Carla Coffin and Mang Ma Occult HBV Infection: Assessment and Clinical Significance D. Lorne Tyrrell Director, Li Ka Shing Institute of Virology University of Alberta

More information

Results Demographic profile of these children is shown in Table I.

Results Demographic profile of these children is shown in Table I. Prevalence of Antibody to Hepatitis C Virus in Pakistani Thalassaemics by Particle Agglutination Test Utilizing C 200 and C 22-3 Viral Antigen Coated Particles Pages with reference to book, From 269 To

More information

Natalia Taborda Vanegas. Doc. Sci. Student Immunovirology Group Universidad de Antioquia

Natalia Taborda Vanegas. Doc. Sci. Student Immunovirology Group Universidad de Antioquia Pathogenesis of Dengue Natalia Taborda Vanegas Doc. Sci. Student Immunovirology Group Universidad de Antioquia Infection process Epidermis keratinocytes Dermis Archives of Medical Research 36 (2005) 425

More information

Vitamin D und seine Bedeutung im Immunsystem und bei der Infektabwehr

Vitamin D und seine Bedeutung im Immunsystem und bei der Infektabwehr Vitamin D und seine Bedeutung im Immunsystem und bei der Infektabwehr Stefan Pilz Department of Internal Medicine, Division of Endocrinology and Metabolism, Medical University of Graz, Austria Department

More information

HEPATITIS WEB STUDY Acute Hepatitis C Virus Infection: Epidemiology, Clinical Features, and Diagnosis

HEPATITIS WEB STUDY Acute Hepatitis C Virus Infection: Epidemiology, Clinical Features, and Diagnosis HEPATITIS WEB STUDY Acute C Virus Infection: Epidemiology, Clinical Features, and Diagnosis H. Nina Kim, MD Assistant Professor of Medicine Division of Infectious Diseases University of Washington School

More information

Hepatitis B Virus Genemer Mix

Hepatitis B Virus Genemer Mix Product Manual Hepatitis B Virus Genemer Mix Primer Pair for amplification of HBV Specific DNA Fragment Includes Internal Negative Control Primers and Template Catalog No.: 60-2007-12 Store at 20 o C For

More information

Viral Safety of Plasma-Derived Products

Viral Safety of Plasma-Derived Products Viral Safety of Plasma-Derived Products SLIDE 1 This presentation will cover viral validation studies for plasma-derived products. FDA requires that the manufacturing process for biopharmaceutical products

More information

Viral Hepatitis Case Report

Viral Hepatitis Case Report Page 1 of 9 Viral Hepatitis Case Report Perinatal Hepatitis B Virus Infection Michigan Department of Community Health Communicable Disease Division Investigation Information Investigation ID Onset Date

More information

Case Finding for Hepatitis B and Hepatitis C

Case Finding for Hepatitis B and Hepatitis C Case Finding for Hepatitis B and Hepatitis C John W. Ward, M.D. Division of Viral Hepatitis Centers for Disease Control and Prevention Atlanta, Georgia, USA Division of Viral Hepatitis National Center

More information

Molecular Diagnosis of Hepatitis B and Hepatitis D infections

Molecular Diagnosis of Hepatitis B and Hepatitis D infections Molecular Diagnosis of Hepatitis B and Hepatitis D infections Acute infection Detection of HBsAg in serum is a fundamental diagnostic marker of HBV infection HBsAg shows a strong correlation with HBV replication

More information

UPDATE ON NEW HEPATITIS C MEDICINES

UPDATE ON NEW HEPATITIS C MEDICINES UPDATE ON NEW HEPATITIS C MEDICINES Diana Sylvestre, MD 2014 AASLD/IDSA Guidelines: Gt 1 Treatment naïve Interferon eligible: sofosuvir + ribavirin + PEG-IFN x 12 weeks Interferon ineligible: sofosbuvir

More information

Co-infected health-care workers

Co-infected health-care workers Co-infected health-care workers Y.Yazdanpanah Service Universitaire des Maladies Infectieuses et du Voyageur C.H. Tourcoing, Faculté de Médecine de Lille CNRS U362, Lille, France Co-infected health-care

More information

Immunological studies, fibrosis and oxidative stress

Immunological studies, fibrosis and oxidative stress Pathogenesis of hepatitis C virus (HCV) infection: role of genetic, immunologic and environmental factors in HCV-related liver disease and in symptomfree HCV carriers. Hepatitis C virus (HCV) infection

More information

Prospects for Vaccines against Hepatitis C Viruses. T. Jake Liang. M.D. Liver Diseases Branch NIDDK, NIH, HHS

Prospects for Vaccines against Hepatitis C Viruses. T. Jake Liang. M.D. Liver Diseases Branch NIDDK, NIH, HHS Prospects for Vaccines against Hepatitis C Viruses T. Jake Liang. M.D. Liver Diseases Branch NIDDK, NIH, HHS HCV Vaccine Prevention strategies Protective immunity Barriers and solutions Vaccine candidates

More information

Identification of Tick-Borne Encephalitis Virus CD4+ and CD8+ T-Cell Epitopes in Vaccinated or Naturally Infected Humans

Identification of Tick-Borne Encephalitis Virus CD4+ and CD8+ T-Cell Epitopes in Vaccinated or Naturally Infected Humans Identification of Tick-Borne Encephalitis Virus CD4+ and CD8+ T-Cell Epitopes in Vaccinated or Naturally Infected Humans Schwaiger Julia Clinical Institute of Virology 29.06.2009 1 Thank you! Franz X.

More information

A white paper for consideration by the NIAID Microbial Sequencing Program

A white paper for consideration by the NIAID Microbial Sequencing Program Hepatitis C Virus Sequencing: Viral evolution, immune recognition and vaccine development. A white paper for consideration by the NIAID Microbial Sequencing Program Todd M. Allen, Ph.D. Assistant Professor

More information

Hepatitis C Glossary of Terms

Hepatitis C Glossary of Terms Acute Hepatitis C A short-term illness that usually occurs within the first six months after someone is exposed to the hepatitis C virus (HCV). 1 Antibodies Proteins produced as part of the body s immune

More information

CANADIAN RULE BASED CLASSIFICATION SYSTEM (IVDD) Life Sciences British Columbia NRC-Industry Research Assistance Program

CANADIAN RULE BASED CLASSIFICATION SYSTEM (IVDD) Life Sciences British Columbia NRC-Industry Research Assistance Program CANADIAN RULE BASED CLASSIFICATION SYSTEM (IVDD) Life Sciences British Columbia NRC-Industry Research Assistance Program Health Canada Regulations on Medical Devices Vancouver, B.C. October 29, 2007 Nancy

More information

Psoriasis; a new marker for Hepatitis C among Egyptian Patients

Psoriasis; a new marker for Hepatitis C among Egyptian Patients ISSN: 2319-7706 Volume 4 Number 6 (2015) pp. 761-767 http://www.ijcmas.com Original Research Article Psoriasis; a new marker for Hepatitis C among Egyptian Patients Asmaa E Mohamed 1, Samaa A Taha 2, Amal

More information

BLOOD DONOR TESTING & LOOKBACK STUDIES Shan Yuan, MD Last Updated 2/8/2011. 1. ABO Typing: Performed each time with each donation

BLOOD DONOR TESTING & LOOKBACK STUDIES Shan Yuan, MD Last Updated 2/8/2011. 1. ABO Typing: Performed each time with each donation Testing Performed: BLOOD DONOR TESTING & LOOKBACK STUDIES Shan Yuan, MD Last Updated 2/8/2011 1. ABO Typing: Performed each time with each donation 2. Rh Typing: o Performed along with ABO typing to determine

More information

National Health Burden of CLD in Italy

National Health Burden of CLD in Italy National Health Burden of CLD in Italy 11,000 deaths due to liver cirrhosis or HCC in 2006 Direct costs for the National Health System for treating CLD patients: 420 M / year for hospital care 164 M /

More information

Peg-IFN and ribavirin: what sustained virologic response can be achieved by using HCV genotyping and viral kinetics?

Peg-IFN and ribavirin: what sustained virologic response can be achieved by using HCV genotyping and viral kinetics? Peg-IFN and ribavirin: what sustained virologic response can be achieved by using HCV genotyping and viral kinetics? Prof. I. Bakulin Gastroenterology Department Key Questions Background Worldwide prevalence

More information

SMF Awareness Seminar 2014

SMF Awareness Seminar 2014 SMF Awareness Seminar 2014 Clinical Evaluation for In Vitro Diagnostic Medical Devices Dr Jiang Naxin Health Sciences Authority Medical Device Branch 1 In vitro diagnostic product means Definition of IVD

More information

Custom Antibody Services

Custom Antibody Services prosci-inc.com Custom Antibody Services High Performance Antibodies and More Broad Antibody Catalog Extensive Antibody Services CUSTOM ANTIBODY SERVICES Established in 1998, ProSci Incorporated is a leading

More information

DEPARTMENT OF IMMUNOLOGY Chair of Histology and Immunology Medical University of Gdańsk

DEPARTMENT OF IMMUNOLOGY Chair of Histology and Immunology Medical University of Gdańsk DEPARTMENT OF IMMUNOLOGY Chair of Histology and Immunology Medical University of Gdańsk Research group Head: Jolanta Myśliwska, MD, PhD Professor of immunology Joanna Więckiewicz, M. Sc. Dominik Rachoń,

More information

CAREERS IN BIOMEDICAL SCIENCE & THE IBMS. Betty Kyle Scottish Regional Representative IBMS Lead Biomedical Scientist NHS Lanarkshire

CAREERS IN BIOMEDICAL SCIENCE & THE IBMS. Betty Kyle Scottish Regional Representative IBMS Lead Biomedical Scientist NHS Lanarkshire CAREERS IN BIOMEDICAL SCIENCE & THE IBMS Betty Kyle Scottish Regional Representative IBMS Lead Biomedical Scientist NHS Lanarkshire What is a biomedical scientist? Biomedical scientists carry out investigations

More information

Lancet Device Incident Investigation Report - 2012

Lancet Device Incident Investigation Report - 2012 Lancet Device Incident Investigation Report - 2012 Summary On May 16, 2012 the Winnipeg Regional Health Authority (WRHA) received notification from the University of Manitoba (U of M) of an incident at

More information

INTERPRETATION INFORMATION SHEET

INTERPRETATION INFORMATION SHEET Creative Testing Solutions 2424 West Erie Dr. 2205 Highway 121 10100 Martin Luther King Jr. St. No. Tempe, AZ 85282 Bedford, TX 76021 St. Petersburg, FL 33716 INTERPRETATION INFORMATION SHEET Human Immunodeficiency

More information

Chapter 43: The Immune System

Chapter 43: The Immune System Name Period Our students consider this chapter to be a particularly challenging and important one. Expect to work your way slowly through the first three concepts. Take particular care with Concepts 43.2

More information

Poor access to HCV treatment is undermining Universal Access A briefing note to the UNITAID Board

Poor access to HCV treatment is undermining Universal Access A briefing note to the UNITAID Board Poor access to HCV treatment is undermining Universal Access A briefing note to the UNITAID Board The growing crisis of HIV/HCV coinfection It is estimated that 4-5 million people living with HIV (PLHIV)

More information

Background: 1) Does your center have effective ways of collecting data from multiple sources to submit to multiple organizations?

Background: 1) Does your center have effective ways of collecting data from multiple sources to submit to multiple organizations? University of Michigan Best Practices Pam James, MS CCRP Administrative Manager, Data Management Bone Marrow Transplant, Hematologic Malignancies & NCCN Background: The data management team at the University

More information

University of Alberta 2015-2016 Faculty Immunization Clearance Form: Requirements for Validating Forms for Entry into a Program

University of Alberta 2015-2016 Faculty Immunization Clearance Form: Requirements for Validating Forms for Entry into a Program University of Alberta 2015-2016 Faculty Immunization Clearance Form: Requirements for Validating Forms for Entry into a Program Key Terms & Abbreviations: dtap: tetanus, diphtheria, acellular pertussis

More information

Vitamin D and its role in immunology: Multiple sclerosis, and inflammatory bowel disease

Vitamin D and its role in immunology: Multiple sclerosis, and inflammatory bowel disease Progress in Biophysics and Molecular Biology 92 (2006) 60 64 Review Vitamin D and its role in immunology: Multiple sclerosis, and inflammatory bowel disease Margherita T. Cantorna Department of Veterinary

More information

Interleukin-10 gene promoter polymorphism and risk of liver cirrhosis

Interleukin-10 gene promoter polymorphism and risk of liver cirrhosis Interleukin-10 gene promoter polymorphism and risk of liver cirrhosis Y. Liu 1, M.C. Yu 2, A.Q. Zhang 1, Y.B. Wang 1, K. Jiang 1 and J.H. Dong 1 1 Department of Hepatobiliary Surgery, Chinese PLA General

More information

A Genetic Analysis of Rheumatoid Arthritis

A Genetic Analysis of Rheumatoid Arthritis A Genetic Analysis of Rheumatoid Arthritis Introduction to Rheumatoid Arthritis: Classification and Diagnosis Rheumatoid arthritis is a chronic inflammatory disorder that affects mainly synovial joints.

More information

Conveners: S. Bruno, C.M. Mastroianni

Conveners: S. Bruno, C.M. Mastroianni SESSIONE 2 Oral communications based on selected abstracts Conveners: S. Bruno, C.M. Mastroianni PNPLA3 variant is an independent predictor of severe steatosis in patients with chronic hepatitis C and

More information

Observational Cross Sectional Study on Blood Donors

Observational Cross Sectional Study on Blood Donors Original Article Observational Cross Sectional Study on Blood Donors Raju G.M. 1, Vijayanath.V. 2, Anitha.M.R. 3 1- Associate Professor, Department of Forensic Medicine and Toxicology, Institute of medical

More information

1 2 3 4 5 6 Figure 4.1: Gel picture showing Generation of HIV-1subtype C codon optimized env expressing recombinant plasmid pvax-1:

1 2 3 4 5 6 Figure 4.1: Gel picture showing Generation of HIV-1subtype C codon optimized env expressing recombinant plasmid pvax-1: Full-fledged work is in progress towards construction and cloning of codon optimized envelope with subsequent aims towards immunization of mice to study immune responses. 1 2 4 5 6 Figure 4.1: Gel picture

More information

FAQs HIV & AIDS. What is HIV? A virus that reduces the effectiveness of your immune system, meaning you are less protected against disease.

FAQs HIV & AIDS. What is HIV? A virus that reduces the effectiveness of your immune system, meaning you are less protected against disease. HIV & AIDS What is HIV? A virus that reduces the effectiveness of your immune system, meaning you are less protected against disease. What does HIV stand for? Human Immunodeficiency Virus Where did HIV

More information

Course Curriculum for Master Degree in Medical Laboratory Sciences/Clinical Microbiology, Immunology and Serology

Course Curriculum for Master Degree in Medical Laboratory Sciences/Clinical Microbiology, Immunology and Serology Course Curriculum for Master Degree in Medical Laboratory Sciences/Clinical Microbiology, Immunology and Serology The Master Degree in Medical Laboratory Sciences / Clinical Microbiology, Immunology or

More information

Hepatitis C Monitoring and Complications (and Treatment!) Dr Mark Douglas

Hepatitis C Monitoring and Complications (and Treatment!) Dr Mark Douglas Hepatitis C Monitoring and Complications (and Treatment!) Dr Mark Douglas Hepatitis C Virus Shimizu et al., 1996 Positive single strand RNA virus Flaviviridae family, Hepacivirus genus 9.6 kbp genome ~3000

More information

Appendix 3 Exposure Incident Report Form

Appendix 3 Exposure Incident Report Form Appendix 3 Exposure Incident Report Form January, 2015 Page 1 of 6 Please see the following pages for the Exposure Incident Report Form. Guidelines for the Management of Exposure to Blood and Body Fluids

More information

The Functional but not Nonfunctional LILRA3 Contributes to Sex Bias in Susceptibility and Severity of ACPA-Positive Rheumatoid Arthritis

The Functional but not Nonfunctional LILRA3 Contributes to Sex Bias in Susceptibility and Severity of ACPA-Positive Rheumatoid Arthritis The Functional but not Nonfunctional LILRA3 Contributes to Sex Bias in Susceptibility and Severity of ACPA-Positive Rheumatoid Arthritis Yan Du Peking University People s Hospital 100044 Beijing CHINA

More information

PROPOSED DOCUMENT. Global Harmonization Task Force. Title: Principles of In Vitro Diagnostic (IVD) Medical Devices Classification

PROPOSED DOCUMENT. Global Harmonization Task Force. Title: Principles of In Vitro Diagnostic (IVD) Medical Devices Classification SG1(PD)/N045R12 PROPOSED DOCUMENT Global Harmonization Task Force Title: Principles of In Vitro Diagnostic (IVD) Medical Devices Classification Authoring Group: Study Group 1 of the Global Harmonization

More information

Immunity Unit Test Z

Immunity Unit Test Z Immunity Unit Test Z Name MB Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Which of the pathogens in Figure 31.1 cause disease by taking over healthy

More information

Use of Nucleic Acid Tests to Reduce the Risk of Transmission of Hepatitis B Virus from Donors

Use of Nucleic Acid Tests to Reduce the Risk of Transmission of Hepatitis B Virus from Donors This document is scheduled to be published in the Federal Register on 01/08/2016 and available online at http://federalregister.gov/a/2016-00149, and on FDsys.gov 4164-01-P DEPARTMENT OF HEALTH AND HUMAN

More information

The most serious symptoms of this stage are:

The most serious symptoms of this stage are: The Natural Progression of Hepatitis C The natural history of hepatitis C looks at the likely outcomes for people infected with the virus if there is no medical intervention. However, the process of trying

More information

Cell Bank Safety Testing for Cellular Therapeutics. Christopher A Bravery

Cell Bank Safety Testing for Cellular Therapeutics. Christopher A Bravery Cell Bank Safety Testing for Cellular Therapeutics Christopher A Bravery cbravery@advbiols.com 1 Introduction Definitions used in this talk Cellular therapeutics (CTP) EU: Advanced Therapy Medicinal Products

More information

UCLA Asian Liver Program

UCLA Asian Liver Program CLA Program Update Program Faculty Myron J. Tong, PhD, MD Professor of Medicine Hepatology Director, Asian Liver Program Surgery Ronald W. Busuttil, MD, PhD Executive Chair Department of Surgery Director,

More information

Autoimmunity and immunemediated. FOCiS. Lecture outline

Autoimmunity and immunemediated. FOCiS. Lecture outline 1 Autoimmunity and immunemediated inflammatory diseases Abul K. Abbas, MD UCSF FOCiS 2 Lecture outline Pathogenesis of autoimmunity: why selftolerance fails Genetics of autoimmune diseases Therapeutic

More information

Global Under Diagnosis of Viral Hepatitis

Global Under Diagnosis of Viral Hepatitis Global Under Diagnosis of Viral Hepatitis Mel Krajden MD, FRCPC Medical Head, Hepatitis Clinical Prevention Services Associate Medical Director, Public Health Microbiology & Reference Laboratory BC Centre

More information

Cost Utility Analysis Subgroup. Brian Custer ISBT WP-TTID Cancun, Mexico July 8, 2012

Cost Utility Analysis Subgroup. Brian Custer ISBT WP-TTID Cancun, Mexico July 8, 2012 Cost Utility Analysis Subgroup Brian Custer ISBT WP-TTID Cancun, Mexico July 8, 2012 Global risk assessment and cost utility of blood safety interventions development of a webbased application and multi-country

More information

Veterinary Testing. Classes of Test

Veterinary Testing. Classes of Test Veterinary Testing Classes of Test July 2014 Copyright National Association of Testing Authorities, Australia 2014 This publication is protected by copyright under the Commonwealth of Australia Copyright

More information

Biotechnology. Srivatsan Kidambi, Ph.D.

Biotechnology. Srivatsan Kidambi, Ph.D. Stem Stem Cell Cell Engineering-What, Biology and it Application Why, How?? to Biotechnology Srivatsan Kidambi, Ph.D. Assistant Professor Department of Chemical & Biomolecular Engineering University of

More information

Risk Factors for Alcoholism among Taiwanese Aborigines

Risk Factors for Alcoholism among Taiwanese Aborigines Risk Factors for Alcoholism among Taiwanese Aborigines Introduction Like most mental disorders, Alcoholism is a complex disease involving naturenurture interplay (1). The influence from the bio-psycho-social

More information

Guidance Document Infectious Substances

Guidance Document Infectious Substances Guidance Document Infectious Substances Note: 1. The following Guidance Document was developed by the ICAO DGP. The original ICAO document reflects references to the ICAO Technical Instructions these have

More information

Hepatitis C treatment update

Hepatitis C treatment update Hepatitis C treatment update Viral Hepatitis Workshop Hepatitis Foundation and Regional Public Health December 2013 Jeffrey S Wong Hepatitis C treatment Non-A non-b hepatitis History of HCV treatment Hutt

More information

Breast cancer and the role of low penetrance alleles: a focus on ATM gene

Breast cancer and the role of low penetrance alleles: a focus on ATM gene Modena 18-19 novembre 2010 Breast cancer and the role of low penetrance alleles: a focus on ATM gene Dr. Laura La Paglia Breast Cancer genetic Other BC susceptibility genes TP53 PTEN STK11 CHEK2 BRCA1

More information

Figure 14.2 Overview of Innate and Adaptive Immunity

Figure 14.2 Overview of Innate and Adaptive Immunity I M M U N I T Y Innate (inborn) Immunity does not distinguish one pathogen from another Figure 14.2 Overview of Innate and Adaptive Immunity Our first line of defense includes physical and chemical barriers

More information

Recommendations for the Identification of Chronic Hepatitis C virus infection Among Persons Born During 1945-1965

Recommendations for the Identification of Chronic Hepatitis C virus infection Among Persons Born During 1945-1965 Recommendations for the Identification of Chronic Hepatitis C virus infection Among Persons Born During 1945-1965 MMWR August 17, 2012 Prepared by : The National Viral Hepatitis Technical Assistance Center

More information

BLOOD GROUP ANTIGENS AND ANTIBODIES

BLOOD GROUP ANTIGENS AND ANTIBODIES BLOOD GROUP ANTIGENS AND ANTIBODIES Over 20 blood group systems having approximately 400 blood group antigens are currently recognised. The ABO and Rhesus (Rh) blood group systems are of major clinical

More information

The Natural History of Chronic Hepatitis B Virus Infection

The Natural History of Chronic Hepatitis B Virus Infection The Natural History of Chronic Hepatitis B Virus Infection Brian J. McMahon, M.D. 1 ABSTRACT Three stages of chronic hepatitis B virus (HBV) infection are recognized: the immune tolerant phase, the chronic

More information

The role of IBV proteins in protection: cellular immune responses. COST meeting WG2 + WG3 Budapest, Hungary, 2015

The role of IBV proteins in protection: cellular immune responses. COST meeting WG2 + WG3 Budapest, Hungary, 2015 The role of IBV proteins in protection: cellular immune responses COST meeting WG2 + WG3 Budapest, Hungary, 2015 1 Presentation include: Laboratory results Literature summary Role of T cells in response

More information

Up to $402,000. Insight HIV. Drug Class. 1.2 million people in the United States were living with HIV at the end of 2011 (most recent data).

Up to $402,000. Insight HIV. Drug Class. 1.2 million people in the United States were living with HIV at the end of 2011 (most recent data). HIV Background, new developments, key strategies Drug Class Insight INTRODUCTION Human Immunodeficiency Virus (HIV) is the virus that can lead to Acquired Immunodeficiency Syndrome, or AIDS. No safe and

More information

Blood Stains at the Crime Scene Forensic Investigation

Blood Stains at the Crime Scene Forensic Investigation Blood Stains at the Crime Scene Forensic Investigation Introduction Blood stains at a crime scene can be crucial in solving the crime. Numerous analytical techniques can be used to study blood stains.

More information

The Liver and Alpha-1. Antitrypsin Deficiency (Alpha-1) 1 ALPHA-1 FOUNDATION

The Liver and Alpha-1. Antitrypsin Deficiency (Alpha-1) 1 ALPHA-1 FOUNDATION The Liver and Alpha-1 Antitrypsin Deficiency (Alpha-1) 1 ALPHA-1 FOUNDATION What Is Alpha-1 Antitrypsin Deficiency? Alpha-1 is a condition that may result in serious lung disease in adults and/or liver

More information

Hepatitis C. Eliot Godofsky, MD University Hepatitis Center Bradenton, FL

Hepatitis C. Eliot Godofsky, MD University Hepatitis Center Bradenton, FL Hepatitis C Eliot Godofsky, MD University Hepatitis Center Bradenton, FL Recent Advances in Hepatitis C Appreciation that many patients are undiagnosed Improved screening to identify infected persons Assessment

More information

New HLA class I epitopes defined by murine monoclonal antibodies

New HLA class I epitopes defined by murine monoclonal antibodies Human Immunology 71 (2010) 456 461 Contents lists available at ScienceDirect New HLA class I epitopes defined by murine monoclonal antibodies Nadim El-Awar a, *, Paul I. Terasaki b, Anh Nguyen a, Mamie

More information

Hospitalizations for Hepatitis A, B, and C, Active Component, U.S. Armed Forces, 1991-2011

Hospitalizations for Hepatitis A, B, and C, Active Component, U.S. Armed Forces, 1991-2011 Hospitalizations for Hepatitis A, B, and C, Active Component, U.S. Armed Forces, 1991-2011 lthough genetically quite distinct from one another, hepatitis viruses A, B, and C all cause inflammatory liver

More information

A link between gut microbiota, mucosal immunity and autoimmune arthritis. Hsin-Jung Joyce Wu "Microbiota and man: the story about us

A link between gut microbiota, mucosal immunity and autoimmune arthritis. Hsin-Jung Joyce Wu Microbiota and man: the story about us A link between gut microbiota, mucosal immunity and autoimmune arthritis Microbes and Man The majority of microbes we encounter are gut microbiota that live mostly in harmony with their host Duodenum 10

More information

2.0 Rationale, Purpose and Scope... 5. 4.0 Definitions... 6. 5.0 General Principles... 7

2.0 Rationale, Purpose and Scope... 5. 4.0 Definitions... 6. 5.0 General Principles... 7 Table of Contents Principles of IVD Medical Devices Classification 1.0 Introduction... 4 2.0 Rationale, Purpose and Scope... 5 2.1 Rationale... 5 2.2 Purpose... 5 2.3 Scope... 5 3.0 References... 5 4.0

More information

Update on Hepatitis C. Sally Williams MD

Update on Hepatitis C. Sally Williams MD Update on Hepatitis C Sally Williams MD Hep C is Everywhere! Hepatitis C Magnitude of the Infection Probably 8 to 10 million people in the U.S. are infected with Hep C 30,000 new cases are diagnosed annually;

More information

Hepatitis C. Screening, Diagnosis and Linkage to Care

Hepatitis C. Screening, Diagnosis and Linkage to Care Hepatitis C Screening, Diagnosis and Linkage to Care Diagnosis If your hepatitis C antibody test is reactive, a second test will be needed to diagnose and determine if you are currently infected. Screening

More information

Search Coordinator Certificate

Search Coordinator Certificate Educational. Expert led. E learning. Information and registration Educational. Expert led. E learning. Professionals involved in unrelated adult donor/cord blood unit search and selection are essential

More information

PERINATAL AND CHILDHOOD HEPATITIS.. WHAT ABOUT THE CHILDREN?

PERINATAL AND CHILDHOOD HEPATITIS.. WHAT ABOUT THE CHILDREN? PERINATAL AND CHILDHOOD HEPATITIS.. WHAT ABOUT THE CHILDREN? John T. Stutts, MD, MPH University of Louisville School of Medicine Department of Pediatrics Division of Pediatric Gastroenterology, Hepatology

More information

Lupus in Children and Teenagers. Arielle Hay, MD Pediatric Rheumatologist Nicklaus Children s Hospital

Lupus in Children and Teenagers. Arielle Hay, MD Pediatric Rheumatologist Nicklaus Children s Hospital Lupus in Children and Teenagers Arielle Hay, MD Pediatric Rheumatologist Nicklaus Children s Hospital Systemic Lupus Erythematosus (SLE) Chronic Illness What is lupus? Autoimmune Multisystem Antinuclear

More information

USPSTF Grade A B Recommendations

USPSTF Grade A B Recommendations USPSTF Grade Recommendations bdominal aortic aneurysm screening: men The USPSTF recommends one-time screening for abdominal aortic aneurysm by ultrasonography in men aged 65 to 75 who have ever smoked.

More information

Seroprevalence of Hepatitis C Virus (HCV) infection among blood donors in a South-Eastern State of Nigeria

Seroprevalence of Hepatitis C Virus (HCV) infection among blood donors in a South-Eastern State of Nigeria Seroprevalence of Hepatitis C Virus (HCV) infection among blood donors in a South-Eastern State of Nigeria Author(s): Chukwurah E.F., Ogbodo S.O and Obi G.O. Vol. 16, No. 2 (2005-05 - 2005-08) Biomedical

More information

EFFECT OF PREDATED VACCINATION AND CHINESE HERBAL ADJUVANT RABBIT HEMORRHAGIC DISEASE VACCINE ON IMMUNE RESPONSE IN YOUNG RABBITS

EFFECT OF PREDATED VACCINATION AND CHINESE HERBAL ADJUVANT RABBIT HEMORRHAGIC DISEASE VACCINE ON IMMUNE RESPONSE IN YOUNG RABBITS Pathology and Hygiene EFFECT OF PREDATED VACCINATION AND CHINESE HERBAL ADJUVANT RABBIT HEMORRHAGIC DISEASE VACCINE ON IMMUNE RESPONSE IN YOUNG RABBITS Longsheng Yang*, Jiabin Xue, Fang Wang, Yuanliang

More information

The Epidemiology of Hepatitis A, B, and C

The Epidemiology of Hepatitis A, B, and C The Epidemiology of Hepatitis A, B, and C Jamie Berkes M.D. University of Illinois at Chicago jberkes@uic.edu Epidemiology: Definitions The study of the incidence and prevalence of diseases in large populations

More information

Etiology of Type 1 Diabetes Chris Theberge

Etiology of Type 1 Diabetes Chris Theberge Etiology of Type 1 Diabetes Chris Theberge Type 1 diabetes, or Insulin Dependent Diabetes Mellitus (IDDM), is a disease characterized by auto-destruction of the pancreatic beta cells that produce insulin.

More information

One time screening, repeat screening for those at risk

One time screening, repeat screening for those at risk 2015 Adult Male Preventive Health Guidelines Important Note Health Net s Preventive Health Guidelines provide Health Net members and practitioners with recommendations for preventive care services for

More information

When an occupational exposure occurs, the source patient should be evaluated for both hepatitis B and hepatitis C. (AII)

When an occupational exposure occurs, the source patient should be evaluated for both hepatitis B and hepatitis C. (AII) XI. OCCUPATIONAL EXPOSURES TO HEPATITIS B AND C RECOMMENDATION: When an occupational exposure occurs, the source patient should be evaluated for both hepatitis B and hepatitis C. (AII) The risk of transmission

More information

AUTOLOGOUS BLOOD DONATION

AUTOLOGOUS BLOOD DONATION AUTOLOGOUS BLOOD DONATION UCLA Blood and Platelet Center 1045 Gayley Avenue Los Angeles, California 90024-3401 phone: 310.794.7207 website: www.gotblood.ucla.edu ----------------------------------------------------------------------------------------------------------------------------

More information

1150 W. Medical Center Dr. Research Investigator Ann Arbor, MI 48109 Department of Microbiology and Immunology phone: (734)763-5364

1150 W. Medical Center Dr. Research Investigator Ann Arbor, MI 48109 Department of Microbiology and Immunology phone: (734)763-5364 Alteri, Christopher J. 5641 Medical Science Bldg. II 1150 W. Medical Center Dr. Research Investigator Ann Arbor, MI 48109 Department of Microbiology and Immunology phone: (734)763-5364 University of Michigan

More information

History of DNA Sequencing & Current Applications

History of DNA Sequencing & Current Applications History of DNA Sequencing & Current Applications Christopher McLeod President & CEO, 454 Life Sciences, A Roche Company IMPORTANT NOTICE Intended Use Unless explicitly stated otherwise, all Roche Applied

More information

Kean University BS Degree Program in Athletic Training BLOOD BORN PATHOGENS POLICY

Kean University BS Degree Program in Athletic Training BLOOD BORN PATHOGENS POLICY Kean University BS Degree Program in Athletic Training BLOOD BORN PATHOGENS POLICY Effective September 2, 2014 The following policy will apply to students taking classes and faculty teaching those classes

More information

Viral Hepatitis A, B, and C

Viral Hepatitis A, B, and C Viral Hepatitis A, B, and C What is Hepatitis? Hepatitis means inflammation of the liver Elizabeth A. Bancroft, MD, SM Acute Communicable Disease Control County of Los Angeles Department of Public Health

More information

Regenerative Medicine : A Promising Approach In Overcoming Diabetes As An Increasing Economic Health Burden

Regenerative Medicine : A Promising Approach In Overcoming Diabetes As An Increasing Economic Health Burden Journal of Emerging Economies and Islamic Research www.jeeir.com Regenerative Medicine : A Promising Approach In Overcoming Diabetes As An Increasing Economic Health Burden Nafeeza Mohd Ismail a, Renu

More information

Nevada Department of Education Standards

Nevada Department of Education Standards Blood-Typing Through an experiment with Kool-Aid, students follow the steps of the scientific method to learn about the experimental procedure of blood typing. Grade Level: 5th Objectives: Students will

More information

Treatment of Acute Hepatitis C

Treatment of Acute Hepatitis C Management of Patients with Viral Hepatitis, Paris, 2004 Treatment of Acute Hepatitis C Michael P. Manns, Andrej Potthoff, Elmar Jaeckel, Heiner Wedemeyer Hepatitis C Virus (HCV) infection is a common

More information

HBV screening and management in HIV-infected children and adolescents

HBV screening and management in HIV-infected children and adolescents HBV screening and management in HIV-infected children and adolescents Linda Aurpibul M.D. Research Institute for Health Sciences, Chiang Mai University 8% HIV and Hepatitis B Co-infection Among Perinatally

More information

Hepatitis C. Laboratory Tests and Hepatitis C

Hepatitis C. Laboratory Tests and Hepatitis C Hepatitis C Laboratory Tests and Hepatitis C If you have hepatitis C, your doctor will use laboratory tests to check your health. This handout will help you understand what the major tests are and what

More information

Ph.D. in Molecular Medicine

Ph.D. in Molecular Medicine Ph.D. in Molecular Medicine and Translational Research College of Medicine 1. Introduction: The College of Medicine, while consolidating on its undergraduate innovative educational programs, decided to

More information

Modelling and analysis of T-cell epitope screening data.

Modelling and analysis of T-cell epitope screening data. Modelling and analysis of T-cell epitope screening data. Tim Beißbarth 2, Jason A. Tye-Din 1, Gordon K. Smyth 1, Robert P. Anderson 1 and Terence P. Speed 1 1 WEHI, 1G Royal Parade, Parkville, VIC 3050,

More information

Association between Dopamine Gene and Alcoholism in Pategar Community of Dharwad, Karnataka

Association between Dopamine Gene and Alcoholism in Pategar Community of Dharwad, Karnataka International Journal of Scientific and Research Publications, Volume 3, Issue 10, October 2013 1 Association between Dopamine Gene and Alcoholism in Pategar Community of Dharwad, Karnataka SOMASHEKHAR

More information

Original Article Study on Prevalence of TTV among Cirrhotic patients due to Hepatitis B & C in Ahwaz University Hospitals during the Years 2004-2005

Original Article Study on Prevalence of TTV among Cirrhotic patients due to Hepatitis B & C in Ahwaz University Hospitals during the Years 2004-2005 Iranian Journal of Virology 2009;3(1): 29-33 2009, Iranian Society for Virology Original Article Study on Prevalence of TTV among Cirrhotic patients due to Hepatitis B & C in Ahwaz University Hospitals

More information