Rates of Molecular Evolution of Primates

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "Rates of Molecular Evolution of Primates"

Transcription

1 Russian Journal of Genetics, Vol. 39, No. 7, 2003, pp Translated from Genetika, Vol. 39, No. 7, 2003, pp Original Russian Text Copyright 2003 by Tfitushkin. THEORETICAL PAPERS AND REVIEWS Rates of Molecular Evolution of Primates E. Ya. Tfitushkin Vavilov Institute of General Genetics, Russian Academy of Sciences, Moscow, Russia Received December 19, 2001 Abstract This review considers the history and the current state of the debatable issue of variation in accumulation rates of mutational substitutions in the phylogeny of humans and other primates. Arguments pro and contra the hypothesis on gradually decreasing tempo of molecular evolution of humans and apes are discussed. It is shown that data on proteins and (nuclear and mitochondrial) DNA confirm this hypothesis. The conclusion is drawn that the total rate of mutation accumulation is determined by a number of interacting factors. The primary of these factors in most cases (including that of hominids) is generation time, which is closely associated with the number of germ cell divisions. At the same time, fixation rates of nonsynonymous substitutions are also affected by various forms of selection. INTRODUCTION Variation in the rate of accumulation of mutational substitutions is currently among the most debatable problems of evolutionary genetics. Until the 1960s these rates were believed to be very unstable. However, in 1962 Zuckerkandl and Pauling (see Russian translation [1]) suggested that the time of divergence of organisms is approximately proportional to the number of amino acid differences in homologous chains of their hemoglobins. A year later a similar suggestion was advanced by Margoliash [2] who conducted a comparative analysis of cytochrome c amino acid sequences. Based on this idea, Zuckerkandl and Pauling formulated the hypothesis on the approximately constant rates of accumulation of point mutations in homologous amino acid sequences of proteins and nucleotide sequences of DNA and RNA [3]. These authors concluded that fixation of mutational substitutions can serve as a molecular evolutionary clock that could be used to determine the time of divergence of taxa, polypeptides, and polynucleotides. This hypothesis (usually referred to as the molecular clock hypothesis) has generated a discussion that has been continuing until now. The opponents of the hypothesis argued that the rates of molecular evolution are very variable and thus the concept of molecular clock is groundless (see [4]). A special place in this dispute is occupied by discussion of the data related to fixation rates of mutational substitutions in the phylogeny of humans and other primates. The interpretation of these data remained a hotly debated issue. In the present review I consider pro and contra argumentation in the discussion of the tempo of molecular evolution and analyze mutation accumulation dynamics in the evolution of hominids and their phylogenetic relatives. A DILEMMA RAISED BY IMMUNOCHEMICAL COMPARISON OF PROTEINS The early immunochemical studies of blood serum proteins of primates conducted in the 1960s [5, 6] have shown that some proteins evolve much faster than others. The proteins with low variability encoded by evolutionary stable genes were termed S (slowly evolving) proteins, and rapidly evolving ones, R (rapidly evolving) proteins. For instance, γ-globulin was assigned to the R type, and albumin, to the S type. The existence of proteins intermediate between these two extreme categories has been suggested. Rapidly evolving (R) proteins were thought to be more species-specific than slowly evolving (S) ones. The results of the same studies demonstrated that the evolution rates of S proteins vary depending on the taxonomic group. It was firmly believed that unequal antigenic distances along with equal divergence times prove inequality of the evolutionary rates of polypeptide sequences. For instance, the divergence of humans with tree shrews occurred at least no later than their divergence with lemurs, but albumins of humans and tree shrews are more similar immunologically than those of humans and lemurs. The splitting of the branches of humans and galagos coincides with that of humans and lemurs. Nevertheless the albumin of galagos was shown to be more similar to the human on than the albumin of lemurs. Therefore, it was concluded that the albumin evolution rate was faster in lemurs than in galagos and tree shrews. In a similar manner, it was shown that the relative evolutionary stability of the human albumin is in contrast with its rapid evolution in artiodactyls [6]. Among the higher primates, the divergence rate of this protein was the highest in platyrrhines (Cebidae), somewhat lower in cercopithecoids, and the lowest in hominoids. These and similar facts laid grounds to the general conclusion on a slowdown of the /03/ $ MAIK Nauka /Interperiodica

2 722 T TUSHKIN rates of progressive evolution of the S (but not R) proteins and were used for substantiating the then-popular theory relating evolutionary progress of primates with the evolution of their placenta. According to this theory proposed by Goodman [5 9], the specific features of evolutionary and genetic processes resulting in the appearance of humans and other modern primates were largely caused by the existence of immunochemical differences between homologous proteins in different individuals, i.e., genetic polymorphism of protein molecules. This theory considers the evolution of hominoid proteins as a culmination of the long-term phylogenetic trend appearing at the earliest stages of evolution of the living matter. It postulates that most of the mutations arising in primary organisms were neutral (note that this suggestion was formulated in 1961, that is, long before the neutral theory proposed in 1968). This promoted the accumulation of huge amounts of genetic variation. A small fraction of the neutral alleles turned out to be preadapted to the environmental conditions that appeared later. These alleles were selected for, which increased their frequencies. As a result of adaptation to the changing environments, the living forms have been gradually increasing their complexity. This process also occurred at the molecular level of organization of the living matter. The latter was manifested, in particular, in the formation of numerous interacting protein sites, which enhanced the number of selective constraints on the protein structure. Hence, the proportion of deleterious mutations increased and that of selectively neutral ones, decreased. As a result, deleterious mutational substations became predominant. The reduction in the number of amino acid sites that could accumulate neutral substitutions led to the slow down of the protein evolution. Placental mammals have an additional factor decreasing the rates of protein divergence: immunological selection against fetal antigens differing from the corresponding maternal ones. This selection is particularly strong in higher primates because these animals possess the hemochorial placenta, which is more permeable than the more ancient epitheliochorial placentas. In 1967, employing microcomplement fixation, Sarich and Wilson [10] checked the assumption on the regularity of molecular evolutionary rates. Using the relative rate test * they concluded that the evolutionary rates * This test is based on comparing homologous informational macromolecules of three types (e.g., A, B, and C), for which is known that two of them (say, B and C) diverged after splitting with the third one (A). The test proper consists in comparing the differences between the macromolecules of the A and B types with that differences between the corresponding molecules of A and C. If the molecular clock hypothesis is valid, then these differences, or, more specifically, the number of molecular substitutions causing them, would be approximately equal. Sarich and Wilson [10] showed, in particular, that during the evolution of the cercopithecoids and humans from their nearest common ancestor (having existed, as they believed, about 30 Myr ago), their albumins changed almost to the same extent. Based on this result, the authors concluded that the molecular clock hypothesis was valid. of this protein are equal in the phylogenetic lineages of hominoids (including human), cercopithecoids, and ceboids. According to Sarich and Wison s estimates, humans and African apes have diverged 4 to 5 Myr ago although most authors at that time believed that this event had occurred Myr ago. Based on these findings, Sarich criticized the placental hypothesis, which, in his view, should have been checked up by its author, Goodman, on the basis of his own immunological data without involving the fossil and anatomical data [11]. According to Sarich, the albumin of an average monkey evolved even faster that of an average prosimian, which radically contradicts one of the basic tenets of the above hypothesis. However, the results of Sarich and Wilson were soon subjected to criticism by some paleontologists who did not agree with their dating of the primate time divergence and immunogeneticists raising objections to their methodological approaches (see [12, 13] for references). Having compared antigenic determinants of 37 serum proteins, Bauer [12] obtain datings that coincided with the paleontological ones accepted at that time. According to his calculations, the nearest common relatives of humans with pongids, cercopithecoids, platyrrhines, and prosimians existed respectively 13.9 (but not 4 5, as claimed by Sarich and Wilson), 28.3, 54.9, and 63.3 Myr ago. In a later work, other authors [13] obtained (from the data of Sarich and Wilson for albumins) the same or even higher estimates. What is the cause of such great discrepancy in datings based on the same materials? Here some explanations of Sarich and Wilson s methods would be useful. These authors used the technique of microcomplement fixation, which consists in conducting a cross reaction between a purified antiserum and an antigen of the examined species and selecting (by a gradual increase) of such a antiserum concentration at which the intensity of the reaction between heterologous individuals would be the same as between homologous ones. The index by which the initial antiserum concentration is increased is called the dissimilarity index (ID). For homologous individuals ID is 1, and its value increases with the time of divergence from the common ancestor. Knowing the relationship between the dissimilarity index and the time, a corresponding immunological clock can be constructed. Sarich and Wilson ([14 16], cited from [17]) have established this relationship on the basis of the data of Wilson et al. ([18], cited from [17]) on an immunological comparison of several species of birds, reptiles, and amphibians and the known paleontological datings. They concluded that this relationship is best approximated by an exponential function ID = e kt. The same dependence was suggested for primates. The datings obtained by these authors were based on a comparison of only one protein, albumin, while the calculation was founded on an assumption that the lineages of hominoids and cercopithecoids had diverged 30 Myr ago. In

3 RATES OF MOLECULAR EVOLUTION OF PRIMATES 723 particular, the conclusion that humans and African apes had diverged about 5 Myr ago was drawn from these assumptions. Since the latter estimate of the time of divergence between hominids and pongids was at variance with the existing views, Read and Lestrel [17] made an attempt at checking whether the results of Wilson et al. correspond to the exponential model. Their approximation of the ID time relationship by a linear (ID = kt + b), power (ID = bt k + c), and exponential (ID = e kt ) functions demonstrated that these data are best described by a power function. Using a set of paleontologically acceptable datings of the divergence between humans and cercopithecoids, the power function gives the time of divergence between human and great apes ranging from 13 to 31 Myr. This was absolutely compatible with the views accepted in the 1960s. Nevertheless, Read and Lestrel suggested that these data are not sufficient for making a conclusive choice among the three possible models. Bauer [12] has accepted the linear model because he expected deviations from linearity only in comparisons going beyond the order of primates. Calibration of the time scale is based on the assumption that the last common ancestor of all placental mammals existed 70 Myr ago. Lovejoy et al. [13] have implemented an essentially different approach. These authors cast doubt on the accuracy of the estimations by their colleagues, including Sarich and Wilson. Lovejoy et al. thought it erroneous to use a geological time scale in estimating amino acid substitution rates because these rates primarily depend on generation length. Based on the degree of neocortex development, they determined generation times of extinct primate taxa and recalculated the divergence times using the same immunological data of Sarich and Wilson. It turned out that hominids and pongids have diverged 14 Myr ago or even earlier. In the overviews of the mid-1970s [19, 20], which in essence summarized the immunochemical studies, the proponents of the hypothesis on the constancy of the protein evolutionary rates in primates and the advocates of the concept on their irregularity both remained convinced in their views. The former (see Sarich and Cronin [19]) agreed that the rates of protein evolution are in some cases irregular. Moreover, using their own material, they revealed a number of such cases as a slow rate of albumin evolution in the lineage of owl monkey (Aotus) and a rapid rate, in anthropoids and phaners (squirrel lemurs) as well as slow evolution of transferrin in the phaner lineage and rapid, in loris. However, all these examples were regarded as exceptions to the rule of constant substitution rates in proteins and nucleic acids. Responding to criticisms in line of those considered above, these authors reasonably argued that the data of Sarich could comply to a multitude of equations and thus can easily be used to produce datings acceptable for different groups of paleontologists. In other words, the critics were accused of forcing the model to fit the given results. The latter (Dene et al. [20]) analyzing their impressively extensive data obtained in immunodiffusion comparisons of blood serum proteins, emphasized that the levels of antigenic species divergence within the genera of catarrhines is substantially lower than that in other mammals including primates. The same is observed in comparisons of larger taxa within superfamilies. Hence, it is concluded that one of two explanations is possible: either the catarrhines are evolutionarily younger than thought before or their antigen evolution slowed down. Having considered some paleontological and morphological data, the authors have chosen the second alternative, i.e., came to the conclusion that the serum proteins in catarrhines evolved slower than in nonanthropoid primates or nonprimate mammals. RATES OF EVOLUTION OF AMINO ACID SEQUENCES The comparative studies of amino acid sequencing were summed up in the mid-1980s since shortly after researchers in the reviewed field have almost completely shifted their attention to direct comparisons of nucleotide sequences. Analysis of the primary protein structure has extended the discussion of the proponents and opponents of the molecular clock theory. The key argumentation in the debate on neutrality of molecular evolution has been formed on the basis of the same material and in relation to this discussion. The estimation of the number of differences at amino acid sites permits evaluation of the number of amino acid, and later, nucleotide, substitutions that led to these differences. The possibility appeared to express the rates of molecular evolution directly in the number of mutational substitutions in unit time. Scoring of the amino acid differences implies detection of homologous sequences and collation of these sequences with localization of deletions and insertions. To do this, special methods of sequence alignment are used (see [21] for review). Based on some assumptions, the rate of molecular evolution can be determined from the estimated proportion of amino acid differences or the so-called amino acid distance d = n/n, where n is the number of homologous sites with differing amino acids and N is the total number of the amino acid pairs under comparison. Most authors accept the assumption that the number of amino acid substitutions follows the Poisson distribution. As early as in the late 1960s on the basis of these assumption Kimura [22] has estimated the evolutionary rates of the α- and β-hemoglobin chains in some lineages of highly diverged vertebrate species and found these rate strikingly constant. He believed that this constancy confirms his neutral theory of molecular evo-

4 724 T TUSHKIN lution (extensive substantiation of this thesis is presented in [23 25] and critique, in review [4]). In their polemics with Kimura, Langley and Fitch [26] conducted a detailed statistical analysis of the evolutionary rates of the α- and β-chains of hemoglobin, cytochrome c, fibrinopeptide A and concluded that they are not constant. These authors employed the assumption of minimum evolution and the maximum likelihood method. They found that the variability of evolutionary rates expressed as nucleotide substitution numbers was about twice as high as expected. However, the same authors in the same work stated that the estimates of the divergence time obtained from the calculated nucleotide substitution numbers are in good agreement with paleontological datings taken from an independent source. The calculated numbers of mutational substitutions plotted against the corresponding geological times showed a linear relationship, which, in view of Kimura [25], testified to constant rates of molecular evolution. The points belonging to primates are a notable exception. They are located below the line, which indicates a slowdown in evolutionary rates of proteins in the phylogeny of these animals. At this time, i.e., in the early 1970s, the same set of data was addressed by Goodman. This author used the results of the amino acid sequence comparisons to develop his idea on a slowdown of molecular evolution in humans and other primates [27, 28]. He carried out phylogenetic analysis on the basis of amino acid differences and minimal mutation distances obtained by their transformation. In addition, he implemented the approach based on the maximum parsimony method. In the first case, a direct calculation of homologous positions containing different amino acids was performed for each species pair. The proportion of such positions is a measure of genetic distance. Matrices of these distances termed amino acid differences (AAD) can be used to determine the order of species divergence. A more adequate measure of genetic distance is the minimal mutation distance (MMD), which is based on the values of amino acid differences. To calculate MMD, for each pair of differing homologous amino acids the minimal number of nucleotides is estimated that must be replaced to transform the codon of one amino acid into that of the other. For this, a special conversion table is used [29]. Since the maximum possible number of nucleotide substitutions for one compared amino acid pairs is equal to three, this measure does not take into account multiple and synonymous mutations. The advantage of minimal mutation differences over amino acid differences lies in the fact that the former better fit the additive hypothesis according to which genetic distances must be strictly directly proportional to the number of mutations that are recorded during the divergence of the compared species from the common ancestor [30, 31]. This advantage does not manifest in the case of closely related species and grows with the time of divergence of the amino acid sequences. The most powerful tool of analysis of molecular evolution is, according to Goodman, the maximum parsimony method. This method is based on a hypothesis stating that evolutionary changes in general are implemented by the shortest possible pathway. The procedure consists in constructing maximum parsimonious phylogenetic trees (in which the number of mutations separating the descendants and the ancestors is minimized) and selection of the tree of the minimum total length via iteration. The distance between the species estimated by the lengths of the chosen tree and expressed as the number of mutational substitutions is called maximum parsimonious distance (MPD). On the maximum parsimonious tree, two mutations can be separated by more than one mutational substitution at one nucleotide position. In other words, this method accounts for multiple and reverse mutations. It is clear that MPD cannot be smaller than MMD. Using single polypeptides and a set of them, Goodman and Lasker [32] calculated distances of the three types for a number of mammalian species (mostly primates). The conclusions on the primate phylogeny obtained from analyses of AAD, MMD, and MPD, in general coincide. However, comprehensive phylogenetic analysis was carried out only for the results obtained by the maximum parsimony method. Consideration of the maximum parsimonious trees confirmed the view on significant irregularity of evolutionary rates of homologous proteins. This irregularity manifests both within a lineage and among the branches [27, 28]. This statement can be readily proven since the number of fixed mutations, including recurrent ones, is known for each branch of the parsimonious tree. Knowing these numbers, the rates of molecular evolution can be calculated. These rates can be expressed, e.g., in NR%, that is, in the number of nucleotide replacements per 100 codons in 10 8 years. There are many examples of irregular evolution of certain proteins (see [33 36]). In this context, of far more interest are the cases of changes in rates of molecular evolution in general, i.e., concerning the total set of proteins examined (hemoglobin chains, myoglobins, fibrinopeptides, cytochrome c, crystallins of the eye lens, and carboanhydrases were mainly sequenced). In the human lineage, several periods of acceleration and deceleration of the rates of mutation accumulation were revealed for the past 700 Myr [33]. About 500 Myr ago, at the early stage of the evolution of vertebrates, when they had divided into Agnata and Gnatostomata, the process of mutation fixation became considerably faster. This period of high rate of molecular evolution terminated about 300 Myr ago, at the time when the common ancestor of birds and mammals appeared. The rates dropped and remained low until the time of appearance of placental mammals, i.e., according to the most popular dating, 90 Myr ago. During the

5 RATES OF MOLECULAR EVOLUTION OF PRIMATES 725 initial differentiation of primates, which commenced about 65 Myr ago, the protein evolution rates were very high. For instance, during this period, crystallins and cytochrome c evolved 10 to 20 times and globins and carboanhydrase I, 2 to 5 times as fast as during the preceding period. However, when higher primates appeared about 40 Myr ago, rates of molecular evolution decreased again, which is particularly apparent in the evolutionary history of hominoids. Thus, proteins mostly underwent changes in two parts of the phylogeny: (1) between the ancestors of all vertebrates and the common ancestors of mammals and birds and (2) between the ancestors of placental mammals (Eutheria) and those of higher primates (Anthropoidea). The rates of protein evolution in closest predecessors of humans should be considered as a special issue. After the appearance of higher primates, these rates decreased at least twofold. In the human and chimpanzee lineages they almost dropped to zero [33, 34]. Since the splitting of their common stem from the orangutan branch, in the genes for six polypeptides (namely, α- and β-hemoglobin chains, myoglobin, fibrinipeptides A and B, carboanhydrase I collectively consisting of 735 amino acids) have accumulated only 11 nucleotide substitutions. At that, human and chimpanzee is separated only by five mutations one of which was fixed in Homo (in carboanhydrase I) and four, in Pan (one in myoglobin and three in carboanhydrase I). If the common ancestor of these organisms existed 5 6 Myr ago, the rate of molecular evolution in the period from its appearance to the modern human is about 2.7 NR%. At the same time, the averaged lineage of the currently existing placental mammals has accumulated 140 nucleotide substitutions during the Myr elapsed from the divergence of the last common ancestor. Thus, the characteristic rate of molecular evolution for Eutheria is 22 NR%, which is 7 times higher than in the direct predecessors of Homo sapiens. EVOLUTIONARY RATES OF NUCLEOTIDE SEQUENCES The data on nucleotide sequences are more informative than those on proteins. They permit more extensive and in-depth study of molecular evolution. For instance, comparing nucleotide sequences, one can estimate rates of evolution of both coding and noncoding sequences whereas comparing coding sequences provides material to analyze accumulation of synonymous and nonsynonymous substitutions. Owing to the degeneracy of the genetic code, the frequency of nucleotide substitutions is higher than that of amino acid substitutions. As expected, comparative studies of coding nucleotide sequences have confirmed the conclusions made from analysis of amino acid sequences. Hominoid slowdown (as the discussed phenomenon is often called) in the coding DNA evolution was found already in the earliest of these studies carried out in the mid- 1980s, which compared orthologous and paralogous γ-globin genes in human, chimpanzee, gorilla and two nonallelic α-globin genes in chimpanzee [37, 38] (see [39] for information on globin genes of primates). It was shown that the fixation rate (frequency) of nonsynonymous nucleotide substitutions in the phylogeny of human and great apes during the last 10 Myr was only substitutions per site per year. This is 18 times lower than the corresponding rate in the early placental mammals and 9 times lower than the average fixation rate during the divergence of the mammalian orders (during approximately the last 80 Myr), which is substitutions par site per year for 39 loci [40] and about the same as only for the globin (α, ε, γ, β) genes (in the latter case, the calculations were conducted for four orders Primates, Lagomorpha, Artiodactyla, and Rodentia for which the relevant data were available [38]). The rate of synonymous subsititutions in hominins (human and great apes), equal to substitutions per site per year, is more than 5 times (3 4 times for the globin genes) as low as the average rate at the divergence of mammalian orders and 7.5 times as low as in the early placental mammals. Later Li et al. [41, 42] convincingly confirmed the conclusion on the slowdown of the rates of nucleotide substitutions, particularly synonymous ones. In one of these works [41], the average evolutionary rate of five genes at the divergence of human and chimpanzee was estimates as substitutions per synonymous site per year; in the other [42], the corresponding rate calculated for seven genes was (A nucleotide is considered synonymous if all possible substitutions in this site are synonymous; if one or two possible substitutions are synonymous, the site is considered synonymous for one-third and two-thirds [43].) This is significantly lower than the so-called average synonymous rate in mammals, which is about substitutions. These extremely low fixation rates in the hominin evolution are doubly remarkable since the duplicated α- and γ-globin genes used for calculations had underwent conversion, which enhances rates of nucleotide sequence change. The average rate of synonymous substitutions at the divergence of humans and Old World monkeys was shown to be equal to Thus, even with regard to synonymous sites, genes of hominins evolved nearly two times as slowly as genes of Old World monkeys The hominoid slowdown is apparent also in the evolution of noncoding sequences. For instance, it was shown for ψη pseudogenes belonging to the β-globin gene clusters (in higher primates, these clusters include six loci positioned in the following order: 5'-ε γ 1 γ 2 ψη δ β-3'. One of the earliest studies dealing with this issue was published in 1984 [44] when this loci was referred to as ψβ. This study showed that the evolutionary rate of this pseudogene as well as all its parts taken separately (including introns and terminal parts at the 5' and 3' ends) is at least 2 to 3 times lower than the evolutionary rate of nonfunctional mammal DNA, which

6 726 T TUSHKIN is, as in the case of synonymous substitutions, substitutions per site per year. The evolution rates of the ψη(ψβ)-globin genes in the lineages of human, chimpanzee, and gorilla after their divergence from the common ancestor were respectively , , and substitutions per site per year. Thus, the change of this gene was twice lower in the human lineage than in the lineages of African apes. That is, in humans the slowdown was more marked than in other hominoids. These results were confirmed, supplemented, and verified in a number of later works by different authors. Using the method of maximum parsimony, the teams that included Goodman [45 50] estimated that in the primate phylogeny, the evolutionary rate of the η pseudogene was highest in lemurs ( substitutions per site per year) and in the early monkeys, which are common ancestors of all primates ( ) and lowest in the ancestors of the modern hominoids (on average from the appearance of catarrhines, ). According to their estimates, the evolutionary rate of the ψη nucleotide sequence in the human lineage was 30 40% lower than in the chimpanzee and gorilla lineages. Based on the relative rate test, Hasegawa et al. [51, 52] also concluded that this rate was high in early primates and later decreased in the Anthropoidea lineage. In addition, these authors showed that in Hominoidea this evolutionary rate was at least 10% lower than in Cercopithecoidea. In the studies [41, 42] cited above, Li et al. analyzed evolution not only of coding but also of noncoding sequences, namely introns and nontranslated regions of some globin genes. These authors also used the relative rate test. They showed a distinct trend for decreasing nucleotide substitution rates in the human lineage for both pseudogene η and the total set of the nuclear DNA sequences examined. The average substitution rate in this total sequence was 1.5 times as low as in the New World monkeys and 2 times lower than in the Old World monkeys. (Note that the latter proportion coincides with that obtained from the data on synonymous substitutions.) Moreover, this rate was lower than the corresponding estimates for the great ape lineage. Nuclear DNA in the ancestors of orangutan, gorilla and chimpanzee evolved respectively 1.3, 2.2, and 1.2 times faster than in the human ancestors (according to [42], in the short communication on this study [41] the results are somewhat different). After obtaining this conclusive evidence in favor of the hominoid slowdown, the opponents of this theory argued that it is related only to certain parts of the genome. The most ardent advocate of this viewpoint was the Australian geneticist Easteal [53, 54]. In 1996, Herbert and Easteal [54] compared human and several of the Old World monkeys for the sequences of 19 genes and adjacent regions. For noncoding sequences, represented by sites, the substitution rate in the Old World monkeys was (in full accordance with the studies cited above) higher than in the human lineage (albeit only by ~43%). However, the Australian authors noted that 83% of the compared sites were in the β-globin gene cluster. These authors did not find significant differences in the mutation accumulation rates in sites not included in this cluster. They also did not detect differences in the evolutionary rates of the coding regions including 1592 synonymous and 5275 nonsynonymous sites belonging to 16 genes of various localization. The synonymous sites of the prion gene, for which the human ancestors evolved faster than those of the Old World monkeys, were the only exception. Based on these results, it was concluded that differences in mutation fixation rates between these two lineages are probably specific only for certain genome regions and thus the phenomenon of hominoid lowdown is not of a general nature. In the same year, evidence contradicting this conclusion was published [55]. These data were earlier presented by Li in a report that became a key event of the symposium Molecular Anthropology: Towards a New Evolutionary Paradigm held on March in Detroit in commemoration of the 70th anniversary of Morris Goodman [56]. In addition to the η-globin pseudogenes, this study compared introns of eight different genes as well as flanking and nontranslated regions near two of these genes. Only three of these noncoding sequences belonged to the β-globin cluster. In particular, it was shown that the mean rate of nucleotide substitutions averaged over the total sequence set was significantly lower than that in the Old World monkeys. For introns (8478 nucleotide positions), the latter rate exceeded the former by a factor of 1.3 (despite the fact that for three of them, including the ε-globin gene intron, these rates are equal), and for flanking and nontranslated regions (936 positions), by a factor of 2.3. The estimate of the ratio of these rates for introns virtually coincided with that for the ψη-globin genes (1.4). Note that these results were based on the relative rate tests, which does not depend on paleontological dating. This removes one of the main objections of Easteal et al. [54] who also used this tests and argued that intertaxon differences in the rates of molecular evolution found by other authors are explained by incorrect dating of the divergence times. The data on DNA DNA hybridization were also used as an argument in favor of the nonuniversal character of hominoid slowdown. These data reflect evolution of the total genome or its representative part and thus, in principle, could significantly contribute to the solution of this debatable issue. However, the interpretation of these results also raised contradictions between the opposed sides. Sibley and Ahlquist have obtained most comprehensive data on comparison of unique (single-copy) nuclear DNA of primates using DNA DNA hybridization. In 1984 [57] they came to a conclusion that the data on primates including hominoids are compatible with the relative rate tests and indicate uniformity of their molecular evolution. A year later, the same con-

7 RATES OF MOLECULAR EVOLUTION OF PRIMATES 727 clusion was made by Benveniste [58] on the basis of his results on DNA DNA hybridization. Although in his relative rate tests DNA of the species with greater generation lengths (i.e., human and great apes) produced somewhat more stable hybrids with DNA of the reference species than DNA of other primates, these differences were insignificant. However, in 1986 Britten [59], having analyzed the results of estimation of DNA heteroduplex stability, detected great (fivefold) differences in nucleotide sequence evolutionary rates between higher primates and some birds, on the one hand, and lower primates, rodents, sea urchins, and fruit flies, on the other. He substantiated a suggestion that in the early primates, before their division into lower and higher primates, the DNA evolution rate was high and then started to slow down but differently in these two groups. This author also showed that the hybridization data are in good agreement with the results of sequencing. He did not consider hominoid slowdown. In 1987, a new work by Sibley and Ahlquist [60] appeared. It was based on far more extensive material than their previous publication on the same topic. No evidence in favor of hominoid slowdown was obtained but the authors changed their opinion about the rates of DNA evolution. Earlier, Sibley and Ahlquist had been convinced that the average rate of genome evolution is the same in all animals but in the new study they admitted that this simple idea has been destoyed by facts. Their previous confidence in the constancy of this rate was based on comparisons of the data for primates and birds: calibrating factors (i.e., coefficients for converting T 50 H values reflecting heteroduplex thermostability into divergence times) obtained in both cases were similar. In their reevaluation of these values made for birds, these authors found that a number of groups of nonpasserine birds had considerably lower rates of genomic evolution than passerines and other nonpasserines. In addition, they took into account the literature results testifying for hominoid slowdown. Having considered all this evidence, Sibley and Ahlquist concluded that the genomic evolutionary rate depends on the age of reproduction onset, which, in turn, in associated with generation length. As follows from the speculative (according to Sibley and Ahlquist) calculations based on the ages of the first reproduction, hominoid DNAs evolved twice al slow as those of cercopithecoids. The authors expressed hope that these hypothetical estimations would be verified in the future. However, two years later, based on their experiments on DNA DNA hybridization, Caccone and Powell [61] stated that hominoid slowdown is nonexistent and their data could serve as a good molecular clock. Thus, the DNA DNA hybridization experiments did not yield conclusive evidence proving one of the alternative explanations. Nevertheless, the view on the universality of hominoid slowdown seems to be more plausible. The statement that it concerns only certain loci rather than the total genome encounters a difficult contradiction. It has been shown that the T 50 H estimates reflecting interspecific differences in unique genomic DNA are in good agreement with the genetic differences based on orthologous nucleotide sequences of the β-like globin gene cluster [47, 62]. The presence of this undeniable directly proportional relationship between these two parameters testifies to the fact that the evolutionary changes of single-copy genome regions, on the one hand, and the β-globin loci, on the other, are synchronous on the geological time scale. The constant rate of evolution of the former implies that the rate of evolution of the latter is also constant. If the evolutionary rates of the latter underwent a slowdown (which now seems to be generally accepted), the evolutionary rates of the former must have decreased proportionally. If we accept the reality of hominoid slowdown for β-globin genes, we must accept it for the set of unique DNA sequences. Ignoring the aforementioned linear relationship, the advocates of the universal molecular clock come in obvious contradiction with the facts. The effectiveness of the relative rate test underlying their results depends on the character and interpretation of the data used [63]. Li, a renowned authority on this problem who coauthored [64] a modern version of this test, in his recent studies confirms his fidelity to the hominoid slowdown concept (see, for example, [65]). Apparently, the arguments of its opponents have not convinced him. * At the same time, an important verification has been made. According to previous results (see above), obtained mainly for the β-globin-like sequences, DNA evolved slower in the human lineages than in those of gorilla and chimpanzee. However, a comparison of many (coding and noncoding) DNA sequences of human, chimpanzee, gorilla, and orangutan conducted by Chen and Li by using the relative rate test demonstrated the lack of statistically significant differences in the total rate of molecular evolution among different phylogenies. The only exception was a region of the Y chromosome (SMCY), which in fact evolved considerably slower in the ancestors of humans than in the ancestors of chimpanzee and gorilla. The rates of evolution of mtdna are of special interest because the mode of inheritance of this DNA differs from that of nuclear DNA. Already the early studies of the mitochondrial genome evolution showed that these rates are extremely high: mtdna evolved 5 to 10 times faster than nuclear DNA [68, 69]. As to variation of these rates, the opinions have again diverged. In their works published in the 1980s, Hasegawa et al. [50, 70 72] expressed a firm conviction that the rate of mtdna evolution is the same in different mammalian lineages and in different periods of their phylogeny. At least this rate is more constant than the evolu- * Probably the most extensive review of the concept of hominoid slowdown and a comprehensive answer to the opponents was presented in the book by Li [66] not available for Russian readers. The most amply documented argumentation of the adversaries of the concept is given in the monograph of the Australian geneticists mentioned above [67], which is also absent in Russian libraries.

8 728 T TUSHKIN tionary rate of the η-globin pseudogene, which was thought to be significantly (more than by 10%) lower in hominoids than in cercopithecoids [50]. However, the mtdna clock based on sequences of 896 nucleotides in length gave a too recent date of human chimpanzee divergence (2.7 ± 0.6 Myr) [72]. This dating has cast some doubt the hypothesis that was then practically generally accepted. According to that hypothesis, the oldest known human ancestor after branching off the chimpanzee lineage was Australopithecus afarensis that lived about 4 Myr ago and moved on two legs. To eradicate this discrepancy between the paleontological and molecular data, a hypothesis was put forward on a horizontal transfer of mtdna between the protohuman and protochimpanzee, which occurred 2.7 ± 0.6 Myr ago after their divergence having started about 5 Myr ago [50, 72]. Introgressive hybridization of the ancestral forms eliminated the accumulated the reading of the clock bringing it back to the initial point. However, later Hasegawa et al. obtained the results that refuted their conviction in constant rates of mtdna evolution. For instance, it was shown that the mtdna transversion rate is higher in human and mouse than in bovines, and probably lower in human than in mouse [73]. A comparison of mtdna in hominoids demonstrated that transitions are more frequent in human and great apes (chimpanzee, gorilla, orangutan) than in gibbons [74]. In lemurs, transition rate was extremely low. It constituted only 1/10 of the transition rate in the other primates although the rate of transversions in lemurs is the same as in the other members of this order [52, 75]. It is known that in mammalian mtdna, transitions occur significantly more often than transversions [69, 72]. However, in the lemur lineage the substitutions of all type have almost the same rate. Moreover, it was shown that the transition rate was higher in catarrhines (except gibbons) than in tarsiers and platyrrhines, and in gibbons it was higher than in the other catarrhines. Only the rate of transitions (but not transversions) varied. No hominoid slowdown was found. However, other Japanese authors [76] arrived at the conclusion that the nucleotide substitution rate in mtdna of hominins (human, chimpanzee, and gorilla) was lower than in the Old World monkeys (which in their study were represented by macaques). According to this study, variation the evolutionary rates of mitochondrial genes has the same pattern as that of nuclear genes. The evolution of nuclear and mitochondrial genes encoding proteins of the electron transport chains deserve special attention. These chains located on the inner mitochondrial membrane include five enzyme complexes, which contain 83 subunits most of which (71) are encoded by the nuclear genome, and some (13), by the mitochondrial genome [77]. Studies of some subunits essential for the chain functioning showed that they evolved much faster in primates than in other mammals. This difference in evolutionary rates seems to be most pronounced in mtdna-encoded cytochrome c oxidase subunit II ([78, 79] and other refs). However, a close ratio of evolutionary rates in primates and nonprimates was also shown in the case of some functionally associated with this subunit polypeptides encoded both by the mitochondrial (cytochrome b [80], cytochrome c oxidase subunit I [81]) and the nuclear (cytochrome c [78]) genomes. According to the recent estimates, this ratio is approximately equal to 2 (5 by earlier estimations [78]). For other genes of the electron transport chains, this ratio is approximately 1.5 [79]. Conclusions on variation of these evolutionary rates within the primate order are controversial. Some authors do not find any significant differences among them at different stage of phylogeny and in different systematic groups. Only occasional local anomalies are noted (according to [79], orangutans and macaques have elevated rates of evolution of the genes considered). However, other authors claimed the existence of a pronounced heterogeneity and pattern in the tempo of evolution of molecules related to aerobic energy metabolism. The aforementioned Australian geneticists found that nonsynonymous nucleotide substitutions in the genes of cytochrome b and cytochrome c oxidase subunit I occurred about twice as frequently in the simian primates than in the lineages of tarsiers, strepsirins (lemuriforms and loriforms) and nonprimate mammals [80, 81]. The same situation, in view of these authors, is observed in the case of the gene of cytochrome c oxidase subunit II. At the same time, they noted that the transversion frequency in the fourfold degenerate sites (positions where all possible substitutions are synonymous) of the cytochrome b gene is the same in all lineages. Another and more detailed scenario was reconstructed by Detroit researchers with participation of Goodman [77, 82]. It is based on a familiar scheme according to which the early stages of the human phylogeny involved acceleration of evolutionary rates while the late stages were characterized by their slowdown. In the cited works, this statement was supported by data on a number of complexes III and IV subunits as well as cytochrome c that interacts with both of these complexes. The most striking example of this dynamics is provided by cytochrome c oxidase subunit IV, which presumably is the key regulator of complex IV, i.e., of the whole enzyme. Phylogenetic sequence analysis of the encoding gene suggests that the nonsynonymous substitution rate was considerably higher in the early ancestors of the modern catarrhines living Myr ago than in their descendants (the platyrrhines are also characterized by these differences though they are less marked). It is particularly remarkable that at the early phylogenetic stages of catarrhines, nonsynonymous substitutions were far more (13.9 times) as frequent as synonymous ones, and at the late stages (e.g., in the direct predecessors of human, chimpanzee and gorilla) this pattern was reversed.

9 RATES OF MOLECULAR EVOLUTION OF PRIMATES /6.6 ~ 6.5 (?) > ~ 1 (?)/> 3 (?) > ~ 3.5 > 1 (?)/~ 4.5 (?) 4.5 < 1 (?)/1 2 < 1 (?)/~ ( ) > ~ 1 (?)/> 2 (?) < 1 (?)/1 2 (?) ~ < 1 (?)/ 2.2 ~ 2 < 1 (?)/> ~ 2 (?) ~ 2 ~ 1 (?)/> 2 (?) > ~ 3.4 (4.5?) ~ 1 (?)/~ 4.5 (?) 4.5? /> 2 (?) / ( ) 0.1/ ( ) 0.1/~ 1 1.2( ) Human Chimpanzee Gorillas Orangutans Gibbons Macaques Coatas Tarsiers Galagoes Lemurs Time, Myr Phylogenetic tree of the species representing major primate taxa. Its topology reflects the results of numerous molecular phylogenetic studies (see [39] for review). The chronology of branching of the phyletic lineages corresponds to the dates from the last reports (e.g., [86]). Above the tree branches, the rates ( 10 9 ) of nonsynonymous/synonymous substitutions are given. (mostly for the globin genes). The rates of substitutions in noncoding DNA sequences (for the ψη globin pseudogene) are given below them. See text for further details. MUTATION ACCUMULATION DYNAMICS IN THE ANCESTORS OF HUMAN AND OTHER PRIMATES Summarizing, let us visualize the total picture of variation in mutation substitution rates in the primate evolution. From the viewpoint of the proponents of the universal molecular clock hypothesis, this variation manifests only in random fluctuations of mutation fixation rates. They argue that the average rate of molecular evolution is the same in all animals including primates. In the case of coding nuclear DNA of mammals, this rate is about substitutions per nonsynonymous nucleotide site per year and about substitutions per synonymous site per year (see above). However, the assumption on the global constancy of the molecular evolutionary rates contradicts a number of convincing results, some of which were mentioned in the present review. The concept of local molecular clocks seems more realistic (see [4] for review). This concept assumes significant differences in nucleotide substitution rates in different taxonomic groups and at different phylogenetic stages. The contested by Kimura [83, 84] (see above) hypothesis that these rates increased and decreased during the entire history of the animal kingdom is in agreement with the results of many studies (see comments on a polemic retort by Kimura in [33, 85]). Primates provide the most interesting and striking example of such heterogeneity in the tempo of molecular evolution. The figure presents the fixation rates of nucleotide substitutions in coding and noncoding regions of primate DNA. The coding sequences are mainly represented by genes of (α- and β-like) globins and noncoding sequences, by the ψη globin pseudogene. The ψη evolutionary rates were calculated for nearly all tree branches, and evolutionary rates of the coding sequences, only for their minor part. Substantiated and plausible assumptions have been made with regard to the unknown values; the hypothetical rates are indicated with question marks. If the rates obtained in different studies are very different, the limits of their range are given; in most cases, the value obtained in the most recent work and/or the most reliable value is also presented. Conclusive evidence indicates that primates of the modern type (euprimates) appeared not earlier than 63 Myr ago (see [86]). The estimates of accumulation rates of nucleotide substitutions in early euprimates are lacking but such estimates exist for their direct predecessors, early placental mammals [38]. Apparently, these rates in early primates were similar to those in their closest ancestors. The corresponding values presented in the figure are produced by such extrapolation. Note that their values are substantially higher for mammals. After the split of two major primate branches, Strepsirhini and Haplorhini, the rates started to diminish, in the former to a greater extent than in the latter. Note also that among the lower primates, lemuriforms evolved slower than loriforms and tarsiers. The most pronounced slowdown was observed in the hominoid phylogeny. The rate estimates are from works [38, 41, 42, 46, 48, 51, 55, 87 94]. The issue of variation in the mtdna evolutionary tempo is even less clear than that of evolutionary rates of nuclear DNA. If we accept that humans and chimpanzees diverged 5 Myr ago, the fixation rate in the

How to Build a Phylogenetic Tree

How to Build a Phylogenetic Tree How to Build a Phylogenetic Tree Phylogenetics tree is a structure in which species are arranged on branches that link them according to their relationship and/or evolutionary descent. A typical rooted

More information

The Story of Human Evolution Part 1: From ape-like ancestors to modern humans

The Story of Human Evolution Part 1: From ape-like ancestors to modern humans The Story of Human Evolution Part 1: From ape-like ancestors to modern humans Slide 1 The Story of Human Evolution This powerpoint presentation tells the story of who we are and where we came from - how

More information

Lecture 5 Mutation and Genetic Variation

Lecture 5 Mutation and Genetic Variation 1 Lecture 5 Mutation and Genetic Variation I. Review of DNA structure and function you should already know this. A. The Central Dogma DNA mrna Protein where the mistakes are made. 1. Some definitions based

More information

Principles of Evolution - Origin of Species

Principles of Evolution - Origin of Species Theories of Organic Evolution X Multiple Centers of Creation (de Buffon) developed the concept of "centers of creation throughout the world organisms had arisen, which other species had evolved from X

More information

Maximum-Likelihood Estimation of Phylogeny from DNA Sequences When Substitution Rates Differ over Sites1

Maximum-Likelihood Estimation of Phylogeny from DNA Sequences When Substitution Rates Differ over Sites1 Maximum-Likelihood Estimation of Phylogeny from DNA Sequences When Substitution Rates Differ over Sites1 Ziheng Yang Department of Animal Science, Beijing Agricultural University Felsenstein s maximum-likelihood

More information

Introduction to Phylogenetic Analysis

Introduction to Phylogenetic Analysis Subjects of this lecture Introduction to Phylogenetic nalysis Irit Orr 1 Introducing some of the terminology of phylogenetics. 2 Introducing some of the most commonly used methods for phylogenetic analysis.

More information

Theory of Evolution. A. the beginning of life B. the evolution of eukaryotes C. the evolution of archaebacteria D. the beginning of terrestrial life

Theory of Evolution. A. the beginning of life B. the evolution of eukaryotes C. the evolution of archaebacteria D. the beginning of terrestrial life Theory of Evolution 1. In 1966, American biologist Lynn Margulis proposed the theory of endosymbiosis, or the idea that mitochondria are the descendents of symbiotic, aerobic eubacteria. What does the

More information

C1. A gene pool is all of the genes present in a particular population. Each type of gene within a gene pool may exist in one or more alleles.

C1. A gene pool is all of the genes present in a particular population. Each type of gene within a gene pool may exist in one or more alleles. C1. A gene pool is all of the genes present in a particular population. Each type of gene within a gene pool may exist in one or more alleles. The prevalence of an allele within the gene pool is described

More information

Ch. 13 How Populations Evolve Period. 4. Describe Lamarck s proposed theory of evolution, The Theory of Acquired Traits.

Ch. 13 How Populations Evolve Period. 4. Describe Lamarck s proposed theory of evolution, The Theory of Acquired Traits. Ch. 13 How Populations Evolve Name Period California State Standards covered by this chapter: Evolution 7. The frequency of an allele in a gene pool of a population depends on many factors and may be stable

More information

Evolution (18%) 11 Items Sample Test Prep Questions

Evolution (18%) 11 Items Sample Test Prep Questions Evolution (18%) 11 Items Sample Test Prep Questions Grade 7 (Evolution) 3.a Students know both genetic variation and environmental factors are causes of evolution and diversity of organisms. (pg. 109 Science

More information

1. Over the past century, several scientists around the world have made the following observations:

1. Over the past century, several scientists around the world have made the following observations: Evolution Keystone Review 1. Over the past century, several scientists around the world have made the following observations: New mitochondria and plastids can only be generated by old mitochondria and

More information

Name: Date: Problem How do amino acid sequences provide evidence for evolution? Procedure Part A: Comparing Amino Acid Sequences

Name: Date: Problem How do amino acid sequences provide evidence for evolution? Procedure Part A: Comparing Amino Acid Sequences Name: Date: Amino Acid Sequences and Evolutionary Relationships Introduction Homologous structures those structures thought to have a common origin but not necessarily a common function provide some of

More information

Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs)

Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs) Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs) Single nucleotide polymorphisms or SNPs (pronounced "snips") are DNA sequence variations that occur

More information

Quiz #4 Ch. 4 Modern Evolutionary Theory

Quiz #4 Ch. 4 Modern Evolutionary Theory Physical Anthropology Summer 2014 Dr. Leanna Wolfe Quiz #4 Ch. 4 Modern Evolutionary Theory 1. T/F Evolution by natural selection works directly on individuals, transforming populations. 2. T/F A genotypic

More information

Evidence for evolution factsheet

Evidence for evolution factsheet The theory of evolution by natural selection is supported by a great deal of evidence. Fossils Fossils are formed when organisms become buried in sediments, causing little decomposition of the organism.

More information

AP Biology Learning Objective Cards

AP Biology Learning Objective Cards 1.1 The student is able to convert a data set from a table of numbers that reflect a change in the genetic makeup of a population over time and to apply mathematical methods and conceptual understandings

More information

Amino Acids and Their Properties

Amino Acids and Their Properties Amino Acids and Their Properties Recap: ss-rrna and mutations Ribosomal RNA (rrna) evolves very slowly Much slower than proteins ss-rrna is typically used So by aligning ss-rrna of one organism with that

More information

Algorithms in Computational Biology (236522) spring 2007 Lecture #1

Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office

More information

Biological Sciences Initiative. Human Genome

Biological Sciences Initiative. Human Genome Biological Sciences Initiative HHMI Human Genome Introduction In 2000, researchers from around the world published a draft sequence of the entire genome. 20 labs from 6 countries worked on the sequence.

More information

Analysis of two genes from the X and Y chromosomes of plant species from the genus Silene

Analysis of two genes from the X and Y chromosomes of plant species from the genus Silene Analysis of DNA sequence data p. 1 Analysis of DNA sequence data using MEGA and DNAsp. Analysis of two genes from the X and Y chromosomes of plant species from the genus Silene The first two computer classes

More information

AP BIOLOGY 2010 SCORING GUIDELINES (Form B)

AP BIOLOGY 2010 SCORING GUIDELINES (Form B) AP BIOLOGY 2010 SCORING GUIDELINES (Form B) Question 2 Certain human genetic conditions, such as sickle cell anemia, result from single base-pair mutations in DNA. (a) Explain how a single base-pair mutation

More information

Final Project Report

Final Project Report CPSC545 by Introduction to Data Mining Prof. Martin Schultz & Prof. Mark Gerstein Student Name: Yu Kor Hugo Lam Student ID : 904907866 Due Date : May 7, 2007 Introduction Final Project Report Pseudogenes

More information

Name Class Date. binomial nomenclature. MAIN IDEA: Linnaeus developed the scientific naming system still used today.

Name Class Date. binomial nomenclature. MAIN IDEA: Linnaeus developed the scientific naming system still used today. Section 1: The Linnaean System of Classification 17.1 Reading Guide KEY CONCEPT Organisms can be classified based on physical similarities. VOCABULARY taxonomy taxon binomial nomenclature genus MAIN IDEA:

More information

Okami Study Guide: Chapter 3 1

Okami Study Guide: Chapter 3 1 Okami Study Guide: Chapter 3 1 Chapter in Review 1. Heredity is the tendency of offspring to resemble their parents in various ways. Genes are units of heredity. They are functional strands of DNA grouped

More information

Biology 1406 - Notes for exam 5 - Population genetics Ch 13, 14, 15

Biology 1406 - Notes for exam 5 - Population genetics Ch 13, 14, 15 Biology 1406 - Notes for exam 5 - Population genetics Ch 13, 14, 15 Species - group of individuals that are capable of interbreeding and producing fertile offspring; genetically similar 13.7, 14.2 Population

More information

Nature of Genetic Material. Nature of Genetic Material

Nature of Genetic Material. Nature of Genetic Material Core Category Nature of Genetic Material Nature of Genetic Material Core Concepts in Genetics (in bold)/example Learning Objectives How is DNA organized? Describe the types of DNA regions that do not encode

More information

Classification and Evolution

Classification and Evolution Classification and Evolution Starter: How many different ways could I split these objects into 2 groups? Classification All living things can also be grouped how do we decide which groups to put them into?

More information

Introduction to Physical Anthropology - Study Guide - Focus Topics

Introduction to Physical Anthropology - Study Guide - Focus Topics Introduction to Physical Anthropology - Study Guide - Focus Topics Chapter 1 Species: Recognize all definitions. Evolution: Describe all processes. Culture: Define and describe importance. Biocultural:

More information

Mechanisms of Evolution

Mechanisms of Evolution page 2 page 3 Teacher's Notes Mechanisms of Evolution Grades: 11-12 Duration: 28 mins Summary of Program Evolution is the gradual change that can be seen in a population s genetic composition, from one

More information

Worksheet - COMPARATIVE MAPPING 1

Worksheet - COMPARATIVE MAPPING 1 Worksheet - COMPARATIVE MAPPING 1 The arrangement of genes and other DNA markers is compared between species in Comparative genome mapping. As early as 1915, the geneticist J.B.S Haldane reported that

More information

Evolution and Darwin

Evolution and Darwin Evolution and Darwin Evolution The processes that have transformed life on earth from it s earliest forms to the vast diversity that characterizes it today. A change in the genes!!!!!!!! Old Theories of

More information

Lab 2/Phylogenetics/September 16, 2002 1 PHYLOGENETICS

Lab 2/Phylogenetics/September 16, 2002 1 PHYLOGENETICS Lab 2/Phylogenetics/September 16, 2002 1 Read: Tudge Chapter 2 PHYLOGENETICS Objective of the Lab: To understand how DNA and protein sequence information can be used to make comparisons and assess evolutionary

More information

What two Assumptions did Darwin have to arrive at BEFORE he could form his theories of evolution?

What two Assumptions did Darwin have to arrive at BEFORE he could form his theories of evolution? Influences on Darwin s Thinking: What ideas did each of the listed names below contribute to Darwin s thinking about evolution? (very brief) Georges Buffon: Jean Baptiste Lamarck: Charles Lyell: Thomas

More information

1 Mutation and Genetic Change

1 Mutation and Genetic Change CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds

More information

How Populations Evolve

How Populations Evolve How Populations Evolve Darwin and the Origin of the Species Charles Darwin published On the Origin of Species by Means of Natural Selection, November 24, 1859. Darwin presented two main concepts: Life

More information

Humans - Origin and Dispersion

Humans - Origin and Dispersion Humans - Origin and Dispersion Human-chimp. Last common ancestor (LCA) Presumed origin in central Africa Hominin species evolved in Africa, some spread to Asia and Europe Homo sapiens evolved in Africa,

More information

Sequence Analysis 15: lecture 5. Substitution matrices Multiple sequence alignment

Sequence Analysis 15: lecture 5. Substitution matrices Multiple sequence alignment Sequence Analysis 15: lecture 5 Substitution matrices Multiple sequence alignment A teacher's dilemma To understand... Multiple sequence alignment Substitution matrices Phylogenetic trees You first need

More information

Gene mutation and molecular medicine Chapter 15

Gene mutation and molecular medicine Chapter 15 Gene mutation and molecular medicine Chapter 15 Lecture Objectives What Are Mutations? How Are DNA Molecules and Mutations Analyzed? How Do Defective Proteins Lead to Diseases? What DNA Changes Lead to

More information

The Universal Laws of Gravitation. Copyright 2012 Joseph A. Rybczyk

The Universal Laws of Gravitation. Copyright 2012 Joseph A. Rybczyk The Universal Laws of Gravitation Copyright 2012 Joseph A. Rybczyk Abstract Close examination of Newton s universal law of gravitation and Galileo s discovery that all objects fall to Earth at the same

More information

MCB41: Second Midterm Spring 2009

MCB41: Second Midterm Spring 2009 MCB41: Second Midterm Spring 2009 Before you start, print your name and student identification number (S.I.D) at the top of each page. There are 7 pages including this page. You will have 50 minutes for

More information

Name: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question.

Name: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question. Name: Class: Date: Chapter 17 Practice Multiple Choice Identify the choice that best completes the statement or answers the question. 1. The correct order for the levels of Linnaeus's classification system,

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources 1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools

More information

AP Biology Essential Knowledge Student Diagnostic

AP Biology Essential Knowledge Student Diagnostic AP Biology Essential Knowledge Student Diagnostic Background The Essential Knowledge statements provided in the AP Biology Curriculum Framework are scientific claims describing phenomenon occurring in

More information

Lecture 3: Mutations

Lecture 3: Mutations Lecture 3: Mutations Recall that the flow of information within a cell involves the transcription of DNA to mrna and the translation of mrna to protein. Recall also, that the flow of information between

More information

DNA and Forensic Science

DNA and Forensic Science DNA and Forensic Science Micah A. Luftig * Stephen Richey ** I. INTRODUCTION This paper represents a discussion of the fundamental principles of DNA technology as it applies to forensic testing. A brief

More information

AP Biology 2015 Free-Response Questions

AP Biology 2015 Free-Response Questions AP Biology 2015 Free-Response Questions College Board, Advanced Placement Program, AP, AP Central, and the acorn logo are registered trademarks of the College Board. AP Central is the official online home

More information

LAB 21 Using Bioinformatics to Investigate Evolutionary Relationships; Have a BLAST!

LAB 21 Using Bioinformatics to Investigate Evolutionary Relationships; Have a BLAST! LAB 21 Using Bioinformatics to Investigate Evolutionary Relationships; Have a BLAST! Introduction: Between 1990-2003, scientists working on an international research project known as the Human Genome Project,

More information

PRINCIPLES OF POPULATION GENETICS

PRINCIPLES OF POPULATION GENETICS PRINCIPLES OF POPULATION GENETICS FOURTH EDITION Daniel L. Hartl Harvard University Andrew G. Clark Cornell University UniversitSts- und Landesbibliothek Darmstadt Bibliothek Biologie Sinauer Associates,

More information

Umm AL Qura University MUTATIONS. Dr Neda M Bogari

Umm AL Qura University MUTATIONS. Dr Neda M Bogari Umm AL Qura University MUTATIONS Dr Neda M Bogari CONTACTS www.bogari.net http://web.me.com/bogari/bogari.net/ From DNA to Mutations MUTATION Definition: Permanent change in nucleotide sequence. It can

More information

The Central Dogma of Molecular Biology

The Central Dogma of Molecular Biology Vierstraete Andy (version 1.01) 1/02/2000 -Page 1 - The Central Dogma of Molecular Biology Figure 1 : The Central Dogma of molecular biology. DNA contains the complete genetic information that defines

More information

Human Genome and Human Genome Project. Louxin Zhang

Human Genome and Human Genome Project. Louxin Zhang Human Genome and Human Genome Project Louxin Zhang A Primer to Genomics Cells are the fundamental working units of every living systems. DNA is made of 4 nucleotide bases. The DNA sequence is the particular

More information

A Quick Taxonomy of the Primate Order (See University of Manitoba for an excellent and very thorough primate taxonomy)

A Quick Taxonomy of the Primate Order (See University of Manitoba for an excellent and very thorough primate taxonomy) PRIMATE TAXONOMY Apes are no monkeys! The best way to insult a scientist working on chimpanzees is to say he/she is working with monkeys. We, humans, belong to the same family as the anthropoid (human-like)

More information

Forensic DNA Testing Terminology

Forensic DNA Testing Terminology Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.

More information

Trasposable elements: P elements

Trasposable elements: P elements Trasposable elements: P elements In 1938 Marcus Rhodes provided the first genetic description of an unstable mutation, an allele of a gene required for the production of pigment in maize. This instability

More information

MAKING AN EVOLUTIONARY TREE

MAKING AN EVOLUTIONARY TREE Student manual MAKING AN EVOLUTIONARY TREE THEORY The relationship between different species can be derived from different information sources. The connection between species may turn out by similarities

More information

Gene Mapping Techniques

Gene Mapping Techniques Gene Mapping Techniques OBJECTIVES By the end of this session the student should be able to: Define genetic linkage and recombinant frequency State how genetic distance may be estimated State how restriction

More information

Employment, unemployment and real economic growth. Ivan Kitov Institute for the Dynamics of the Geopsheres, Russian Academy of Sciences

Employment, unemployment and real economic growth. Ivan Kitov Institute for the Dynamics of the Geopsheres, Russian Academy of Sciences Employment, unemployment and real economic growth Ivan Kitov Institute for the Dynamics of the Geopsheres, Russian Academy of Sciences Oleg Kitov Department of Economics, University of Oxford Abstract

More information

A Brief Introduction to Systems Biology: Gene Regulatory Networks Rajat K. De

A Brief Introduction to Systems Biology: Gene Regulatory Networks Rajat K. De A Brief Introduction to Systems Biology: Gene Regulatory Networks Rajat K. De Machine Intelligence Unit, Indian Statistical Institute 203 B. T. Road Kolkata 700108 email id: rajat@isical.ac.in 1 Informatics

More information

Lab 2 - Illustrating Evolutionary Relationships Between Organisms: Emperor Penguins and Phylogenetic Trees

Lab 2 - Illustrating Evolutionary Relationships Between Organisms: Emperor Penguins and Phylogenetic Trees Biology 18 Spring 2008 Lab 2 - Illustrating Evolutionary Relationships Between Organisms: Emperor Penguins and Phylogenetic Trees Pre-Lab Reference Reading: Review pp. 542-556 and pp. 722-737 in Life by

More information

Chapter 6 DNA Replication

Chapter 6 DNA Replication Chapter 6 DNA Replication Each strand of the DNA double helix contains a sequence of nucleotides that is exactly complementary to the nucleotide sequence of its partner strand. Each strand can therefore

More information

Genetics Lecture Notes 7.03 2005. Lectures 1 2

Genetics Lecture Notes 7.03 2005. Lectures 1 2 Genetics Lecture Notes 7.03 2005 Lectures 1 2 Lecture 1 We will begin this course with the question: What is a gene? This question will take us four lectures to answer because there are actually several

More information

SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE

SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE AP Biology Date SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE LEARNING OBJECTIVES Students will gain an appreciation of the physical effects of sickle cell anemia, its prevalence in the population,

More information

Unit 1 - Fundamental Biology Skills and Knowledge

Unit 1 - Fundamental Biology Skills and Knowledge PREP TM AP* Biology Prep Course Syllabus Foundational Topics Review 10 units that cover fundamental biology topics typically covered in a general biology course. This content is perfect to use as a summer

More information

FINDING RELATION BETWEEN AGING AND

FINDING RELATION BETWEEN AGING AND FINDING RELATION BETWEEN AGING AND TELOMERE BY APRIORI AND DECISION TREE Jieun Sung 1, Youngshin Joo, and Taeseon Yoon 1 Department of National Science, Hankuk Academy of Foreign Studies, Yong-In, Republic

More information

Structure and Function of DNA

Structure and Function of DNA Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four

More information

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!! DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other

More information

Genomes and SNPs in Malaria and Sickle Cell Anemia

Genomes and SNPs in Malaria and Sickle Cell Anemia Genomes and SNPs in Malaria and Sickle Cell Anemia Introduction to Genome Browsing with Ensembl Ensembl The vast amount of information in biological databases today demands a way of organising and accessing

More information

Modules 5: Behavior Genetics and Evolutionary Psychology

Modules 5: Behavior Genetics and Evolutionary Psychology Modules 5: Behavior Genetics and Evolutionary Psychology Source of similarities and differences Similarities with other people such as developing a languag, showing similar emotions, following similar

More information

Human Genome Organization: An Update. Genome Organization: An Update

Human Genome Organization: An Update. Genome Organization: An Update Human Genome Organization: An Update Genome Organization: An Update Highlights of Human Genome Project Timetable Proposed in 1990 as 3 billion dollar joint venture between DOE and NIH with 15 year completion

More information

Phylogenetic Trees Made Easy

Phylogenetic Trees Made Easy Phylogenetic Trees Made Easy A How-To Manual Fourth Edition Barry G. Hall University of Rochester, Emeritus and Bellingham Research Institute Sinauer Associates, Inc. Publishers Sunderland, Massachusetts

More information

Evolution of Retroviruses: Fossils in our DNA 1

Evolution of Retroviruses: Fossils in our DNA 1 Evolution of Retroviruses: Fossils in our DNA 1 JOHN M. COFFIN Professor of Molecular Biology and Microbiology Tufts University UNIQUE AMONG INFECTIOUS AGENTS, retroviruses provide the opportunity for

More information

Human Mendelian Disorders. Genetic Technology. What is Genetics? Genes are DNA 9/3/2008. Multifactorial Disorders

Human Mendelian Disorders. Genetic Technology. What is Genetics? Genes are DNA 9/3/2008. Multifactorial Disorders Human genetics: Why? Human Genetics Introduction Determine genotypic basis of variant phenotypes to facilitate: Understanding biological basis of human genetic diversity Prenatal diagnosis Predictive testing

More information

Focusing on results not data comprehensive data analysis for targeted next generation sequencing

Focusing on results not data comprehensive data analysis for targeted next generation sequencing Focusing on results not data comprehensive data analysis for targeted next generation sequencing Daniel Swan, Jolyon Holdstock, Angela Matchan, Richard Stark, John Shovelton, Duarte Mohla and Simon Hughes

More information

A Step-by-Step Tutorial: Divergence Time Estimation with Approximate Likelihood Calculation Using MCMCTREE in PAML

A Step-by-Step Tutorial: Divergence Time Estimation with Approximate Likelihood Calculation Using MCMCTREE in PAML 9 June 2011 A Step-by-Step Tutorial: Divergence Time Estimation with Approximate Likelihood Calculation Using MCMCTREE in PAML by Jun Inoue, Mario dos Reis, and Ziheng Yang In this tutorial we will analyze

More information

Chapter 12 - Reaction Kinetics

Chapter 12 - Reaction Kinetics Chapter 12 - Reaction Kinetics In the last chapter we looked at enzyme mechanisms. In this chapter we ll see how enzyme kinetics, i.e., the study of enzyme reaction rates, can be useful in learning more

More information

Data for phylogenetic analysis

Data for phylogenetic analysis Data for phylogenetic analysis The data that are used to estimate the phylogeny of a set of tips are the characteristics of those tips. Therefore the success of phylogenetic inference depends in large

More information

Chapter 4 The role of mutation in evolution

Chapter 4 The role of mutation in evolution Chapter 4 The role of mutation in evolution Objective Darwin pointed out the importance of variation in evolution. Without variation, there would be nothing for natural selection to act upon. Any change

More information

Inferential Statistics

Inferential Statistics Inferential Statistics Sampling and the normal distribution Z-scores Confidence levels and intervals Hypothesis testing Commonly used statistical methods Inferential Statistics Descriptive statistics are

More information

Chapter 1. What is Biology? Worksheets. (Opening image copyright by Kirsty Pargeter, 2010. Used under license from Shutterstock.com.

Chapter 1. What is Biology? Worksheets. (Opening image copyright by Kirsty Pargeter, 2010. Used under license from Shutterstock.com. Chapter 1 What is Biology? Worksheets (Opening image copyright by Kirsty Pargeter, 2010. Used under license from Shutterstock.com.) Lesson 1.1: Science and the Natural World Lesson 1.2: Biology: The Study

More information

Chapter 21 Active Reading Guide The Evolution of Populations

Chapter 21 Active Reading Guide The Evolution of Populations Name: Roksana Korbi AP Biology Chapter 21 Active Reading Guide The Evolution of Populations This chapter begins with the idea that we focused on as we closed Chapter 19: Individuals do not evolve! Populations

More information

Biological kinds and the causal theory of reference

Biological kinds and the causal theory of reference Biological kinds and the causal theory of reference Ingo Brigandt Department of History and Philosophy of Science 1017 Cathedral of Learning University of Pittsburgh Pittsburgh, PA 15260 E-mail: inb1@pitt.edu

More information

A branch-and-bound algorithm for the inference of ancestral. amino-acid sequences when the replacement rate varies among

A branch-and-bound algorithm for the inference of ancestral. amino-acid sequences when the replacement rate varies among A branch-and-bound algorithm for the inference of ancestral amino-acid sequences when the replacement rate varies among sites Tal Pupko 1,*, Itsik Pe er 2, Masami Hasegawa 1, Dan Graur 3, and Nir Friedman

More information

Chapter 5: Organization and Expression of Immunoglobulin Genes

Chapter 5: Organization and Expression of Immunoglobulin Genes Chapter 5: Organization and Expression of Immunoglobulin Genes I. Genetic Model Compatible with Ig Structure A. Two models for Ab structure diversity 1. Germ-line theory: maintained that the genome contributed

More information

Age to Age Factor Selection under Changing Development Chris G. Gross, ACAS, MAAA

Age to Age Factor Selection under Changing Development Chris G. Gross, ACAS, MAAA Age to Age Factor Selection under Changing Development Chris G. Gross, ACAS, MAAA Introduction A common question faced by many actuaries when selecting loss development factors is whether to base the selected

More information

An algorithm for isoelectric point estimation

An algorithm for isoelectric point estimation An algorithm for isoelectric point estimation David L. Tabb Created 7/10/01 Updated 6/28/03 1 Introduction One of the most common techniques for separating mixtures of proteins is the two-dimensional polyacrylamide

More information

Summary. 16 1 Genes and Variation. 16 2 Evolution as Genetic Change. Name Class Date

Summary. 16 1 Genes and Variation. 16 2 Evolution as Genetic Change. Name Class Date Chapter 16 Summary Evolution of Populations 16 1 Genes and Variation Darwin s original ideas can now be understood in genetic terms. Beginning with variation, we now know that traits are controlled by

More information

Bayesian coalescent inference of population size history

Bayesian coalescent inference of population size history Bayesian coalescent inference of population size history Alexei Drummond University of Auckland Workshop on Population and Speciation Genomics, 2016 1st February 2016 1 / 39 BEAST tutorials Population

More information

INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B

INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS

More information

Bio 102 Practice Problems Genetic Code and Mutation

Bio 102 Practice Problems Genetic Code and Mutation Bio 102 Practice Problems Genetic Code and Mutation Multiple choice: Unless otherwise directed, circle the one best answer: 1. Beadle and Tatum mutagenized Neurospora to find strains that required arginine

More information

BARCODING LIFE, ILLUSTRATED

BARCODING LIFE, ILLUSTRATED BARCODING LIFE, ILLUSTRATED Goals, Rationale, Results Barcoding is a standardized approach to identifying animals and plants by minimal sequences of DNA. 1. Why barcode animal and plant species? By harnessing

More information

Chapter Seven. Multiple regression An introduction to multiple regression Performing a multiple regression on SPSS

Chapter Seven. Multiple regression An introduction to multiple regression Performing a multiple regression on SPSS Chapter Seven Multiple regression An introduction to multiple regression Performing a multiple regression on SPSS Section : An introduction to multiple regression WHAT IS MULTIPLE REGRESSION? Multiple

More information

11.1 KEY CONCEPT A population shares a common gene pool.

11.1 KEY CONCEPT A population shares a common gene pool. 11.1 KEY CONCEPT A population shares a common gene pool. Why it s beneficial: Genetic variation leads to phenotypic variation. It increases the chance that some individuals will survive Phenotypic variation

More information

Introduction to Bioinformatics 3. DNA editing and contig assembly

Introduction to Bioinformatics 3. DNA editing and contig assembly Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 matthewb@ba.ars.usda.gov

More information

Understanding by Design. Title: BIOLOGY/LAB. Established Goal(s) / Content Standard(s): Essential Question(s) Understanding(s):

Understanding by Design. Title: BIOLOGY/LAB. Established Goal(s) / Content Standard(s): Essential Question(s) Understanding(s): Understanding by Design Title: BIOLOGY/LAB Standard: EVOLUTION and BIODIVERSITY Grade(s):9/10/11/12 Established Goal(s) / Content Standard(s): 5. Evolution and Biodiversity Central Concepts: Evolution

More information

1 Phylogenetic History: The Evolution of Marine Mammals

1 Phylogenetic History: The Evolution of Marine Mammals 1 Phylogenetic History: The Evolution of Marine Mammals Think for a moment about marine mammals: seals, walruses, dugongs and whales. Seals and walruses are primarily cold-water species that eat mostly

More information

Translation Study Guide

Translation Study Guide Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to

More information

Evolution Part 1. Unit 10 Miss Wheeler

Evolution Part 1. Unit 10 Miss Wheeler Evolution Part 1 Unit 10 Miss Wheeler Evolution Evolution- The process by which organisms have changed (and will continue changing) over time Charles Darwin- Father of Evolution Traveled for 5 years on

More information

European Medicines Agency

European Medicines Agency European Medicines Agency July 1996 CPMP/ICH/139/95 ICH Topic Q 5 B Quality of Biotechnological Products: Analysis of the Expression Construct in Cell Lines Used for Production of r-dna Derived Protein

More information

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins

More information

DNA Insertions and Deletions in the Human Genome. Philipp W. Messer

DNA Insertions and Deletions in the Human Genome. Philipp W. Messer DNA Insertions and Deletions in the Human Genome Philipp W. Messer Genetic Variation CGACAATAGCGCTCTTACTACGTGTATCG : : CGACAATGGCGCT---ACTACGTGCATCG 1. Nucleotide mutations 2. Genomic rearrangements 3.

More information