cd NA Cloning and sequence analysis of the f ull2length cd NA encoding defensin, an antimicrobial peptide from the housefly ( M usca domestica)
|
|
- Lenard Lloyd
- 7 years ago
- Views:
Transcription
1 49 (3) : A cta Zoologica S inica 3 cd NA 33 ( ) Cloning and sequence analysis of the f ull2length cd NA encoding defensin an antimicrobial peptide from the housefly ( M usca domestica) WAN G Lai2Cheng WAN G Jin2Xing WAN G Lai2Yuan ZHAO Xiao2Fan ( School of L if e Science S handong U niversity Ji nan Chi na) Abstract Defensin is a kind of cationic inducible antimicrobial peptide found in a large range of living organisms that contributes to host defense by disrupting the cytoplasmic membrane of microorganisms. With their broad antimicrobial spectrum and strong pharmaceutical effects antimicrobial peptides including defensins represent a source of novel antibi2 otic agents. A novel full2length 430 base pairs cdna of an insect defensin was cloned using polymerase chain reaction ( PCR) from the cdna library of houseflies ( M usca domestica) that had been challenged by E. coli and S taphylococcus aureus. Sequence analysis revealed that the open reading frame of the cdna encoded a 922amino acid peptide which con2 tained an NH 2 2terminal signal sequence (1-22) followed by a propeptide and the mature peptide (53-92). quence identity with other insect defensin is between 51 % and 73 %. The se2 The mature peptide with a predicted molecular weight of 410 kda and p I of 8169 has 1 negative charged amino acid and 4 positice ones. The putative housefly defensin is characterized by 6 invariant cysteine residues forming 3 disulfide bonds Cys12Cys4 Cys22Cys5 and Cys32Cys6. These results suggest that the novel full2length cdna of the defensin gene denominated M dde has been successfully cloned from houseflies [ Acta Zoologica Sinica 49 (3) : ]. Key words Housefly ( M usca domestica) defensin PCR cdna library cdna (Bulet et al. 1999) ( Hoffmann 1995) : (1) ( Hyalophora ce2 ; (2) ( cropia) ) (Drosomysin) ; (3) (Cecropin) ( Hultmark et al. 1980) 500 ( Za2 (Apidaecin) sloff 2002 ) 170 (Abaecins) ( GG ) ( ) ( ) [ This research was funded by grants from the Foundation for Skeleton Staffs of Universities in China ( GG ) Special Foundation for the Doctorship Education ( ) and Foundation of Department of Science and Technolo2 gy of Shandong Province ( ) ] : A Y ( The nucleotide sequence reported in this paper has been submitted to GenBank with ac2 cession number A Y260152) 33 (Corresponding author). E2mail : edu. cn 24 : ν 2003 Acta Zoologica Sinica
2 3 : cdna ( Gloverins) ( Attacins) ( Di2 marcq et al. 1998) ; cdna PCR ( 1999) ( In2 3 5 sect defensins) cdna ( ) 111 (Zasloff 2002) ( M usca domestica) ( S taphylococcus aureus) ; 24 h RNA 112 Taq DNA Pst ( DL2000 DNA Marker Ta KaRa ; UN IQ ) Column DNA Gel Extraction Kit pucm2t Vector ; ( 1992) 113 RNA gt11 cd NA ( 2001 a b) 114 ( 2001) GenBank 5 ( Drosophila) 7 (Rutschmann et al. 2000) MddeF1 MddeR ; ( E. coli ) 115 PCR gt11 cdna MddeF1 MddeR1 PCR : 94 2 min ; s s s 35 ; min PCR : 2 % PCR 116 PCR UN IQ25 Column DNA Gel Extraction Kit (Sangon) PCR pucm2t Vector ( Sangon) PCR pucm2t E. coli DH5 3 Pst Sangon ( )
3 cdna Fig11 Cloning the full2length cdna of defensin from Musca domestica a. PCR 119 bp cdna [cdna fragment (119 bp) of defensin amplified by PCR using primers of MddeF1 and R1 ] b. 3 PCR 253 bp cdna [ Defensin cdna fragment ( 253 bp) including 3 2end untranslated nucleotides amplified by PCR using primers MddeF2 and gtr] primer and specific primer MdeR2 ] NA fragments] c. 5 PCR 352 bp cdna [ 5 2end cdna fragment (352 bp) amplified by PCR using adapter d. 430bp cdna [ Full2length cdna (430 bp) from overlapping of three cd2 M : DL2000 DNA Marker [Lane show amplification results of PCR and lane show the results of negative control of PCR] 117 cd NA 3 5 PCR 119 bp cdna (BLAST) ( http : / / www. ncbi. nlm. nih. gov/ ) 70 % Blastx ( nr) cdna MddeF2 ; ExPASy ( http : / / www. MddeR2 cdna MddeF2 5 GCC ACG TGC GA T TTG TTG A GC 3 MddeR2 5 AC GCA GAC A GC CTT GCC A TT G 3 3 PCR : cdna MddeF2 gt bp gt R PCR 119 bp ( 1a) Blastx : 94 2 min ; s s s 35 ; min 5 ( S arcophaga peregri na) ( Yamada et al. 1994) PCR : cdna 94 % cdna (5 2AA TTCGCGGCCGCT2 3 ) MddeR cd NA PCR Internet NCB I expasy. org/ ) PCR MddeF1 R1 cdna cdna cdna MddeF2
4 3 : cdna cdna Fig12 cd NA and deduced amino acid sequences of defensin from Musca domestica ; ( TAA) Poly (A) (AATAAA) ; ( 3 ) ( TGA) ( TAA) ; [ The sequence of predicted mature peptide is underlined. The Poly ( A) signal ( AATAAA) and the stop codon ( TAA) are boxed. Asterisk ( 3 ) indicates the stop codon ( TGA) followed by the powerful stop codon ( TAA) at the same ORF. The nucleotide sequence is numbered on the left and the amino acid sequence is numbered from the first methionine on the right ] gt11 gt R PCR bp ( 1b) 253 bp 40 3 Poly (A) AA TAAA 3 ; 5 PCR 350 bp ( 1c) 352 bp A TG TAA 5 3 cdna 430 bp cdna ( 1 d) 279 bp kd C1 C4 C2 C5 C3 C6 ( 4) 8144 R A 40 ExPASy Di2 marcq et al. (1998) 3 N loop 1 2 2N loop ; ; kd 8169 ( G) 20 % 6 (C 15 %) 213 cd NA ( Hoffmann cdna ) NCB I Blastx cdna cdna 3 3 : mrna ( 90 % )
5 Fig13 Similarity analysis of deduced defensin amino acid sequence from Musca domestica and other insect defensins 5 - [ Five defensin pre2 cursors (phormicin precursor sapecin precursor defensin 2a defensin precursor of Stomoxys and defensin A precursor of Aedes) from GenBank were compared with defensin precursor of M usca domestica. Shadowed amino acids indicate the identity amino acid ; - was introduced for opti2 mized the alignment of the sequences] 45 ( Ganz et al. 1995) cdna 92 GenBank nestling2sucking blowfly ( Protophorm ia terraenov ae) 4 ( Phormicin precursor ) Fig14 The different structure domains of mature 73 % Phormicin A defensin from Musca domestica Phormicin B 97 % 94 % ( 3) 430 bp cdna 4 : ExPASy (1 22) ( Hoffmann et al. 1999) N 52 (Dimarcq et al. 1998) : (1) ( ) Dimarcq et al. (1998) CS (Drosomycin) ; (2) 2 3 : N loop 2 Thanatin Tachyplesins Androctonin ; 2 2 C 2 (3) ; (4) (C2 C5 C3 C6) N loop (C1 C4) ( Precursor) 19 N ExPASy 38
6 3 : cdna Science 284 : ( References) Bulet P. C. Hetru J. L. Dimarcq and D. A. Hoffmann 1999 Antimicrobial peptides in insects : structure and function. Dev. Com p. I m m unol. 23 (4 5) : Chen L. C. and J. X. Wang 1999 The antibacterial peptides from insects. Progress i n Biotechnology 19 (5) : [ X. F. Zhao 2001 Purification and characterization of an an2 tibacterial peptide from housefly M usca domestica. Journal of S handong U niversity ( Science Edition) 36 (3) : [ ( ) 36 (3) : ] Dimarcq J. L. P. Bulet C. Hetru and J. Hoffmann 1998 Cys2 teine2rich antimicrobial peptides in invertebrates. ( Pepti de Science) 47 : Biopolymers Ganz T. and R. I. Lehrer 1995 Defensins. Pharmac. Ther. 66 : Hoffmann J. A Innate immunity of insect. ion i n I m m unology 7 : Current Opi n2 Hoffmann J. A Immune responsiveness in vector insects. Proc. N atl. Acad. Sci. USA 94 : Hoffmann J. A. F. C. Kafatos C. A. Janeway and R. A. B. Ezekowitz 1999 Phylogenetic perspectives in innate immunity. Hultmark D. H. Steiner T. Rasmuson and H. G. Boman 1980 Purification and properties of three inducible bactericidal proteins from hemolymph of immunized pupae of Eur. J. Biochem. 106 : Hyalophora cecropia. Rutschmann S. A. C. J ung R. Zhou N. Silverman J. A. Hoff2 mann and D. Ferrandon 2000 Role of Drosophila IKK in a Toll2independent antibacterial immune response. Nat ure Im2 m unology 1 (4) : Wang J. H. and C. Z. Qu 2000 Progress in insect antimicrobial peptides. Chinese Journal of Vector Biology and Cont rol 11 (5) : [ (5) : ] Wang L. Y. J. X. Wang X. F. Zhao and L. C. Wang 2001a The improved method for the isolation of house fly total RNA. (5) : ] Sichuan J. of Zoology 20 (2) : [ Chen L. C. J. X. Wang Y. Liu L. Y. Wang L. C. Wang and 2001 RNA. 20 (2) : ] Wang L. Y. J. X. Wang X. F. Zhao and L. C. Wang 2001b Construction of cdna library of housefly ( M usca domestica). ological Research 22 (2) : [ 2001 cdna. 22 (2) : ] Wang Y. C. W. Liu and F. Yang 1992 Abstraction of hemolymph of house fly and the inducing of its antibacterial matter. Acta Microbiologica Si nica 32 (6) : [ (6) : ] Yamada K. and S. Natori 1994 Characterization of the antimicro2 Zo2 bial peptide derived from sapecin B an antibacterial protein of S ar2 cophaga peregri na (flesh fly). Biochem. J. 298 : Zasloff M Antimicrobial peptides of multicellular organisms. N at ure 415 :
pcas-guide System Validation in Genome Editing
pcas-guide System Validation in Genome Editing Tagging HSP60 with HA tag genome editing The latest tool in genome editing CRISPR/Cas9 allows for specific genome disruption and replacement in a flexible
More informationGENEWIZ, Inc. DNA Sequencing Service Details for USC Norris Comprehensive Cancer Center DNA Core
DNA Sequencing Services Pre-Mixed o Provide template and primer, mixed into the same tube* Pre-Defined o Provide template and primer in separate tubes* Custom o Full-service for samples with unknown concentration
More informationJust the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
More informationIntroduction to Bioinformatics 3. DNA editing and contig assembly
Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 matthewb@ba.ars.usda.gov
More informationBioinformatics Resources at a Glance
Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences
More informationMolecular Genetics. RNA, Transcription, & Protein Synthesis
Molecular Genetics RNA, Transcription, & Protein Synthesis Section 1 RNA AND TRANSCRIPTION Objectives Describe the primary functions of RNA Identify how RNA differs from DNA Describe the structure and
More informationRecombinant DNA & Genetic Engineering. Tools for Genetic Manipulation
Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna
More informationGene Expression Assays
APPLICATION NOTE TaqMan Gene Expression Assays A mpl i fic ationef ficienc yof TaqMan Gene Expression Assays Assays tested extensively for qpcr efficiency Key factors that affect efficiency Efficiency
More informationRecombinant DNA Unit Exam
Recombinant DNA Unit Exam Question 1 Restriction enzymes are extensively used in molecular biology. Below are the recognition sites of two of these enzymes, BamHI and BclI. a) BamHI, cleaves after the
More information13.2 Ribosomes & Protein Synthesis
13.2 Ribosomes & Protein Synthesis Introduction: *A specific sequence of bases in DNA carries the directions for forming a polypeptide, a chain of amino acids (there are 20 different types of amino acid).
More informationGenBank, Entrez, & FASTA
GenBank, Entrez, & FASTA Nucleotide Sequence Databases First generation GenBank is a representative example started as sort of a museum to preserve knowledge of a sequence from first discovery great repositories,
More informationA novel pig gene, CPNE1, differentially expressed in the muscle tissues from Wujin pigs and Large White pigs*
Animal Science Papers and Reports vol. 30 (2012) no. 2, 131-138 Institute of Genetics and Animal Breeding, Jastrzębiec, Poland A novel pig gene, CPNE1, differentially expressed in the muscle tissues from
More information2006 7.012 Problem Set 3 KEY
2006 7.012 Problem Set 3 KEY Due before 5 PM on FRIDAY, October 13, 2006. Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. Which reaction is catalyzed by each
More informationBio 102 Practice Problems Recombinant DNA and Biotechnology
Bio 102 Practice Problems Recombinant DNA and Biotechnology Multiple choice: Unless otherwise directed, circle the one best answer: 1. Which of the following DNA sequences could be the recognition site
More informationSTUDIES ON SEED STORAGE PROTEINS OF SOME ECONOMICALLY MINOR PLANTS
STUDIES ON SEED STORAGE PROTEINS OF SOME ECONOMICALLY MINOR PLANTS THESIS SUBMITTED FOR THE DEGREB OF DOCTOR OF PHILOSOPHY (SCIENCE) OF THE UNIVERSITY OF CALCUTTA 1996 NRISINHA DE, M.Sc DEPARTMENT OF BIOCHEMISTRY
More informationIIID 14. Biotechnology in Fish Disease Diagnostics: Application of the Polymerase Chain Reaction (PCR)
IIID 14. Biotechnology in Fish Disease Diagnostics: Application of the Polymerase Chain Reaction (PCR) Background Infectious diseases caused by pathogenic organisms such as bacteria, viruses, protozoa,
More information2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three
Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,
More informationImproved methods for site-directed mutagenesis using Gibson Assembly TM Master Mix
CLONING & MAPPING DNA CLONING DNA AMPLIFICATION & PCR EPIGENETICS RNA ANALYSIS Improved methods for site-directed mutagenesis using Gibson Assembly TM Master Mix LIBRARY PREP FOR NET GEN SEQUENCING PROTEIN
More informationBacReady TM Multiplex PCR System
BacReady TM Multiplex PCR System Technical Manual No. 0191 Version 10112010 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI Detailed Experimental
More informationFrom DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains
Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes
More informationProtein Synthesis How Genes Become Constituent Molecules
Protein Synthesis Protein Synthesis How Genes Become Constituent Molecules Mendel and The Idea of Gene What is a Chromosome? A chromosome is a molecule of DNA 50% 50% 1. True 2. False True False Protein
More informationRecombinant DNA Technology
Recombinant DNA Technology Dates in the Development of Gene Cloning: 1965 - plasmids 1967 - ligase 1970 - restriction endonucleases 1972 - first experiments in gene splicing 1974 - worldwide moratorium
More informationRT-PCR: Two-Step Protocol
RT-PCR: Two-Step Protocol We will provide both one-step and two-step protocols for RT-PCR. We recommend the twostep protocol for this class. In the one-step protocol, the components of RT and PCR are mixed
More informationMs. Campbell Protein Synthesis Practice Questions Regents L.E.
Name Student # Ms. Campbell Protein Synthesis Practice Questions Regents L.E. 1. A sequence of three nitrogenous bases in a messenger-rna molecule is known as a 1) codon 2) gene 3) polypeptide 4) nucleotide
More informationTIANquick Mini Purification Kit
TIANquick Mini Purification Kit For purification of PCR products, 100 bp to 20 kb www.tiangen.com TIANquick Mini Purification Kit (Spin column) Cat no. DP203 Kit Contents Contents Buffer BL Buffer PB Buffer
More informationVector NTI Advance 11 Quick Start Guide
Vector NTI Advance 11 Quick Start Guide Catalog no. 12605050, 12605099, 12605103 Version 11.0 December 15, 2008 12605022 Published by: Invitrogen Corporation 5791 Van Allen Way Carlsbad, CA 92008 U.S.A.
More informationPrimeSTAR HS DNA Polymerase
Cat. # R010A For Research Use PrimeSTAR HS DNA Polymerase Product Manual Table of Contents I. Description...3 II. III. IV. Components...3 Storage...3 Features...3 V. General Composition of PCR Reaction
More informationCoding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein
Assignment 3 Michele Owens Vocabulary Gene: A sequence of DNA that instructs a cell to produce a particular protein Promoter a control sequence near the start of a gene Coding sequence the sequence of
More informationHiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
More informationMolecular analyses of EGFR: mutation and amplification detection
Molecular analyses of EGFR: mutation and amplification detection Petra Nederlof, Moleculaire Pathologie NKI Amsterdam Henrique Ruijter, Ivon Tielen, Lucie Boerrigter, Aafke Ariaens Outline presentation
More informationFirst Strand cdna Synthesis
380PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name First Strand cdna Synthesis (Cat. # 786 812) think proteins! think G-Biosciences
More informationIntroduction to Genome Annotation
Introduction to Genome Annotation AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT
More informationTitle : Parallel DNA Synthesis : Two PCR product from one DNA template
Title : Parallel DNA Synthesis : Two PCR product from one DNA template Bhardwaj Vikash 1 and Sharma Kulbhushan 2 1 Email: vikashbhardwaj@ gmail.com 1 Current address: Government College Sector 14 Gurgaon,
More informationA Multiple DNA Sequence Translation Tool Incorporating Web Robot and Intelligent Recommendation Techniques
Proceedings of the 2007 WSEAS International Conference on Computer Engineering and Applications, Gold Coast, Australia, January 17-19, 2007 402 A Multiple DNA Sequence Translation Tool Incorporating Web
More informationCCR Biology - Chapter 9 Practice Test - Summer 2012
Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible
More informationTroubleshooting the Single-step PCR Site-directed Mutagenesis Procedure Intended to Create a Non-functional rop Gene in the pbr322 Plasmid
Troubleshooting the Single-step PCR Site-directed Mutagenesis Procedure Intended to Create a Non-functional rop Gene in the pbr322 Plasmid Lina Jew Department of Microbiology & Immunology, University of
More informationTranscription and Translation of DNA
Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes
More informationUNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet
1 UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet Exam in: MBV4010 Arbeidsmetoder i molekylærbiologi og biokjemi I MBV4010 Methods in molecular biology and biochemistry I Day of exam:.
More informationMitochondrial DNA Analysis
Mitochondrial DNA Analysis Lineage Markers Lineage markers are passed down from generation to generation without changing Except for rare mutation events They can help determine the lineage (family tree)
More informationGenScript BloodReady TM Multiplex PCR System
GenScript BloodReady TM Multiplex PCR System Technical Manual No. 0174 Version 20040915 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI
More informationLabGenius. Technical design notes. The world s most advanced synthetic DNA libraries. hi@labgeni.us V1.5 NOV 15
LabGenius The world s most advanced synthetic DNA libraries Technical design notes hi@labgeni.us V1.5 NOV 15 Introduction OUR APPROACH LabGenius is a gene synthesis company focussed on the design and manufacture
More informationSERVICES CATALOGUE WITH SUBMISSION GUIDELINES
SERVICES CATALOGUE WITH SUBMISSION GUIDELINES 3921 Montgomery Road Cincinnati, Ohio 45212 513-841-2428 www.agctsequencing.com CONTENTS Welcome Dye Terminator Sequencing DNA Sequencing Services - Full Service
More informationMATCH Commun. Math. Comput. Chem. 61 (2009) 781-788
MATCH Communications in Mathematical and in Computer Chemistry MATCH Commun. Math. Comput. Chem. 61 (2009) 781-788 ISSN 0340-6253 Three distances for rapid similarity analysis of DNA sequences Wei Chen,
More informationBio-Reagents Gene synthesis Peptide Synthesis Protein Expression Antibody Production. Life Science Products and Services
Bio-Reagents Gene synthesis Peptide Synthesis Protein Expression Antibody Production Life Science Products and Services Since 2002, Biomatik has provided worldwide researchers in life science discovery
More informationLecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides
Lecture Series 7 From DNA to Protein: Genotype to Phenotype Reading Assignments Read Chapter 7 From DNA to Protein A. Genes and the Synthesis of Polypeptides Genes are made up of DNA and are expressed
More informationSickle cell anemia: Altered beta chain Single AA change (#6 Glu to Val) Consequence: Protein polymerizes Change in RBC shape ---> phenotypes
Protein Structure Polypeptide: Protein: Therefore: Example: Single chain of amino acids 1 or more polypeptide chains All polypeptides are proteins Some proteins contain >1 polypeptide Hemoglobin (O 2 binding
More informationLecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology
Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,
More informationHCS604.03 Exercise 1 Dr. Jones Spring 2005. Recombinant DNA (Molecular Cloning) exercise:
HCS604.03 Exercise 1 Dr. Jones Spring 2005 Recombinant DNA (Molecular Cloning) exercise: The purpose of this exercise is to learn techniques used to create recombinant DNA or clone genes. You will clone
More informationPCR & DNA Sequencing. PCR= Polymerase Chain Reaction. PCR applications
PCR= Polymerase Chain Reaction PCR & DNA Sequencing Biology 224 Instructor: Tom Peavy March 20, 2006 DNA photocopier integral tool for molecular biologists work horse versatile (many applications) not
More informationrestriction enzymes 350 Home R. Ward: Spring 2001
restriction enzymes 350 Home Restriction Enzymes (endonucleases): molecular scissors that cut DNA Properties of widely used Type II restriction enzymes: recognize a single sequence of bases in dsdna, usually
More informationName Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in
DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results
More informationSanger Sequencing. Troubleshooting Guide. Failed sequence
Sanger Sequencing Troubleshooting Guide Below are examples of the main problems experienced in ABI Sanger sequencing. Possible causes for failure and their solutions are listed below each example. The
More informationDetection of RNA variants transcribed from the transgene in Roundup Ready soybean
Eur Food Res Technol (2005) 220:438 443 DOI 10.1007/s00217-004-1064-5 ORIGINAL PAPER Andreas Rang Bettina Linke Bärbel Jansen Detection of RNA variants transcribed from the transgene in Roundup Ready soybean
More informationName Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.
13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both
More informationBecker Muscular Dystrophy
Muscular Dystrophy A Case Study of Positional Cloning Described by Benjamin Duchenne (1868) X-linked recessive disease causing severe muscular degeneration. 100 % penetrance X d Y affected male Frequency
More information1/12 Dideoxy DNA Sequencing
1/12 Dideoxy DNA Sequencing Dideoxy DNA sequencing utilizes two steps: PCR (polymerase chain reaction) amplification of DNA using dideoxy nucleoside triphosphates (Figures 1 and 2)and denaturing polyacrylamide
More informationINTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS
More informationData Analysis for Ion Torrent Sequencing
IFU022 v140202 Research Use Only Instructions For Use Part III Data Analysis for Ion Torrent Sequencing MANUFACTURER: Multiplicom N.V. Galileilaan 18 2845 Niel Belgium Revision date: August 21, 2014 Page
More informationSequence Formats and Sequence Database Searches. Gloria Rendon SC11 Education June, 2011
Sequence Formats and Sequence Database Searches Gloria Rendon SC11 Education June, 2011 Sequence A is the primary structure of a biological molecule. It is a chain of residues that form a precise linear
More informationExpression and Purification of Recombinant Protein in bacteria and Yeast. Presented By: Puspa pandey, Mohit sachdeva & Ming yu
Expression and Purification of Recombinant Protein in bacteria and Yeast Presented By: Puspa pandey, Mohit sachdeva & Ming yu DNA Vectors Molecular carriers which carry fragments of DNA into host cell.
More informationUnderstanding the immune response to bacterial infections
Understanding the immune response to bacterial infections A Ph.D. (SCIENCE) DISSERTATION SUBMITTED TO JADAVPUR UNIVERSITY SUSHIL KUMAR PATHAK DEPARTMENT OF CHEMISTRY BOSE INSTITUTE 2008 CONTENTS Page SUMMARY
More informationMolecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION
Molecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION Susan Carson Heather B. Miller D.Scott Witherow ELSEVIER AMSTERDAM BOSTON HEIDELBERG LONDON NEW YORK OXFORD PARIS SAN DIEGO SAN
More informationDNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!
DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other
More information(http://genomes.urv.es/caical) TUTORIAL. (July 2006)
(http://genomes.urv.es/caical) TUTORIAL (July 2006) CAIcal manual 2 Table of contents Introduction... 3 Required inputs... 5 SECTION A Calculation of parameters... 8 SECTION B CAI calculation for FASTA
More informationRETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison
RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the
More informationNucleic Acid Techniques in Bacterial Systematics
Nucleic Acid Techniques in Bacterial Systematics Edited by Erko Stackebrandt Department of Microbiology University of Queensland St Lucia, Australia and Michael Goodfellow Department of Microbiology University
More informationDNA Sample preparation and Submission Guidelines
DNA Sample preparation and Submission Guidelines Requirements: Please submit samples in 1.5ml microcentrifuge tubes. Fill all the required information in the Eurofins DNA sequencing order form and send
More informationThe Steps. 1. Transcription. 2. Transferal. 3. Translation
Protein Synthesis Protein synthesis is simply the "making of proteins." Although the term itself is easy to understand, the multiple steps that a cell in a plant or animal must go through are not. In order
More informationTransfection-Transfer of non-viral genetic material into eukaryotic cells. Infection/ Transduction- Transfer of viral genetic material into cells.
Transfection Key words: Transient transfection, Stable transfection, transfection methods, vector, plasmid, origin of replication, reporter gene/ protein, cloning site, promoter and enhancer, signal peptide,
More informationBiological Sequence Data Formats
Biological Sequence Data Formats Here we present three standard formats in which biological sequence data (DNA, RNA and protein) can be stored and presented. Raw Sequence: Data without description. FASTA
More information1. Molecular computation uses molecules to represent information and molecular processes to implement information processing.
Chapter IV Molecular Computation These lecture notes are exclusively for the use of students in Prof. MacLennan s Unconventional Computation course. c 2013, B. J. MacLennan, EECS, University of Tennessee,
More information2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.
1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence
More informationhttp://www.life.umd.edu/grad/mlfsc/ DNA Bracelets
http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets by Louise Brown Jasko John Anthony Campbell Jack Dennis Cassidy Michael Nickelsburg Stephen Prentis Rohm Objectives: 1) Using plastic beads, construct
More informationAll-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna
All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna All-in-One TM mirna First-Strand cdna Synthesis Kit AMRT-0020 (20 RT reactions), AMRT-0060 (60 RT reactions) Used in combination
More informationMGC premier full length cdna and ORF clones
MGC premier full length cdna and ORF clones TCH1003, TCM1004, TCR1005, TCB1006, TCL1007, TCT1008, TCZ1009, TOH6003, TOM6004, TOZ6009, TCHS1003, TCMS1004, TCRS1005, TCBS1006, TCLS1007, TCTS1008 MGC premier
More informationHow many of you have checked out the web site on protein-dna interactions?
How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss
More informationAmazing DNA facts. Hands-on DNA: A Question of Taste Amazing facts and quiz questions
Amazing DNA facts These facts can form the basis of a quiz (for example, how many base pairs are there in the human genome?). Students should be familiar with most of this material, so the quiz could be
More informationBio 102 Practice Problems Genetic Code and Mutation
Bio 102 Practice Problems Genetic Code and Mutation Multiple choice: Unless otherwise directed, circle the one best answer: 1. Beadle and Tatum mutagenized Neurospora to find strains that required arginine
More informationDNA Sequencing Troubleshooting Guide
DNA Sequencing Troubleshooting Guide Successful DNA Sequencing Read Peaks are well formed and separated with good quality scores. There is a small area at the beginning of the run before the chemistry
More informationPreciseTM Whitepaper
Precise TM Whitepaper Introduction LIMITATIONS OF EXISTING RNA-SEQ METHODS Correctly designed gene expression studies require large numbers of samples, accurate results and low analysis costs. Analysis
More informationGENE CONSTRUCTION KIT 4
GENE CONSTRUCTION KIT 4 Tutorials & User Manual from Textco BioSoftware, Inc. September 2012, First Edition Gene Construction Kit 4 Manual is Copyright Textco Bio- Software, Inc. 2003-2012. All rights
More informationEU Reference Laboratory for E. coli Department of Veterinary Public Health and Food Safety Unit of Foodborne Zoonoses Istituto Superiore di Sanità
Identification and characterization of Verocytotoxin-producing Escherichia coli (VTEC) by Real Time PCR amplification of the main virulence genes and the genes associated with the serogroups mainly associated
More informationRecombinant DNA and Biotechnology
Recombinant DNA and Biotechnology Chapter 18 Lecture Objectives What Is Recombinant DNA? How Are New Genes Inserted into Cells? What Sources of DNA Are Used in Cloning? What Other Tools Are Used to Study
More informationGene Synthesis 191. Mutagenesis 194. Gene Cloning 196. AccuGeneBlock Service 198. Gene Synthesis FAQs 201. User Protocol 204
Gene Synthesis 191 Mutagenesis 194 Gene Cloning 196 AccuGeneBlock Service 198 Gene Synthesis FAQs 201 User Protocol 204 Gene Synthesis Overview Gene synthesis is the most cost-effective way to enhance
More information2. Are there any chaperones such as GroES, GroEL, and DnaK..etc added into the solution A or solution B in the kit?
GENERAL 1. What are the MW limits of proteins that can be produced by PURExpress? 2. Are there any chaperones such as GroES, GroEL, and DnaK..etc added into the solution A or solution B in the kit? 3.
More informationptune Inducible Vector
ptune Inducible Vector Application Guide Table of Contents Package contents and Storage Conditions:...2 Related products:...2 Introduction...2 Figure 1. Schematic Diagrams of ptune Inducible vector...3
More informationDNA sequencing. Dideoxy-terminating sequencing or Sanger dideoxy sequencing
DNA sequencing Dideoxy-terminating sequencing or Sanger dideoxy sequencing Tools DNA template (single stranded) Specific primer (usually 17-23 mer, free 3 -OH) dntps DNA polymerase capacity of polymerizing
More informationInnate Immunity. Insects rely solely on an innate immune system for defense against infection
Innate Immunity Insects rely solely on an innate immune system for defense against infection The importance of mammalian innate immunity has only recently become appreciated The innate immune response
More informationGenetics Lecture Notes 7.03 2005. Lectures 1 2
Genetics Lecture Notes 7.03 2005 Lectures 1 2 Lecture 1 We will begin this course with the question: What is a gene? This question will take us four lectures to answer because there are actually several
More informationGlobal MicroRNA Amplification Kit
Global MicroRNA Amplification Kit Store kit at -20 C on receipt (ver. 3-060901) A limited-use label license covers this product. By use of this product, you accept the terms and conditions outlined in
More informationIntegrated Protein Services
Integrated Protein Services Custom protein expression & purification Version DC04-0012 Expression strategy The first step in the recombinant protein generation process is to design an appropriate expression
More informationConcluding lesson. Student manual. What kind of protein are you? (Basic)
Concluding lesson Student manual What kind of protein are you? (Basic) Part 1 The hereditary material of an organism is stored in a coded way on the DNA. This code consists of four different nucleotides:
More informationID of alternative translational initiation events. Description of gene function Reference of NCBI database access and relative literatures
Data resource: In this database, 650 alternatively translated variants assigned to a total of 300 genes are contained. These database records of alternative translational initiation have been collected
More informationSystematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals
Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals Xiaohui Xie 1, Jun Lu 1, E. J. Kulbokas 1, Todd R. Golub 1, Vamsi Mootha 1, Kerstin Lindblad-Toh
More informationOverview of Eukaryotic Gene Prediction
Overview of Eukaryotic Gene Prediction CBB 231 / COMPSCI 261 W.H. Majoros What is DNA? Nucleus Chromosome Telomere Centromere Cell Telomere base pairs histones DNA (double helix) DNA is a Double Helix
More informationGene Models & Bed format: What they represent.
GeneModels&Bedformat:Whattheyrepresent. Gene models are hypotheses about the structure of transcripts produced by a gene. Like all models, they may be correct, partly correct, or entirely wrong. Typically,
More informationEuropean Medicines Agency
European Medicines Agency July 1996 CPMP/ICH/139/95 ICH Topic Q 5 B Quality of Biotechnological Products: Analysis of the Expression Construct in Cell Lines Used for Production of r-dna Derived Protein
More informationProvincial Exam Questions. 9. Give one role of each of the following nucleic acids in the production of an enzyme.
Provincial Exam Questions Unit: Cell Biology: Protein Synthesis (B7 & B8) 2010 Jan 3. Describe the process of translation. (4 marks) 2009 Sample 8. What is the role of ribosomes in protein synthesis? A.
More informationCloning Blunt-End Pfu DNA Polymerase- Generated PCR Fragments into pgem -T Vector Systems
Promega Notes Number 71, 1999, p. 10 Blunt-End Pfu DNA Polymerase- Generated PCR Fragments into pgem -T Vector Systems By Kimberly Knoche, Ph.D., and Dan Kephart, Ph.D. Promega Corporation Corresponding
More information