Flt3-ITD, NPM1 and CEBPα mutation detection in AML

Transcription

1 Flt3-ITD, NPM1 and CEBPα mutation detection in AML a collaborative diagnostic assay setup Friedel Nollet, Ph.D., AZ Sint-Jan Brugge-Oostende AV

2 Acute Myeloïd Leukemia

3 AML subgroups (WHO2008 classification) AML with recurrent genetic abnormalities AML with t(8;21) AML1/ETO AML with inv(16) CBFB/MYH11 APL with t(15;17) PML/RARa AML with t(9;11) MLLT3/MLL (==MLL/AF9) AML with t(6;9) DEK/NUP214 (==DEK/CAN) AML with inv(3) ot t(3;3) RPN-EVI1 AML with t(1;22) RBM1/MKL1 Provisional AML with mutated NPM1 Provisional AML with mutated CEBPa AML with myelodysplasie-related changes AML, NOS Myeloid sarcoma Myeloid proliferations related to Down Syndrome Blastic plasmacytoid dendritic cell neoplasm AML molecular prognostic markers All AML CN-AML (45%) Outcome Flt3-ITD 15%-25% 25%-35% Adverse NPM1 25%-35% 45%-60% Favorable CEBPa 5%-15% 10%-20% Favorable

4 Flt3 mutations in AML TKD D835

5 Nucleophosmin-1 mutations in AML * Falini, B. et al. NEJM 2005; 352:

6 CEBPα mutations in AML Green et al., 2010, JCO 28(16)

7 Double CEBPα mutations Wouters et al., Blood (2009) 113:

8 Participating Centres ULB Erasme, Hakim El Housni Jesse Ziekenhuis, Hasselt, Femke Hillen, Brigitte Maes Institut de Pathology et de Genetique, Gosselies, Pascal Vannuffel UZBrussel, Marleen Bakkus CHU University de Liège, Frédéric Lambert Ziekenhuis Netwerk Antwerpen, Pieter Deschouwer, Annemie Celens AZ Sint-Jan, Brugge, Friedel Nollet, Johan Billiet UZGent, Barbara Denys UZLeuven, Hilde Vranckx, Wim De Kelver Heilig Hart Ziekenhuis Roeselare, Elke Boone St-Augustinus, Antwerpen, Philippe van Lint.

9 Primer selection

10 1: Biotechniques Jun;20(6):1004-6, Modulation of non-templated nucleotide addition by Taq DNA polymerase: primer modifications that facilitate genotyping. Brownstein MJ, Carpten JD, Smith JR. Taq DNA polymerase can catalyze non-templated addition of a nucleotide (principally adenosine) to the 3' end of PCR-amplified products. Recently, we showed that this activity, which is primer-specific, presents a potential source of error in genotyping studies based on the use of short tandem repeat (STR) markers. Furthermore, in reviewing our data, we found that non-templated nucleotide addition adjacent to a 3' terminal C is favored and that addition adjacent to a 3' terminal A is not. It was clear, however, that features of the template in addition to the 3' terminal base also affect the fraction of product adenylated. To define consensus sequences that promote or inhibit product adenylation, we transplanted sequences between the 5' ends of the reverse primers of markers that are adenylated and those of markers that are not adenylated. It proved difficult to identify a single sequence capable of protecting the products of all markers from non-templated addition of nucleotide. On the other hand, placing the sequence GTTTCTT on the 5' end of reverse primers resulted in nearly 100% adenylation of the 3' end of the forward strand. This modification or related ones (called "PIG-tailing") should facilitate accurate genotyping and efficient T/A cloning.

11 PCR optimisation F. Nollet, AZ Sint Jan, Brugge

12 Singleplex or multiplex genescan TAD1 TAD2 bzip NPM1 FLT3-ITD TAD1 + TAD2 TAD2 wt TAD1 wt + 5bp bzip + NPM1 + FLT3 bzip wt NPM1 wt + 4bp FLT3 wt M. Bakkus, UZBrussel

13 1bp resolutie gctttc gctttcc: M. Bakkus, UZBrussel

14 Example of Multiplex GeneScan NPM1 +4bp NPM1 wild type Flt3 wild type Flt3-ITD bzip TAD2 TAD2 wild type TAD2 +5bp F. Nollet, AZ Sint Jan, Brugge

15 NPM : actctctggtggtagaatgaaaaatagatgttgaactatgcaaagagaca tttaatttattgatgtctatgaagtgttgtggttccttaaccacatttct ttttttttttttccaggctattcaagatctctggcagtggaggaagtctc tttaagaaaatagtttaaacaatttgttaaaaaattttccgtcttatttc atttctgtaacagttgatatctggctgtcctttttataatgcagagtgag aactttccctaccgtgtttgataaatgttgtccaggttctattgccaaga atgtgttgtccaaaatgcc

16

17 Interrun

18 Flt3-ITD RNA versus DNA Conclusion : sensitivity Flt3-ITD on DNA is ~5% on RNA ~1%

19 linearity and sensitivity Conclusion : semi-quantitative analysis sensitivity is ~ 5% (sensitivity of Flt3-ITD detection on RNA is ~1%)

20 Sample Exchange

21 Conclusions collaborative reflection upon strategy and primer selection for Flt3-ITD, NPM1 and CEBPα is rewarded by straightforward optimisation and setup de facto standardization of assay

22 THE END

23 Example Without LNA With LNA Hakim El Housni, ULB Erasme