Isolation and characterization of microsatellite markers from the greater ani. Crotophaga major (Aves: Cuculidae)

Size: px
Start display at page:

Download "Isolation and characterization of microsatellite markers from the greater ani. Crotophaga major (Aves: Cuculidae)"

Transcription

1 Page 1 of 9 Isolation and characterization of microsatellite markers from the greater ani Crotophaga major (Aves: Cuculidae) C. RIEHL * and S. M. BOGDANOWICZ * Department of Ecology and Evolutionary Biology, Princeton University, 106A Guyot Hall, Princeton, NJ 08544, USA Department of Migration and Immuno-ecology, Max Planck Institute for Ornithology, Schlossallee 2, Radolfzell, Germany Department of Ecology and Evolutionary Biology, Cornell University, E145 Corson Hall, Ithaca, NY 14853, USA Keywords: Crotophaga, Crotophaga major, greater ani, microsatellite Correspondence: Christina Riehl, Fax: criehl@princeton.edu

2 Page 2 of Abstract The greater ani (Crotophaga major) is a communally breeding cuckoo found in Panama and northern South America. We developed 12 polymorphic microsatellite loci in 227 individuals, with a mean of 6.2 alleles per locus (range 4 10) and a mean observed heterozygosity of 0.58 (range ). These markers will allow determination of mating patterns and reproductive success of individuals within communally breeding groups The greater ani (Crotophaga major) practices a rare form of cooperative breeding in which several unrelated females lay eggs in one nest. Breeding groups are composed of socially monogamous pairs; however, the genetic mating system of this species has not been determined. Microsatellite loci have previously been developed for two related species (C. ani, Blanchard & Quinn 2001; and Guira guira, Muniz et al. 2003), but these loci are monomorphic in C. major. Here we describe the development of twelve polymorphic microsatellite loci for C. major, which will be used to determine mating patterns and reproductive success of individuals in nesting groups. Genomic DNA from a nestling greater ani from Barro Colorado Island, Panama, was used to create a DNA library enriched for microsatellites using the ligation procedure of Hamilton et al. (1999), with modifications following Grant & Bogdanowicz (2006). Briefly, blunt-ended DNA fragments were created by digestion with BsaA I and Hinc II, then ligated to SNX linker sequences and enriched for microsatellite sequences by a biotin-capture method using streptavidin-coated magnetic beads. Three libraries were

3 Page 3 of enriched in parallel using the dimeric, trimeric, and tetrameric biotinylated oligonucleotide repeat units described in Barnett et al. (2007). Captured fragments were amplified by polymerase chain reaction (PCR) using a primer complementary to the SNX linker (DYAD thermal cycler, Bio-rad), digested with Nhe I to remove the linker, and ligated into Xba I -digested puc 19 plasmids. Recombinant molecules were electroporated into competent Escherichia coli cells and transformed bacteria were screened with a 33 P-labelled probe of the oligonucleotide sequences used in the enrichment (Grant & Bogdanowicz 2006). We used PCR with universal M13 primers to amplify plasmid DNA from positive clones, then sequenced the products with BigDye Terminator version 3.1 Cycle Sequencing chemistry and an automated 3730xl DNA Analyser (Applied Biosystems). We sequenced 272 clones and designed primer pairs to amplify 30 microsatellite loci using the program Primer3 (Rozen & Skaletsky 2000). Primer pairs from 25 loci were successfully optimized and tested for variability on a panel of 16 unrelated greater ani nestlings from different nesting groups from Gatún Lake, Panama. We then selected twelve polymorphic loci to genotype 227 individuals from the same population (Table 1). For the initial screening for polymorphism, fluorescently labeled PCR products were created using the universal tag method of Schuelke (2000) with the conditions described in Makarewich et al. (2009). A pigtail (5 -GTTTCT) was attached to the reverse primer to ensure complete adenylation of the amplification products (Brownstein et al. 1996). Each PCR reaction contained ng DNA, 10 mm Tris-HCl, 50 mm KCl, 1.5 mm MgCl 2, 0.12 pm of the locus-specific forward primer, 1.2 pm of the universal forward primer, 1.2 pm of the locus-specific reverse primer, 0.2 U Taq polymerase

4 Page 4 of (Sigma), 200 µm dntps (Invitrogen), and H 2 O to bring the final volume to10 µl. Amplifications consisted of an initial denaturation (95 C, 4 min); 35 cycles of denaturation (95 C, 45 s), annealing (locus-specific annealing temperature, 60 s), and extension (72 C, 60 s); and a final extension of 5 min at 72 C. For the expanded genotyping, we amplified multiple loci in the same PCR reaction ( multiplexing ). Each locus-specific forward primer was fluorescently labeled at the 5 end (6-FAM, PET, NED, or VIC; Applied Biosystems) and was used with the pigtailed locus-specific reverse primer as described above. PCR conditions were as described above, with the following changes: i) 0.25 U Taq polymerase; ii) 3.25 mm MgCl 2 ; and iii) primer concentrations varied from 1 to 3 pm to yield similar fluorescent signals. PCR products were sized on an ABI PRISM 3100 Genetic Analyser (Applied Biosystems) with a GeneScan-500 LIZ molecular weight standard (Applied Biosystems) and GeneMapper 3.7 software (Applied Biosystems). We used GenePop 3.4 (Raymond and Rousset 1995) and Cervus 3.0 (Kalinowski et al. 2007) to determine observed and expected heterozygosity levels, conformation to Hardy-Weinberg proportions, null allele frequencies, and gametic disequilibrium between locus pairs. The number of alleles per locus ranged from 4 to 10 (mean = 6.2) with observed heterozygosities ranging from 0.22 to 0.8 (mean = 0.58; Table 2). Tests for gametic disequilibrium were not statistically significant after a Bonferroni correction for multiple comparisons. One locus, CrMa4-1, was not in HWE and had an estimated null allele frequency of 0.3. This may be due to the presence of alleles larger than 500 base pairs and therefore undetectable using a 500-bp size standard; however, it is possible that this locus could still be useful in genotyping analyses when used with a larger size standard.

5 Page 5 of The markers developed here will be used to determine mating patterns and reproductive success of individuals within communal groups, and will allow comparison of extra-pair copulation rates and reproductive skew between C. major and its congeners References Barnett JR, Stenzler LM, Ruiz-Gutierrez V, Bogdanowicz SM, Lovette IJ (2007) Isolation and characterization of microsatellite markers from the white-ruffed manakin Corapipo altera (Aves, Pipridae). Molecular Ecology Resources, 8, Blanchard L, Quinn JS (2001) The characterization of microsatellite loci in the communally breeding smooth-billed ani (Crotophaga ani). Molecular Ecology Notes, 1, Brownstein MH, Carpten JD, Smith JR (1996) Modulation of nontemplated nucleotide addition by Taq DNA polymerase: primer modifications that facilitate genotyping. BioTechniques, 20, Grant JB, Bogdanowicz SM (2006) Isolation and characterization of microsatellite markers from the panic moth, Saucrobotys futilalis L. (Lepidoptera: Pyralidae: Pyraustinae). Molecular Ecology Notes, 6, Hamilton MB, Pincus EL, Difiore A, Fleischer RC (1999) Universal linker and ligation procedures for construction of genomic DNA libraries enriched for microsatellites. BioTechniques, 27, Kalinowski ST, Taper ML, Marshall TC (2007) Revising how the computer program

6 Page 6 of CERVUS accommodates genotyping error increases success in paternity assignment. Molecular Ecology, 16, Makarewich CA, Stenzler LM, Ferretti V, Winkler DW, Lovette IJ (2009) Isolation and characterization of microsatellite markers from three species of swallows in the genus Tachycineta: T. albilinea, T. bicolor and T. leucorrhoa. Molecular Ecology Resources, 9, Muniz LSB, Macedo RHF, Graves J (2003) Isolation and characterization of dinucleotide microsatellite loci in communally breeding Guira cuckoos (Aves: Cuculidae). Molecular Ecology Notes, 3, Raymond M, Rousset F (2004) GenePop Version Updated from Raymond & Rousset (1995) GenePop version 1.2: population genetics software for exact tests and ecumenicism. Journal of Heredity, 83, Rozen S, Skaletsky HJ (2000) Primer3 on the WWW for general users and for biologist programmers. In: Bioinformatics Methods and Protocols: Methods in Molecular Biology (eds. Krawetz S, Misener S), pp Humana Press, Totowa, NJ. Schuelke M (2000) An economic method for the fluorescent labeling of PCR fragments. Nature Biotechnology, 18, Acknowledgments We thank L. M. Stenzler, I. J. Lovette, and the Cornell Laboratory of Ornithology for assistance in microsatellite development and genotyping, and L. Jara for field assistance.

7 Page 7 of This work was supported by the Max Planck Institute for Ornithology, Princeton University, and a NSF Graduate Research Fellowship to C. Riehl

8 Page 8 of 9 Locus Table 1 Microsatellite loci developed in Crotophaga major Fluorescent Dye Label; Multiplex Combination Repeat Motif Primer Sequence (5 3 ) GenBank Accession no. CrMa3-27 VIC; 1 (CAA) 11 (TAA) 7 (CAAA) 5 F: GGTGCTTCCCAAACCTTAT R: TGCTTGTCATCCTCAAGTGG CrMa3-95 FAM; 1 (GTTT) 8 F: CATGCCTTGAACCCTGACTT R: GGGAGAATTCTTTTCCTTGGAC CrMa2-23 FAM; 2 (TC) 43 F: CAGTCTGAGGGAAGCCAAAT R: AAAACCAAACCAACACGAGAA CrMa2-24 PET; 2 (CA) 12 F: AGCAGAACTTTGCCCCTCTT R: ATGGCTGTCAAAATGCTGTG CrMa4-1 FAM; 3 (GAAA) 36 F: TTGCACAGGAAGAGTGGATG R: GTTGCACAGGAGGAAAAAGC CrMa4-6 FAM; 3 (GATA) 10 F: TTGCATGTATGGCATGAGGT R: TCTTCTGGCTGTGTGGATTTC CrMa3-25 VIC; 3 (CTT) 34 F: GTGGGAAAGCTTGAAGAGCA R: CAGAGGTTAAGCTCAAGGAAAA CrMa3-142 NED; 4 (GTT) 18 F: TCCAGTTCCACCTCCCACTA R: GGAAAGAATCTCAGCTTTTGCT CrMa3-37 PET; 4 (GAA) 14 (CAA) 6 (GAA) 15 F: TTCTTACTCTGCGACTGAGCAC R: GTGGGAAAGCTTGAAGAGCA CrMa3-45 VIC; 4 (GTT) 16 (GTTT) 4 F: AATGGTTCGGGTGTGAAGAG R: AGGGTCCAATTTCTGCAGTG CrMa3-8 PET; 5 (CAA) 17 F: AAGTGCCATACATGCTGCTG R: GCAGGTTCCAGTCATTGCTC CrMa3-104 NED; 5 (TAG) 5 CTG(TAG) 3 (GTT) 11 F: TCATGCTCTGGTCCATCATC R: TTGGACTTCTGGTACTGTGTCC GQ GQ GQ GQ GQ GQ GQ GQ GQ GQ GQ GQ144426

9 Page 9 of 9 Table 2 Characteristics of microsatellite loci amplified in Crotophaga major. Ta, optimized annealing temperature; MgCl 2, optimized concentration; n, number of individuals genotyped; N A, number of alleles; H O, observed heterozygosity; H E, expected heterozygosity. Locus T a ( C) MgCl 2 (m) Allele size n N A H O H E range (bp) CrMa CrMa CrMa CrMa CrMa4-1* CrMa CrMa CrMa CrMa CrMa CrMa CrMa * Indicates locus not in HWE

Isolation and characterization of nine microsatellite loci in the Pale Pitcher Plant. MARGARET M. KOOPMAN*, ELIZABETH GALLAGHER, and BRYAN C.

Isolation and characterization of nine microsatellite loci in the Pale Pitcher Plant. MARGARET M. KOOPMAN*, ELIZABETH GALLAGHER, and BRYAN C. Page 1 of 28 1 1 2 3 PERMANENT GENETIC RESOURCES Isolation and characterization of nine microsatellite loci in the Pale Pitcher Plant Sarracenia alata (Sarraceniaceae). 4 5 6 MARGARET M. KOOPMAN*, ELIZABETH

More information

Forensic DNA Testing Terminology

Forensic DNA Testing Terminology Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.

More information

Rapid Acquisition of Unknown DNA Sequence Adjacent to a Known Segment by Multiplex Restriction Site PCR

Rapid Acquisition of Unknown DNA Sequence Adjacent to a Known Segment by Multiplex Restriction Site PCR Rapid Acquisition of Unknown DNA Sequence Adjacent to a Known Segment by Multiplex Restriction Site PCR BioTechniques 25:415-419 (September 1998) ABSTRACT The determination of unknown DNA sequences around

More information

DNA Sequence Analysis

DNA Sequence Analysis DNA Sequence Analysis Two general kinds of analysis Screen for one of a set of known sequences Determine the sequence even if it is novel Screening for a known sequence usually involves an oligonucleotide

More information

Troubleshooting for PCR and multiplex PCR

Troubleshooting for PCR and multiplex PCR Page 1 of 5 Page designed and maintained by Octavian Henegariu (Email: Tavi's Yale email or Tavi's Yahoo email). As I am currently pursuing a new junior faculty position, the Yale URL and email may change

More information

360 Master Mix. , and a supplementary 360 GC Enhancer.

360 Master Mix. , and a supplementary 360 GC Enhancer. Product Bulletin AmpliTaq Gold 360 Master Mix and 360 DNA Polymerase AmpliTaq Gold 360 Master Mix AmpliTaq Gold 360 DNA Polymerase 360 Coverage for a Full Range of Targets AmpliTaq Gold 360 Master Mix

More information

PrimeSTAR HS DNA Polymerase

PrimeSTAR HS DNA Polymerase Cat. # R010A For Research Use PrimeSTAR HS DNA Polymerase Product Manual Table of Contents I. Description...3 II. III. IV. Components...3 Storage...3 Features...3 V. General Composition of PCR Reaction

More information

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Genetic engineering: humans Gene replacement therapy or gene therapy Many technical and ethical issues implications for gene pool for germ-line gene therapy what traits constitute disease rather than just

More information

Taq98 Hot Start 2X Master Mix

Taq98 Hot Start 2X Master Mix Taq98 Hot Start 2X Master Mix Optimized for 98C Denaturation Lucigen Corporation 2905 Parmenter St, Middleton, WI 53562 USA Toll Free: (888) 575-9695 (608) 831-9011 FAX: (608) 831-9012 lucigen@lucigen.com

More information

Short Communication. Corresponding author: I.G. Hamoy E-mail: ighamoy@gmail.com

Short Communication. Corresponding author: I.G. Hamoy E-mail: ighamoy@gmail.com Short Communication Multiplex PCR panel of microsatellite markers for the tambaqui, Colossoma macropomum, developed as a tool for use in conservation and broodstock management I.G. Hamoy and S. Santos

More information

BacReady TM Multiplex PCR System

BacReady TM Multiplex PCR System BacReady TM Multiplex PCR System Technical Manual No. 0191 Version 10112010 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI Detailed Experimental

More information

Technical Note. Roche Applied Science. No. LC 18/2004. Assay Formats for Use in Real-Time PCR

Technical Note. Roche Applied Science. No. LC 18/2004. Assay Formats for Use in Real-Time PCR Roche Applied Science Technical Note No. LC 18/2004 Purpose of this Note Assay Formats for Use in Real-Time PCR The LightCycler Instrument uses several detection channels to monitor the amplification of

More information

quantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476

quantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476 BioScience quantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476 This method describes a Real-time semi-quantitative TaqMan PCR procedure for the determination of

More information

Gene Mapping Techniques

Gene Mapping Techniques Gene Mapping Techniques OBJECTIVES By the end of this session the student should be able to: Define genetic linkage and recombinant frequency State how genetic distance may be estimated State how restriction

More information

Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis

Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype

More information

Troubleshooting Sequencing Data

Troubleshooting Sequencing Data Troubleshooting Sequencing Data Troubleshooting Sequencing Data No recognizable sequence (see page 7-10) Insufficient Quantitate the DNA. Increase the amount of DNA in the sequencing reactions. See page

More information

Catalina Monzó n-argü ello Æ Joaquín Muñ oz Æ Adolfo Marco Æ Luis Felipe Ló pez-jurado Æ Ciro Rico

Catalina Monzó n-argü ello Æ Joaquín Muñ oz Æ Adolfo Marco Æ Luis Felipe Ló pez-jurado Æ Ciro Rico Twelve new polymorphic microsatellite markers from the loggerhead sea turtle (Caretta caretta) and cross-species amplification on other marine turtle species Catalina Monzó n-argü ello Æ Joaquín Muñ oz

More information

DNA: A Person s Ultimate Fingerprint

DNA: A Person s Ultimate Fingerprint A partnership between the UAB Center for Community Outreach Development and McWane Center DNA: A Person s Ultimate Fingerprint This project is supported by a Science Education Partnership Award (SEPA)

More information

SERVICES CATALOGUE WITH SUBMISSION GUIDELINES

SERVICES CATALOGUE WITH SUBMISSION GUIDELINES SERVICES CATALOGUE WITH SUBMISSION GUIDELINES 3921 Montgomery Road Cincinnati, Ohio 45212 513-841-2428 www.agctsequencing.com CONTENTS Welcome Dye Terminator Sequencing DNA Sequencing Services - Full Service

More information

Seventy-five EST-linked Atlantic salmon (Salmo salar L.) microsatellite markers and their cross-amplification in five salmonid species

Seventy-five EST-linked Atlantic salmon (Salmo salar L.) microsatellite markers and their cross-amplification in five salmonid species Molecular Ecology Notes (2005) 5, 282 288 doi: 10.1111/j.1471-8286.2005.00902.x Blackwell Publishing, Ltd. PRIMER NOTE Seventy-five EST-linked Atlantic salmon (Salmo salar L.) microsatellite markers and

More information

Commonly Used STR Markers

Commonly Used STR Markers Commonly Used STR Markers Repeats Satellites 100 to 1000 bases repeated Minisatellites VNTR variable number tandem repeat 10 to 100 bases repeated Microsatellites STR short tandem repeat 2 to 6 bases repeated

More information

RT-PCR: Two-Step Protocol

RT-PCR: Two-Step Protocol RT-PCR: Two-Step Protocol We will provide both one-step and two-step protocols for RT-PCR. We recommend the twostep protocol for this class. In the one-step protocol, the components of RT and PCR are mixed

More information

Introduction. Preparation of Template DNA

Introduction. Preparation of Template DNA Procedures and Recommendations for DNA Sequencing at the Plant-Microbe Genomics Facility Ohio State University Biological Sciences Building Room 420, 484 W. 12th Ave., Columbus OH 43210 Telephone: 614/247-6204;

More information

The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics

The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics The GS Junior System The Power of Next-Generation Sequencing on Your Benchtop Proven technology: Uses the same long

More information

How many of you have checked out the web site on protein-dna interactions?

How many of you have checked out the web site on protein-dna interactions? How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss

More information

Procedures For DNA Sequencing

Procedures For DNA Sequencing Procedures For DNA Sequencing Plant-Microbe Genomics Facility (PMGF) Ohio State University 420 Biological Sciences Building 484 W. 12th Ave., Columbus OH 43210 Telephone: 614/247-6204 FAX: 614/292-6337

More information

Genomics Services @ GENterprise

Genomics Services @ GENterprise Genomics Services @ GENterprise since 1998 Mainz University spin-off privately financed 6-10 employees since 2006 Genomics Services @ GENterprise Sequencing Service (Sanger/3730, 454) Genome Projects (Bacteria,

More information

GENOTYPING ASSAYS AT ZIRC

GENOTYPING ASSAYS AT ZIRC GENOTYPING ASSAYS AT ZIRC A. READ THIS FIRST - DISCLAIMER Dear ZIRC user, We now provide detailed genotyping protocols for a number of zebrafish lines distributed by ZIRC. These protocols were developed

More information

DNA FRAGMENT ANALYSIS by Capillary Electrophoresis

DNA FRAGMENT ANALYSIS by Capillary Electrophoresis DNA FRAGMENT ANALYSIS by Capillary Electrophoresis USER GUIDE DNA Fragment Analysis by Capillary Electrophoresis Publication Number 4474504 Rev. A Revision Date September 2012 For Research Use Only. Not

More information

Biotechnology: DNA Technology & Genomics

Biotechnology: DNA Technology & Genomics Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 The BIG Questions How can we use our knowledge of DNA to: diagnose disease or defect? cure disease or defect? change/improve organisms? What

More information

Application Guide... 2

Application Guide... 2 Protocol for GenomePlex Whole Genome Amplification from Formalin-Fixed Parrafin-Embedded (FFPE) tissue Application Guide... 2 I. Description... 2 II. Product Components... 2 III. Materials to be Supplied

More information

Introduction To Real Time Quantitative PCR (qpcr)

Introduction To Real Time Quantitative PCR (qpcr) Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors

More information

Fast PCR: General Considerations for Minimizing Run Times and Maximizing Throughput

Fast PCR: General Considerations for Minimizing Run Times and Maximizing Throughput amplification tech note 5362 Fast PCR: General Considerations for Minimizing Run Times and Maximizing Throughput Daniel Sullivan, Babette Fahey, and David Titus, Bio-Rad Laboratories, Inc., Waltham, MA

More information

1/12 Dideoxy DNA Sequencing

1/12 Dideoxy DNA Sequencing 1/12 Dideoxy DNA Sequencing Dideoxy DNA sequencing utilizes two steps: PCR (polymerase chain reaction) amplification of DNA using dideoxy nucleoside triphosphates (Figures 1 and 2)and denaturing polyacrylamide

More information

Becker Muscular Dystrophy

Becker Muscular Dystrophy Muscular Dystrophy A Case Study of Positional Cloning Described by Benjamin Duchenne (1868) X-linked recessive disease causing severe muscular degeneration. 100 % penetrance X d Y affected male Frequency

More information

Title: Characterization of microsatellite primers for Bembidion lampros through

Title: Characterization of microsatellite primers for Bembidion lampros through 1 2 Title: Characterization of microsatellite primers for Bembidion lampros through 454-sequencing of the genome. 3 4 C Marchi 1, LW Andersen 2, F Panitz 3, L-E Holm 3, V Loeschcke 1 5 6 7 8 9 10 1 Integrative

More information

HiPer RT-PCR Teaching Kit

HiPer RT-PCR Teaching Kit HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The

More information

EU Reference Laboratory for E. coli Department of Veterinary Public Health and Food Safety Unit of Foodborne Zoonoses Istituto Superiore di Sanità

EU Reference Laboratory for E. coli Department of Veterinary Public Health and Food Safety Unit of Foodborne Zoonoses Istituto Superiore di Sanità Identification and characterization of Verocytotoxin-producing Escherichia coli (VTEC) by Real Time PCR amplification of the main virulence genes and the genes associated with the serogroups mainly associated

More information

GenScript BloodReady TM Multiplex PCR System

GenScript BloodReady TM Multiplex PCR System GenScript BloodReady TM Multiplex PCR System Technical Manual No. 0174 Version 20040915 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI

More information

Essentials of Real Time PCR. About Sequence Detection Chemistries

Essentials of Real Time PCR. About Sequence Detection Chemistries Essentials of Real Time PCR About Real-Time PCR Assays Real-time Polymerase Chain Reaction (PCR) is the ability to monitor the progress of the PCR as it occurs (i.e., in real time). Data is therefore collected

More information

Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation

Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation BDGP Resources Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation For recovery of sequences flanking PZ, PlacW and PEP elements E. Jay Rehm Berkeley Drosophila Genome Project I.

More information

PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-)

PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-) PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-) FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE Lucigen Corporation 2905 Parmenter St, Middleton, WI 53562 USA Toll Free: (888) 575-9695 (608)

More information

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99. 1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence

More information

The Techniques of Molecular Biology: Forensic DNA Fingerprinting

The Techniques of Molecular Biology: Forensic DNA Fingerprinting Revised Fall 2011 The Techniques of Molecular Biology: Forensic DNA Fingerprinting The techniques of molecular biology are used to manipulate the structure and function of molecules such as DNA and proteins

More information

AmpFlSTR Identifiler Direct PCR Amplification Kit

AmpFlSTR Identifiler Direct PCR Amplification Kit USER GUIDE AmpFlSTR Identifiler Direct PCR Amplification Kit for use with: 200 reaction kit (Part no. 4467831) 1000 reaction kit (Part no. 4408580) Publication Part Number 4415125 Rev. J For Forensic or

More information

DNA Core Facility: DNA Sequencing Guide

DNA Core Facility: DNA Sequencing Guide DNA Core Facility: DNA Sequencing Guide University of Missouri-Columbia 216 Life Sciences Center Columbia, MO 65211 http://biotech.missouri.edu/dnacore/ Table of Contents 1. Evaluating Sequencing Data..

More information

Genome Sequencer System. Amplicon Sequencing. Application Note No. 5 / February 2007. www.roche-applied-science.com

Genome Sequencer System. Amplicon Sequencing. Application Note No. 5 / February 2007. www.roche-applied-science.com Genome Sequencer System Application Note No. 5 / February 2007 Amplicon Sequencing www.roche-applied-science.com 1 Amplicon Sequencing Corresponding author: Tom Jarvie, 454 Life Sciences Corporation, Branford,

More information

Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA

Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA Page 1 of 5 Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA Genetics Exercise: Understanding how meiosis affects genetic inheritance and DNA patterns

More information

TaqMan Fast Advanced Master Mix. Protocol

TaqMan Fast Advanced Master Mix. Protocol TaqMan Fast Advanced Master Mix Protocol For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in this document is subject to change without notice. APPLIED

More information

Recombinant DNA Unit Exam

Recombinant DNA Unit Exam Recombinant DNA Unit Exam Question 1 Restriction enzymes are extensively used in molecular biology. Below are the recognition sites of two of these enzymes, BamHI and BclI. a) BamHI, cleaves after the

More information

ONLINE SUPPLEMENTAL MATERIAL. Allele-Specific Expression of Angiotensinogen in Human Subcutaneous Adipose Tissue

ONLINE SUPPLEMENTAL MATERIAL. Allele-Specific Expression of Angiotensinogen in Human Subcutaneous Adipose Tissue ONLINE SUPPLEMENTAL MATERIAL Allele-Specific Expression of Angiotensinogen in Human Subcutaneous Adipose Tissue Sungmi Park 1, Ko-Ting Lu 1, Xuebo Liu 1, Tapan K. Chatterjee 2, Steven M. Rudich 3, Neal

More information

PCR was carried out in a reaction volume of 20 µl using the ABI AmpliTaq GOLD kit (ABI,

PCR was carried out in a reaction volume of 20 µl using the ABI AmpliTaq GOLD kit (ABI, Supplemental Text/Tables PCR Amplification and Sequencing PCR was carried out in a reaction volume of 20 µl using the ABI AmpliTaq GOLD kit (ABI, Foster City, CA). Each PCR reaction contained 20 ng genomic

More information

510K Summary. This summary of 510(k) safety and effectiveness information is being submitted in accordance with the requirements of 21 CFR 807.92.

510K Summary. This summary of 510(k) safety and effectiveness information is being submitted in accordance with the requirements of 21 CFR 807.92. 510K Summary This summary of 510(k) safety and effectiveness information is being submitted in accordance with the requirements of 21 CFR 807.92. Submitter: Contact: One Lambda, Incorporated 21001 Kittridge

More information

Artisan Scientific is You~ Source for: Quality New and Certified-Used/Pre:-awned ECJuiflment

Artisan Scientific is You~ Source for: Quality New and Certified-Used/Pre:-awned ECJuiflment Looking for more information? Visit us on the web at http://www.artisan-scientific.com for more information: Price Quotations Drivers Technical Specifications. Manuals and Documentation Artisan Scientific

More information

ABSTRACT. Promega Corporation, Updated September 2008. http://www.promega.com/pubhub. 1 Campbell-Staton, S.

ABSTRACT. Promega Corporation, Updated September 2008. http://www.promega.com/pubhub. 1 Campbell-Staton, S. A Modified Wizard SV Genomic DNA Purification System Protocol to Purify Genomic DNA... A Modified Wizard SV Genomic DNA Purification System Protocol to Purify Genomic DNA from Shed Reptile Skin ABSTRACT

More information

A Fast, Accurate, and Automated Workflow for Multi Locus Sequence Typing of Bacterial Isolates

A Fast, Accurate, and Automated Workflow for Multi Locus Sequence Typing of Bacterial Isolates Application Note MLST A Fast, Accurate, and Automated Workflow for Multi Locus Sequence Typing of Bacterial Isolates Using Applied Biosystems 3130 and 3730 Series Capillary Electrophoresis Systems and

More information

Recombinant DNA Technology

Recombinant DNA Technology Recombinant DNA Technology Dates in the Development of Gene Cloning: 1965 - plasmids 1967 - ligase 1970 - restriction endonucleases 1972 - first experiments in gene splicing 1974 - worldwide moratorium

More information

PicoMaxx High Fidelity PCR System

PicoMaxx High Fidelity PCR System PicoMaxx High Fidelity PCR System Instruction Manual Catalog #600420 (100 U), #600422 (500 U), and #600424 (1000 U) Revision C Research Use Only. Not for Use in Diagnostic Procedures. 600420-12 LIMITED

More information

July 7th 2009 DNA sequencing

July 7th 2009 DNA sequencing July 7th 2009 DNA sequencing Overview Sequencing technologies Sequencing strategies Sample preparation Sequencing instruments at MPI EVA 2 x 5 x ABI 3730/3730xl 454 FLX Titanium Illumina Genome Analyzer

More information

Nucleic Acid Techniques in Bacterial Systematics

Nucleic Acid Techniques in Bacterial Systematics Nucleic Acid Techniques in Bacterial Systematics Edited by Erko Stackebrandt Department of Microbiology University of Queensland St Lucia, Australia and Michael Goodfellow Department of Microbiology University

More information

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,

More information

ID kit. imegen Anchovies II. and E. japonicus) DNA detection by. User manual. Anchovies species (E. encrasicolus. sequencing.

ID kit. imegen Anchovies II. and E. japonicus) DNA detection by. User manual. Anchovies species (E. encrasicolus. sequencing. User manual imegen Anchovies II ID kit Anchovies species (E. encrasicolus and E. japonicus) DNA detection by sequencing Reference: Made in Spain The information in this guide is subject to change without

More information

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing DNA sequence represents a single format onto which a broad range of biological phenomena can be projected for high-throughput data collection Over the past three years, massively

More information

Real-Time PCR Vs. Traditional PCR

Real-Time PCR Vs. Traditional PCR Real-Time PCR Vs. Traditional PCR Description This tutorial will discuss the evolution of traditional PCR methods towards the use of Real-Time chemistry and instrumentation for accurate quantitation. Objectives

More information

Data Analysis for Ion Torrent Sequencing

Data Analysis for Ion Torrent Sequencing IFU022 v140202 Research Use Only Instructions For Use Part III Data Analysis for Ion Torrent Sequencing MANUFACTURER: Multiplicom N.V. Galileilaan 18 2845 Niel Belgium Revision date: August 21, 2014 Page

More information

Reverse Transcription System

Reverse Transcription System TECHNICAL BULLETIN Reverse Transcription System Instruc ons for use of Product A3500 Revised 1/14 TB099 Reverse Transcription System All technical literature is available on the Internet at: www.promega.com/protocols/

More information

Gene Expression Assays

Gene Expression Assays APPLICATION NOTE TaqMan Gene Expression Assays A mpl i fic ationef ficienc yof TaqMan Gene Expression Assays Assays tested extensively for qpcr efficiency Key factors that affect efficiency Efficiency

More information

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna

More information

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology

More information

Individualization of tiger by using microsatellites

Individualization of tiger by using microsatellites Forensic Science International 151 (2005) 45 51 www.elsevier.com/locate/forsciint Individualization of tiger by using microsatellites Yan Chun Xu a,b, *,BoLi a, Wan Shui Li c, Su Ying Bai a, Yu Jin a,

More information

HCS604.03 Exercise 1 Dr. Jones Spring 2005. Recombinant DNA (Molecular Cloning) exercise:

HCS604.03 Exercise 1 Dr. Jones Spring 2005. Recombinant DNA (Molecular Cloning) exercise: HCS604.03 Exercise 1 Dr. Jones Spring 2005 Recombinant DNA (Molecular Cloning) exercise: The purpose of this exercise is to learn techniques used to create recombinant DNA or clone genes. You will clone

More information

Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual

Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual F- 470S 20 cdna synthesis reactions (20 µl each) F- 470L 100 cdna synthesis reactions (20 µl each) Table of contents 1. Description...

More information

TIANquick Mini Purification Kit

TIANquick Mini Purification Kit TIANquick Mini Purification Kit For purification of PCR products, 100 bp to 20 kb www.tiangen.com TIANquick Mini Purification Kit (Spin column) Cat no. DP203 Kit Contents Contents Buffer BL Buffer PB Buffer

More information

PCR Instruments and Consumables

PCR Instruments and Consumables Index Page GeneAmp PCR Instrument Systems 2 GeneAmp PCR System 9700 Components 3 Accessories and Software for GeneAmp PCR Instrument Systems 4 Disposables 5 PCR Enzymes 7 GeneAmp PCR Kits 12 RNA PCR Kits

More information

DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA

DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA DNA Fingerprinting Unless they are identical twins, individuals have unique DNA DNA fingerprinting The name used for the unambiguous identifying technique that takes advantage of differences in DNA sequence

More information

SYBR Green Realtime PCR Master Mix -Plus-

SYBR Green Realtime PCR Master Mix -Plus- Instruction manual SYBR Green Realtime PCR Master Mix -Plus- 0810 F0925K SYBR Green Realtime PCR Master Mix -Plus- Contents QPK-212T 1mLx1 QPK-212 1mLx5 Store at -20 C, protected from light [1] Introduction

More information

Computer with GeneMapper ID (version 3.2.1 or most current) software Microsoft Excel, Word Print2PDF software

Computer with GeneMapper ID (version 3.2.1 or most current) software Microsoft Excel, Word Print2PDF software Procedure for GeneMapper ID for Casework 1.0 Purpose-This procedure specifies the steps for performing analysis on DNA samples amplified with AmpFlSTR Identifiler Plus using the GeneMapper ID (GMID) software.

More information

restriction enzymes 350 Home R. Ward: Spring 2001

restriction enzymes 350 Home R. Ward: Spring 2001 restriction enzymes 350 Home Restriction Enzymes (endonucleases): molecular scissors that cut DNA Properties of widely used Type II restriction enzymes: recognize a single sequence of bases in dsdna, usually

More information

Molecular Diagnostics in the Clinical Microbiology Laboratory

Molecular Diagnostics in the Clinical Microbiology Laboratory Molecular Diagnostics in the Clinical Microbiology Laboratory Patrick Tang, MD, PhD, FRCPC B.C. Centre for Disease Control University of British Columbia Molecular Diagnostics in the Clinical Microbiology

More information

Protocols. Internal transcribed spacer region (ITS) region. Niklaus J. Grünwald, Frank N. Martin, and Meg M. Larsen (2013)

Protocols. Internal transcribed spacer region (ITS) region. Niklaus J. Grünwald, Frank N. Martin, and Meg M. Larsen (2013) Protocols Internal transcribed spacer region (ITS) region Niklaus J. Grünwald, Frank N. Martin, and Meg M. Larsen (2013) The nuclear ribosomal RNA (rrna) genes (small subunit, large subunit and 5.8S) are

More information

Analysis of the DNA Methylation Patterns at the BRCA1 CpG Island

Analysis of the DNA Methylation Patterns at the BRCA1 CpG Island Analysis of the DNA Methylation Patterns at the BRCA1 CpG Island Frédérique Magdinier 1 and Robert Dante 2 1 Laboratory of Molecular Biology of the Cell, Ecole Normale Superieure, Lyon, France 2 Laboratory

More information

Quantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit

Quantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit Product Bulletin Human Identification Quantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit The Quantifiler kits produce reliable and reproducible results, helping to

More information

Genotyping by sequencing and data analysis. Ross Whetten North Carolina State University

Genotyping by sequencing and data analysis. Ross Whetten North Carolina State University Genotyping by sequencing and data analysis Ross Whetten North Carolina State University Stein (2010) Genome Biology 11:207 More New Technology on the Horizon Genotyping By Sequencing Timeline 2007 Complexity

More information

Identification of the VTEC serogroups mainly associated with human infections by conventional PCR amplification of O-associated genes

Identification of the VTEC serogroups mainly associated with human infections by conventional PCR amplification of O-associated genes Identification of the VTEC serogroups mainly associated with human infections by conventional PCR amplification of O-associated genes 1. Aim and field of application The present method concerns the identification

More information

A Primer of Genome Science THIRD

A Primer of Genome Science THIRD A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:

More information

PCR & DNA Sequencing. PCR= Polymerase Chain Reaction. PCR applications

PCR & DNA Sequencing. PCR= Polymerase Chain Reaction. PCR applications PCR= Polymerase Chain Reaction PCR & DNA Sequencing Biology 224 Instructor: Tom Peavy March 20, 2006 DNA photocopier integral tool for molecular biologists work horse versatile (many applications) not

More information

Hepatitis B Virus Genemer Mix

Hepatitis B Virus Genemer Mix Product Manual Hepatitis B Virus Genemer Mix Primer Pair for amplification of HBV Specific DNA Fragment Includes Internal Negative Control Primers and Template Catalog No.: 60-2007-12 Store at 20 o C For

More information

DNA Sequencing Handbook

DNA Sequencing Handbook Genomics Core 147 Biotechnology Building Ithaca, New York 14853-2703 Phone: (607) 254-4857; Fax (607) 254-4847 Web: http://cores.lifesciences.cornell.edu/brcinfo/ Email: DNA_Services@cornell.edu DNA Sequencing

More information

AFLP System Analysis Getting Started Guide

AFLP System Analysis Getting Started Guide GeneMapper Software Version 4.1 AFLP System Analysis Getting Started Guide Getting Started Setting Up the Analysis Analyzing and Examining the Data Exporting and Printing the Analyzed Data GeneMapper

More information

DNA-functionalized hydrogels for confined membrane-free in vitro transcription/translation

DNA-functionalized hydrogels for confined membrane-free in vitro transcription/translation Electronic Supplementary Material (ESI) for Lab on a Chip. This journal is The Royal Society of Chemistry 2014 DNA-functionalized hydrogels for confined membrane-free in vitro transcription/translation

More information

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing Technology and applications 10/1/2015 Jeroen Van Houdt - Genomics Core - KU Leuven - UZ Leuven 1 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977

More information

CCR Biology - Chapter 9 Practice Test - Summer 2012

CCR Biology - Chapter 9 Practice Test - Summer 2012 Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible

More information

Sanger Sequencing and Quality Assurance. Zbigniew Rudzki Department of Pathology University of Melbourne

Sanger Sequencing and Quality Assurance. Zbigniew Rudzki Department of Pathology University of Melbourne Sanger Sequencing and Quality Assurance Zbigniew Rudzki Department of Pathology University of Melbourne Sanger DNA sequencing The era of DNA sequencing essentially started with the publication of the enzymatic

More information

Cloning Blunt-End Pfu DNA Polymerase- Generated PCR Fragments into pgem -T Vector Systems

Cloning Blunt-End Pfu DNA Polymerase- Generated PCR Fragments into pgem -T Vector Systems Promega Notes Number 71, 1999, p. 10 Blunt-End Pfu DNA Polymerase- Generated PCR Fragments into pgem -T Vector Systems By Kimberly Knoche, Ph.D., and Dan Kephart, Ph.D. Promega Corporation Corresponding

More information

Brief Communication. B. Freeman, 1 N. Smith, 1 C. Curtis, 1 L. Huckett, 1 J. Mill, 1 and I. W. Craig 1,2

Brief Communication. B. Freeman, 1 N. Smith, 1 C. Curtis, 1 L. Huckett, 1 J. Mill, 1 and I. W. Craig 1,2 Behavior Genetics, Vol. 33, No. 1, January 2003 ( 2003) Brief Communication DNA from Buccal Swabs Recruited by Mail: Evaluation of Storage Effects on Long-term Stability and Suitability for Multiplex Polymerase

More information

Recombinant DNA and Biotechnology

Recombinant DNA and Biotechnology Recombinant DNA and Biotechnology Chapter 18 Lecture Objectives What Is Recombinant DNA? How Are New Genes Inserted into Cells? What Sources of DNA Are Used in Cloning? What Other Tools Are Used to Study

More information

IIID 14. Biotechnology in Fish Disease Diagnostics: Application of the Polymerase Chain Reaction (PCR)

IIID 14. Biotechnology in Fish Disease Diagnostics: Application of the Polymerase Chain Reaction (PCR) IIID 14. Biotechnology in Fish Disease Diagnostics: Application of the Polymerase Chain Reaction (PCR) Background Infectious diseases caused by pathogenic organisms such as bacteria, viruses, protozoa,

More information

mircute mirna qpcr Detection Kit (SYBR Green)

mircute mirna qpcr Detection Kit (SYBR Green) mircute mirna qpcr Detection Kit (SYBR Green) For detection of mirna using real-time RT-PCR (SYBR Green I) www.tiangen.com QP110302 mircute mirna qpcr Detection Kit (SYBR Green) Kit Contents Cat. no. FP401

More information

Genomic DNA Extraction Kit INSTRUCTION MANUAL

Genomic DNA Extraction Kit INSTRUCTION MANUAL Genomic DNA Extraction Kit INSTRUCTION MANUAL Table of Contents Introduction 3 Kit Components 3 Storage Conditions 4 Recommended Equipment and Reagents 4 Introduction to the Protocol 4 General Overview

More information

Single Nucleotide Polymorphisms (SNPs)

Single Nucleotide Polymorphisms (SNPs) Single Nucleotide Polymorphisms (SNPs) Additional Markers 13 core STR loci Obtain further information from additional markers: Y STRs Separating male samples Mitochondrial DNA Working with extremely degraded

More information