Isolation and characterization of microsatellite markers from the greater ani. Crotophaga major (Aves: Cuculidae)
|
|
- Brandon Sparks
- 8 years ago
- Views:
Transcription
1 Page 1 of 9 Isolation and characterization of microsatellite markers from the greater ani Crotophaga major (Aves: Cuculidae) C. RIEHL * and S. M. BOGDANOWICZ * Department of Ecology and Evolutionary Biology, Princeton University, 106A Guyot Hall, Princeton, NJ 08544, USA Department of Migration and Immuno-ecology, Max Planck Institute for Ornithology, Schlossallee 2, Radolfzell, Germany Department of Ecology and Evolutionary Biology, Cornell University, E145 Corson Hall, Ithaca, NY 14853, USA Keywords: Crotophaga, Crotophaga major, greater ani, microsatellite Correspondence: Christina Riehl, Fax: criehl@princeton.edu
2 Page 2 of Abstract The greater ani (Crotophaga major) is a communally breeding cuckoo found in Panama and northern South America. We developed 12 polymorphic microsatellite loci in 227 individuals, with a mean of 6.2 alleles per locus (range 4 10) and a mean observed heterozygosity of 0.58 (range ). These markers will allow determination of mating patterns and reproductive success of individuals within communally breeding groups The greater ani (Crotophaga major) practices a rare form of cooperative breeding in which several unrelated females lay eggs in one nest. Breeding groups are composed of socially monogamous pairs; however, the genetic mating system of this species has not been determined. Microsatellite loci have previously been developed for two related species (C. ani, Blanchard & Quinn 2001; and Guira guira, Muniz et al. 2003), but these loci are monomorphic in C. major. Here we describe the development of twelve polymorphic microsatellite loci for C. major, which will be used to determine mating patterns and reproductive success of individuals in nesting groups. Genomic DNA from a nestling greater ani from Barro Colorado Island, Panama, was used to create a DNA library enriched for microsatellites using the ligation procedure of Hamilton et al. (1999), with modifications following Grant & Bogdanowicz (2006). Briefly, blunt-ended DNA fragments were created by digestion with BsaA I and Hinc II, then ligated to SNX linker sequences and enriched for microsatellite sequences by a biotin-capture method using streptavidin-coated magnetic beads. Three libraries were
3 Page 3 of enriched in parallel using the dimeric, trimeric, and tetrameric biotinylated oligonucleotide repeat units described in Barnett et al. (2007). Captured fragments were amplified by polymerase chain reaction (PCR) using a primer complementary to the SNX linker (DYAD thermal cycler, Bio-rad), digested with Nhe I to remove the linker, and ligated into Xba I -digested puc 19 plasmids. Recombinant molecules were electroporated into competent Escherichia coli cells and transformed bacteria were screened with a 33 P-labelled probe of the oligonucleotide sequences used in the enrichment (Grant & Bogdanowicz 2006). We used PCR with universal M13 primers to amplify plasmid DNA from positive clones, then sequenced the products with BigDye Terminator version 3.1 Cycle Sequencing chemistry and an automated 3730xl DNA Analyser (Applied Biosystems). We sequenced 272 clones and designed primer pairs to amplify 30 microsatellite loci using the program Primer3 (Rozen & Skaletsky 2000). Primer pairs from 25 loci were successfully optimized and tested for variability on a panel of 16 unrelated greater ani nestlings from different nesting groups from Gatún Lake, Panama. We then selected twelve polymorphic loci to genotype 227 individuals from the same population (Table 1). For the initial screening for polymorphism, fluorescently labeled PCR products were created using the universal tag method of Schuelke (2000) with the conditions described in Makarewich et al. (2009). A pigtail (5 -GTTTCT) was attached to the reverse primer to ensure complete adenylation of the amplification products (Brownstein et al. 1996). Each PCR reaction contained ng DNA, 10 mm Tris-HCl, 50 mm KCl, 1.5 mm MgCl 2, 0.12 pm of the locus-specific forward primer, 1.2 pm of the universal forward primer, 1.2 pm of the locus-specific reverse primer, 0.2 U Taq polymerase
4 Page 4 of (Sigma), 200 µm dntps (Invitrogen), and H 2 O to bring the final volume to10 µl. Amplifications consisted of an initial denaturation (95 C, 4 min); 35 cycles of denaturation (95 C, 45 s), annealing (locus-specific annealing temperature, 60 s), and extension (72 C, 60 s); and a final extension of 5 min at 72 C. For the expanded genotyping, we amplified multiple loci in the same PCR reaction ( multiplexing ). Each locus-specific forward primer was fluorescently labeled at the 5 end (6-FAM, PET, NED, or VIC; Applied Biosystems) and was used with the pigtailed locus-specific reverse primer as described above. PCR conditions were as described above, with the following changes: i) 0.25 U Taq polymerase; ii) 3.25 mm MgCl 2 ; and iii) primer concentrations varied from 1 to 3 pm to yield similar fluorescent signals. PCR products were sized on an ABI PRISM 3100 Genetic Analyser (Applied Biosystems) with a GeneScan-500 LIZ molecular weight standard (Applied Biosystems) and GeneMapper 3.7 software (Applied Biosystems). We used GenePop 3.4 (Raymond and Rousset 1995) and Cervus 3.0 (Kalinowski et al. 2007) to determine observed and expected heterozygosity levels, conformation to Hardy-Weinberg proportions, null allele frequencies, and gametic disequilibrium between locus pairs. The number of alleles per locus ranged from 4 to 10 (mean = 6.2) with observed heterozygosities ranging from 0.22 to 0.8 (mean = 0.58; Table 2). Tests for gametic disequilibrium were not statistically significant after a Bonferroni correction for multiple comparisons. One locus, CrMa4-1, was not in HWE and had an estimated null allele frequency of 0.3. This may be due to the presence of alleles larger than 500 base pairs and therefore undetectable using a 500-bp size standard; however, it is possible that this locus could still be useful in genotyping analyses when used with a larger size standard.
5 Page 5 of The markers developed here will be used to determine mating patterns and reproductive success of individuals within communal groups, and will allow comparison of extra-pair copulation rates and reproductive skew between C. major and its congeners References Barnett JR, Stenzler LM, Ruiz-Gutierrez V, Bogdanowicz SM, Lovette IJ (2007) Isolation and characterization of microsatellite markers from the white-ruffed manakin Corapipo altera (Aves, Pipridae). Molecular Ecology Resources, 8, Blanchard L, Quinn JS (2001) The characterization of microsatellite loci in the communally breeding smooth-billed ani (Crotophaga ani). Molecular Ecology Notes, 1, Brownstein MH, Carpten JD, Smith JR (1996) Modulation of nontemplated nucleotide addition by Taq DNA polymerase: primer modifications that facilitate genotyping. BioTechniques, 20, Grant JB, Bogdanowicz SM (2006) Isolation and characterization of microsatellite markers from the panic moth, Saucrobotys futilalis L. (Lepidoptera: Pyralidae: Pyraustinae). Molecular Ecology Notes, 6, Hamilton MB, Pincus EL, Difiore A, Fleischer RC (1999) Universal linker and ligation procedures for construction of genomic DNA libraries enriched for microsatellites. BioTechniques, 27, Kalinowski ST, Taper ML, Marshall TC (2007) Revising how the computer program
6 Page 6 of CERVUS accommodates genotyping error increases success in paternity assignment. Molecular Ecology, 16, Makarewich CA, Stenzler LM, Ferretti V, Winkler DW, Lovette IJ (2009) Isolation and characterization of microsatellite markers from three species of swallows in the genus Tachycineta: T. albilinea, T. bicolor and T. leucorrhoa. Molecular Ecology Resources, 9, Muniz LSB, Macedo RHF, Graves J (2003) Isolation and characterization of dinucleotide microsatellite loci in communally breeding Guira cuckoos (Aves: Cuculidae). Molecular Ecology Notes, 3, Raymond M, Rousset F (2004) GenePop Version Updated from Raymond & Rousset (1995) GenePop version 1.2: population genetics software for exact tests and ecumenicism. Journal of Heredity, 83, Rozen S, Skaletsky HJ (2000) Primer3 on the WWW for general users and for biologist programmers. In: Bioinformatics Methods and Protocols: Methods in Molecular Biology (eds. Krawetz S, Misener S), pp Humana Press, Totowa, NJ. Schuelke M (2000) An economic method for the fluorescent labeling of PCR fragments. Nature Biotechnology, 18, Acknowledgments We thank L. M. Stenzler, I. J. Lovette, and the Cornell Laboratory of Ornithology for assistance in microsatellite development and genotyping, and L. Jara for field assistance.
7 Page 7 of This work was supported by the Max Planck Institute for Ornithology, Princeton University, and a NSF Graduate Research Fellowship to C. Riehl
8 Page 8 of 9 Locus Table 1 Microsatellite loci developed in Crotophaga major Fluorescent Dye Label; Multiplex Combination Repeat Motif Primer Sequence (5 3 ) GenBank Accession no. CrMa3-27 VIC; 1 (CAA) 11 (TAA) 7 (CAAA) 5 F: GGTGCTTCCCAAACCTTAT R: TGCTTGTCATCCTCAAGTGG CrMa3-95 FAM; 1 (GTTT) 8 F: CATGCCTTGAACCCTGACTT R: GGGAGAATTCTTTTCCTTGGAC CrMa2-23 FAM; 2 (TC) 43 F: CAGTCTGAGGGAAGCCAAAT R: AAAACCAAACCAACACGAGAA CrMa2-24 PET; 2 (CA) 12 F: AGCAGAACTTTGCCCCTCTT R: ATGGCTGTCAAAATGCTGTG CrMa4-1 FAM; 3 (GAAA) 36 F: TTGCACAGGAAGAGTGGATG R: GTTGCACAGGAGGAAAAAGC CrMa4-6 FAM; 3 (GATA) 10 F: TTGCATGTATGGCATGAGGT R: TCTTCTGGCTGTGTGGATTTC CrMa3-25 VIC; 3 (CTT) 34 F: GTGGGAAAGCTTGAAGAGCA R: CAGAGGTTAAGCTCAAGGAAAA CrMa3-142 NED; 4 (GTT) 18 F: TCCAGTTCCACCTCCCACTA R: GGAAAGAATCTCAGCTTTTGCT CrMa3-37 PET; 4 (GAA) 14 (CAA) 6 (GAA) 15 F: TTCTTACTCTGCGACTGAGCAC R: GTGGGAAAGCTTGAAGAGCA CrMa3-45 VIC; 4 (GTT) 16 (GTTT) 4 F: AATGGTTCGGGTGTGAAGAG R: AGGGTCCAATTTCTGCAGTG CrMa3-8 PET; 5 (CAA) 17 F: AAGTGCCATACATGCTGCTG R: GCAGGTTCCAGTCATTGCTC CrMa3-104 NED; 5 (TAG) 5 CTG(TAG) 3 (GTT) 11 F: TCATGCTCTGGTCCATCATC R: TTGGACTTCTGGTACTGTGTCC GQ GQ GQ GQ GQ GQ GQ GQ GQ GQ GQ GQ144426
9 Page 9 of 9 Table 2 Characteristics of microsatellite loci amplified in Crotophaga major. Ta, optimized annealing temperature; MgCl 2, optimized concentration; n, number of individuals genotyped; N A, number of alleles; H O, observed heterozygosity; H E, expected heterozygosity. Locus T a ( C) MgCl 2 (m) Allele size n N A H O H E range (bp) CrMa CrMa CrMa CrMa CrMa4-1* CrMa CrMa CrMa CrMa CrMa CrMa CrMa * Indicates locus not in HWE
Isolation and characterization of nine microsatellite loci in the Pale Pitcher Plant. MARGARET M. KOOPMAN*, ELIZABETH GALLAGHER, and BRYAN C.
Page 1 of 28 1 1 2 3 PERMANENT GENETIC RESOURCES Isolation and characterization of nine microsatellite loci in the Pale Pitcher Plant Sarracenia alata (Sarraceniaceae). 4 5 6 MARGARET M. KOOPMAN*, ELIZABETH
More informationForensic DNA Testing Terminology
Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.
More informationRapid Acquisition of Unknown DNA Sequence Adjacent to a Known Segment by Multiplex Restriction Site PCR
Rapid Acquisition of Unknown DNA Sequence Adjacent to a Known Segment by Multiplex Restriction Site PCR BioTechniques 25:415-419 (September 1998) ABSTRACT The determination of unknown DNA sequences around
More informationDNA Sequence Analysis
DNA Sequence Analysis Two general kinds of analysis Screen for one of a set of known sequences Determine the sequence even if it is novel Screening for a known sequence usually involves an oligonucleotide
More informationTroubleshooting for PCR and multiplex PCR
Page 1 of 5 Page designed and maintained by Octavian Henegariu (Email: Tavi's Yale email or Tavi's Yahoo email). As I am currently pursuing a new junior faculty position, the Yale URL and email may change
More information360 Master Mix. , and a supplementary 360 GC Enhancer.
Product Bulletin AmpliTaq Gold 360 Master Mix and 360 DNA Polymerase AmpliTaq Gold 360 Master Mix AmpliTaq Gold 360 DNA Polymerase 360 Coverage for a Full Range of Targets AmpliTaq Gold 360 Master Mix
More informationPrimeSTAR HS DNA Polymerase
Cat. # R010A For Research Use PrimeSTAR HS DNA Polymerase Product Manual Table of Contents I. Description...3 II. III. IV. Components...3 Storage...3 Features...3 V. General Composition of PCR Reaction
More informationChapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company
Genetic engineering: humans Gene replacement therapy or gene therapy Many technical and ethical issues implications for gene pool for germ-line gene therapy what traits constitute disease rather than just
More informationTaq98 Hot Start 2X Master Mix
Taq98 Hot Start 2X Master Mix Optimized for 98C Denaturation Lucigen Corporation 2905 Parmenter St, Middleton, WI 53562 USA Toll Free: (888) 575-9695 (608) 831-9011 FAX: (608) 831-9012 lucigen@lucigen.com
More informationShort Communication. Corresponding author: I.G. Hamoy E-mail: ighamoy@gmail.com
Short Communication Multiplex PCR panel of microsatellite markers for the tambaqui, Colossoma macropomum, developed as a tool for use in conservation and broodstock management I.G. Hamoy and S. Santos
More informationBacReady TM Multiplex PCR System
BacReady TM Multiplex PCR System Technical Manual No. 0191 Version 10112010 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI Detailed Experimental
More informationTechnical Note. Roche Applied Science. No. LC 18/2004. Assay Formats for Use in Real-Time PCR
Roche Applied Science Technical Note No. LC 18/2004 Purpose of this Note Assay Formats for Use in Real-Time PCR The LightCycler Instrument uses several detection channels to monitor the amplification of
More informationquantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476
BioScience quantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476 This method describes a Real-time semi-quantitative TaqMan PCR procedure for the determination of
More informationGene Mapping Techniques
Gene Mapping Techniques OBJECTIVES By the end of this session the student should be able to: Define genetic linkage and recombinant frequency State how genetic distance may be estimated State how restriction
More informationGenetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis
Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype
More informationTroubleshooting Sequencing Data
Troubleshooting Sequencing Data Troubleshooting Sequencing Data No recognizable sequence (see page 7-10) Insufficient Quantitate the DNA. Increase the amount of DNA in the sequencing reactions. See page
More informationCatalina Monzó n-argü ello Æ Joaquín Muñ oz Æ Adolfo Marco Æ Luis Felipe Ló pez-jurado Æ Ciro Rico
Twelve new polymorphic microsatellite markers from the loggerhead sea turtle (Caretta caretta) and cross-species amplification on other marine turtle species Catalina Monzó n-argü ello Æ Joaquín Muñ oz
More informationDNA: A Person s Ultimate Fingerprint
A partnership between the UAB Center for Community Outreach Development and McWane Center DNA: A Person s Ultimate Fingerprint This project is supported by a Science Education Partnership Award (SEPA)
More informationSERVICES CATALOGUE WITH SUBMISSION GUIDELINES
SERVICES CATALOGUE WITH SUBMISSION GUIDELINES 3921 Montgomery Road Cincinnati, Ohio 45212 513-841-2428 www.agctsequencing.com CONTENTS Welcome Dye Terminator Sequencing DNA Sequencing Services - Full Service
More informationSeventy-five EST-linked Atlantic salmon (Salmo salar L.) microsatellite markers and their cross-amplification in five salmonid species
Molecular Ecology Notes (2005) 5, 282 288 doi: 10.1111/j.1471-8286.2005.00902.x Blackwell Publishing, Ltd. PRIMER NOTE Seventy-five EST-linked Atlantic salmon (Salmo salar L.) microsatellite markers and
More informationCommonly Used STR Markers
Commonly Used STR Markers Repeats Satellites 100 to 1000 bases repeated Minisatellites VNTR variable number tandem repeat 10 to 100 bases repeated Microsatellites STR short tandem repeat 2 to 6 bases repeated
More informationRT-PCR: Two-Step Protocol
RT-PCR: Two-Step Protocol We will provide both one-step and two-step protocols for RT-PCR. We recommend the twostep protocol for this class. In the one-step protocol, the components of RT and PCR are mixed
More informationIntroduction. Preparation of Template DNA
Procedures and Recommendations for DNA Sequencing at the Plant-Microbe Genomics Facility Ohio State University Biological Sciences Building Room 420, 484 W. 12th Ave., Columbus OH 43210 Telephone: 614/247-6204;
More informationThe Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics
The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics The GS Junior System The Power of Next-Generation Sequencing on Your Benchtop Proven technology: Uses the same long
More informationHow many of you have checked out the web site on protein-dna interactions?
How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss
More informationProcedures For DNA Sequencing
Procedures For DNA Sequencing Plant-Microbe Genomics Facility (PMGF) Ohio State University 420 Biological Sciences Building 484 W. 12th Ave., Columbus OH 43210 Telephone: 614/247-6204 FAX: 614/292-6337
More informationGenomics Services @ GENterprise
Genomics Services @ GENterprise since 1998 Mainz University spin-off privately financed 6-10 employees since 2006 Genomics Services @ GENterprise Sequencing Service (Sanger/3730, 454) Genome Projects (Bacteria,
More informationGENOTYPING ASSAYS AT ZIRC
GENOTYPING ASSAYS AT ZIRC A. READ THIS FIRST - DISCLAIMER Dear ZIRC user, We now provide detailed genotyping protocols for a number of zebrafish lines distributed by ZIRC. These protocols were developed
More informationDNA FRAGMENT ANALYSIS by Capillary Electrophoresis
DNA FRAGMENT ANALYSIS by Capillary Electrophoresis USER GUIDE DNA Fragment Analysis by Capillary Electrophoresis Publication Number 4474504 Rev. A Revision Date September 2012 For Research Use Only. Not
More informationBiotechnology: DNA Technology & Genomics
Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 The BIG Questions How can we use our knowledge of DNA to: diagnose disease or defect? cure disease or defect? change/improve organisms? What
More informationApplication Guide... 2
Protocol for GenomePlex Whole Genome Amplification from Formalin-Fixed Parrafin-Embedded (FFPE) tissue Application Guide... 2 I. Description... 2 II. Product Components... 2 III. Materials to be Supplied
More informationIntroduction To Real Time Quantitative PCR (qpcr)
Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors
More informationFast PCR: General Considerations for Minimizing Run Times and Maximizing Throughput
amplification tech note 5362 Fast PCR: General Considerations for Minimizing Run Times and Maximizing Throughput Daniel Sullivan, Babette Fahey, and David Titus, Bio-Rad Laboratories, Inc., Waltham, MA
More information1/12 Dideoxy DNA Sequencing
1/12 Dideoxy DNA Sequencing Dideoxy DNA sequencing utilizes two steps: PCR (polymerase chain reaction) amplification of DNA using dideoxy nucleoside triphosphates (Figures 1 and 2)and denaturing polyacrylamide
More informationBecker Muscular Dystrophy
Muscular Dystrophy A Case Study of Positional Cloning Described by Benjamin Duchenne (1868) X-linked recessive disease causing severe muscular degeneration. 100 % penetrance X d Y affected male Frequency
More informationTitle: Characterization of microsatellite primers for Bembidion lampros through
1 2 Title: Characterization of microsatellite primers for Bembidion lampros through 454-sequencing of the genome. 3 4 C Marchi 1, LW Andersen 2, F Panitz 3, L-E Holm 3, V Loeschcke 1 5 6 7 8 9 10 1 Integrative
More informationHiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
More informationEU Reference Laboratory for E. coli Department of Veterinary Public Health and Food Safety Unit of Foodborne Zoonoses Istituto Superiore di Sanità
Identification and characterization of Verocytotoxin-producing Escherichia coli (VTEC) by Real Time PCR amplification of the main virulence genes and the genes associated with the serogroups mainly associated
More informationGenScript BloodReady TM Multiplex PCR System
GenScript BloodReady TM Multiplex PCR System Technical Manual No. 0174 Version 20040915 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI
More informationEssentials of Real Time PCR. About Sequence Detection Chemistries
Essentials of Real Time PCR About Real-Time PCR Assays Real-time Polymerase Chain Reaction (PCR) is the ability to monitor the progress of the PCR as it occurs (i.e., in real time). Data is therefore collected
More informationInverse PCR & Cycle Sequencing of P Element Insertions for STS Generation
BDGP Resources Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation For recovery of sequences flanking PZ, PlacW and PEP elements E. Jay Rehm Berkeley Drosophila Genome Project I.
More informationPyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-)
PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-) FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE Lucigen Corporation 2905 Parmenter St, Middleton, WI 53562 USA Toll Free: (888) 575-9695 (608)
More information2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.
1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence
More informationThe Techniques of Molecular Biology: Forensic DNA Fingerprinting
Revised Fall 2011 The Techniques of Molecular Biology: Forensic DNA Fingerprinting The techniques of molecular biology are used to manipulate the structure and function of molecules such as DNA and proteins
More informationAmpFlSTR Identifiler Direct PCR Amplification Kit
USER GUIDE AmpFlSTR Identifiler Direct PCR Amplification Kit for use with: 200 reaction kit (Part no. 4467831) 1000 reaction kit (Part no. 4408580) Publication Part Number 4415125 Rev. J For Forensic or
More informationDNA Core Facility: DNA Sequencing Guide
DNA Core Facility: DNA Sequencing Guide University of Missouri-Columbia 216 Life Sciences Center Columbia, MO 65211 http://biotech.missouri.edu/dnacore/ Table of Contents 1. Evaluating Sequencing Data..
More informationGenome Sequencer System. Amplicon Sequencing. Application Note No. 5 / February 2007. www.roche-applied-science.com
Genome Sequencer System Application Note No. 5 / February 2007 Amplicon Sequencing www.roche-applied-science.com 1 Amplicon Sequencing Corresponding author: Tom Jarvie, 454 Life Sciences Corporation, Branford,
More informationBiology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA
Page 1 of 5 Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA Genetics Exercise: Understanding how meiosis affects genetic inheritance and DNA patterns
More informationTaqMan Fast Advanced Master Mix. Protocol
TaqMan Fast Advanced Master Mix Protocol For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in this document is subject to change without notice. APPLIED
More informationRecombinant DNA Unit Exam
Recombinant DNA Unit Exam Question 1 Restriction enzymes are extensively used in molecular biology. Below are the recognition sites of two of these enzymes, BamHI and BclI. a) BamHI, cleaves after the
More informationONLINE SUPPLEMENTAL MATERIAL. Allele-Specific Expression of Angiotensinogen in Human Subcutaneous Adipose Tissue
ONLINE SUPPLEMENTAL MATERIAL Allele-Specific Expression of Angiotensinogen in Human Subcutaneous Adipose Tissue Sungmi Park 1, Ko-Ting Lu 1, Xuebo Liu 1, Tapan K. Chatterjee 2, Steven M. Rudich 3, Neal
More informationPCR was carried out in a reaction volume of 20 µl using the ABI AmpliTaq GOLD kit (ABI,
Supplemental Text/Tables PCR Amplification and Sequencing PCR was carried out in a reaction volume of 20 µl using the ABI AmpliTaq GOLD kit (ABI, Foster City, CA). Each PCR reaction contained 20 ng genomic
More information510K Summary. This summary of 510(k) safety and effectiveness information is being submitted in accordance with the requirements of 21 CFR 807.92.
510K Summary This summary of 510(k) safety and effectiveness information is being submitted in accordance with the requirements of 21 CFR 807.92. Submitter: Contact: One Lambda, Incorporated 21001 Kittridge
More informationArtisan Scientific is You~ Source for: Quality New and Certified-Used/Pre:-awned ECJuiflment
Looking for more information? Visit us on the web at http://www.artisan-scientific.com for more information: Price Quotations Drivers Technical Specifications. Manuals and Documentation Artisan Scientific
More informationABSTRACT. Promega Corporation, Updated September 2008. http://www.promega.com/pubhub. 1 Campbell-Staton, S.
A Modified Wizard SV Genomic DNA Purification System Protocol to Purify Genomic DNA... A Modified Wizard SV Genomic DNA Purification System Protocol to Purify Genomic DNA from Shed Reptile Skin ABSTRACT
More informationA Fast, Accurate, and Automated Workflow for Multi Locus Sequence Typing of Bacterial Isolates
Application Note MLST A Fast, Accurate, and Automated Workflow for Multi Locus Sequence Typing of Bacterial Isolates Using Applied Biosystems 3130 and 3730 Series Capillary Electrophoresis Systems and
More informationRecombinant DNA Technology
Recombinant DNA Technology Dates in the Development of Gene Cloning: 1965 - plasmids 1967 - ligase 1970 - restriction endonucleases 1972 - first experiments in gene splicing 1974 - worldwide moratorium
More informationPicoMaxx High Fidelity PCR System
PicoMaxx High Fidelity PCR System Instruction Manual Catalog #600420 (100 U), #600422 (500 U), and #600424 (1000 U) Revision C Research Use Only. Not for Use in Diagnostic Procedures. 600420-12 LIMITED
More informationJuly 7th 2009 DNA sequencing
July 7th 2009 DNA sequencing Overview Sequencing technologies Sequencing strategies Sample preparation Sequencing instruments at MPI EVA 2 x 5 x ABI 3730/3730xl 454 FLX Titanium Illumina Genome Analyzer
More informationNucleic Acid Techniques in Bacterial Systematics
Nucleic Acid Techniques in Bacterial Systematics Edited by Erko Stackebrandt Department of Microbiology University of Queensland St Lucia, Australia and Michael Goodfellow Department of Microbiology University
More informationLecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology
Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,
More informationID kit. imegen Anchovies II. and E. japonicus) DNA detection by. User manual. Anchovies species (E. encrasicolus. sequencing.
User manual imegen Anchovies II ID kit Anchovies species (E. encrasicolus and E. japonicus) DNA detection by sequencing Reference: Made in Spain The information in this guide is subject to change without
More informationNext Generation Sequencing
Next Generation Sequencing DNA sequence represents a single format onto which a broad range of biological phenomena can be projected for high-throughput data collection Over the past three years, massively
More informationReal-Time PCR Vs. Traditional PCR
Real-Time PCR Vs. Traditional PCR Description This tutorial will discuss the evolution of traditional PCR methods towards the use of Real-Time chemistry and instrumentation for accurate quantitation. Objectives
More informationData Analysis for Ion Torrent Sequencing
IFU022 v140202 Research Use Only Instructions For Use Part III Data Analysis for Ion Torrent Sequencing MANUFACTURER: Multiplicom N.V. Galileilaan 18 2845 Niel Belgium Revision date: August 21, 2014 Page
More informationReverse Transcription System
TECHNICAL BULLETIN Reverse Transcription System Instruc ons for use of Product A3500 Revised 1/14 TB099 Reverse Transcription System All technical literature is available on the Internet at: www.promega.com/protocols/
More informationGene Expression Assays
APPLICATION NOTE TaqMan Gene Expression Assays A mpl i fic ationef ficienc yof TaqMan Gene Expression Assays Assays tested extensively for qpcr efficiency Key factors that affect efficiency Efficiency
More informationRecombinant DNA & Genetic Engineering. Tools for Genetic Manipulation
Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna
More informationBiotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College
Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology
More informationIndividualization of tiger by using microsatellites
Forensic Science International 151 (2005) 45 51 www.elsevier.com/locate/forsciint Individualization of tiger by using microsatellites Yan Chun Xu a,b, *,BoLi a, Wan Shui Li c, Su Ying Bai a, Yu Jin a,
More informationHCS604.03 Exercise 1 Dr. Jones Spring 2005. Recombinant DNA (Molecular Cloning) exercise:
HCS604.03 Exercise 1 Dr. Jones Spring 2005 Recombinant DNA (Molecular Cloning) exercise: The purpose of this exercise is to learn techniques used to create recombinant DNA or clone genes. You will clone
More informationThermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual
Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual F- 470S 20 cdna synthesis reactions (20 µl each) F- 470L 100 cdna synthesis reactions (20 µl each) Table of contents 1. Description...
More informationTIANquick Mini Purification Kit
TIANquick Mini Purification Kit For purification of PCR products, 100 bp to 20 kb www.tiangen.com TIANquick Mini Purification Kit (Spin column) Cat no. DP203 Kit Contents Contents Buffer BL Buffer PB Buffer
More informationPCR Instruments and Consumables
Index Page GeneAmp PCR Instrument Systems 2 GeneAmp PCR System 9700 Components 3 Accessories and Software for GeneAmp PCR Instrument Systems 4 Disposables 5 PCR Enzymes 7 GeneAmp PCR Kits 12 RNA PCR Kits
More informationDNA Fingerprinting. Unless they are identical twins, individuals have unique DNA
DNA Fingerprinting Unless they are identical twins, individuals have unique DNA DNA fingerprinting The name used for the unambiguous identifying technique that takes advantage of differences in DNA sequence
More informationSYBR Green Realtime PCR Master Mix -Plus-
Instruction manual SYBR Green Realtime PCR Master Mix -Plus- 0810 F0925K SYBR Green Realtime PCR Master Mix -Plus- Contents QPK-212T 1mLx1 QPK-212 1mLx5 Store at -20 C, protected from light [1] Introduction
More informationComputer with GeneMapper ID (version 3.2.1 or most current) software Microsoft Excel, Word Print2PDF software
Procedure for GeneMapper ID for Casework 1.0 Purpose-This procedure specifies the steps for performing analysis on DNA samples amplified with AmpFlSTR Identifiler Plus using the GeneMapper ID (GMID) software.
More informationrestriction enzymes 350 Home R. Ward: Spring 2001
restriction enzymes 350 Home Restriction Enzymes (endonucleases): molecular scissors that cut DNA Properties of widely used Type II restriction enzymes: recognize a single sequence of bases in dsdna, usually
More informationMolecular Diagnostics in the Clinical Microbiology Laboratory
Molecular Diagnostics in the Clinical Microbiology Laboratory Patrick Tang, MD, PhD, FRCPC B.C. Centre for Disease Control University of British Columbia Molecular Diagnostics in the Clinical Microbiology
More informationProtocols. Internal transcribed spacer region (ITS) region. Niklaus J. Grünwald, Frank N. Martin, and Meg M. Larsen (2013)
Protocols Internal transcribed spacer region (ITS) region Niklaus J. Grünwald, Frank N. Martin, and Meg M. Larsen (2013) The nuclear ribosomal RNA (rrna) genes (small subunit, large subunit and 5.8S) are
More informationAnalysis of the DNA Methylation Patterns at the BRCA1 CpG Island
Analysis of the DNA Methylation Patterns at the BRCA1 CpG Island Frédérique Magdinier 1 and Robert Dante 2 1 Laboratory of Molecular Biology of the Cell, Ecole Normale Superieure, Lyon, France 2 Laboratory
More informationQuantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit
Product Bulletin Human Identification Quantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit The Quantifiler kits produce reliable and reproducible results, helping to
More informationGenotyping by sequencing and data analysis. Ross Whetten North Carolina State University
Genotyping by sequencing and data analysis Ross Whetten North Carolina State University Stein (2010) Genome Biology 11:207 More New Technology on the Horizon Genotyping By Sequencing Timeline 2007 Complexity
More informationIdentification of the VTEC serogroups mainly associated with human infections by conventional PCR amplification of O-associated genes
Identification of the VTEC serogroups mainly associated with human infections by conventional PCR amplification of O-associated genes 1. Aim and field of application The present method concerns the identification
More informationA Primer of Genome Science THIRD
A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:
More informationPCR & DNA Sequencing. PCR= Polymerase Chain Reaction. PCR applications
PCR= Polymerase Chain Reaction PCR & DNA Sequencing Biology 224 Instructor: Tom Peavy March 20, 2006 DNA photocopier integral tool for molecular biologists work horse versatile (many applications) not
More informationHepatitis B Virus Genemer Mix
Product Manual Hepatitis B Virus Genemer Mix Primer Pair for amplification of HBV Specific DNA Fragment Includes Internal Negative Control Primers and Template Catalog No.: 60-2007-12 Store at 20 o C For
More informationDNA Sequencing Handbook
Genomics Core 147 Biotechnology Building Ithaca, New York 14853-2703 Phone: (607) 254-4857; Fax (607) 254-4847 Web: http://cores.lifesciences.cornell.edu/brcinfo/ Email: DNA_Services@cornell.edu DNA Sequencing
More informationAFLP System Analysis Getting Started Guide
GeneMapper Software Version 4.1 AFLP System Analysis Getting Started Guide Getting Started Setting Up the Analysis Analyzing and Examining the Data Exporting and Printing the Analyzed Data GeneMapper
More informationDNA-functionalized hydrogels for confined membrane-free in vitro transcription/translation
Electronic Supplementary Material (ESI) for Lab on a Chip. This journal is The Royal Society of Chemistry 2014 DNA-functionalized hydrogels for confined membrane-free in vitro transcription/translation
More informationNext Generation Sequencing
Next Generation Sequencing Technology and applications 10/1/2015 Jeroen Van Houdt - Genomics Core - KU Leuven - UZ Leuven 1 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977
More informationCCR Biology - Chapter 9 Practice Test - Summer 2012
Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible
More informationSanger Sequencing and Quality Assurance. Zbigniew Rudzki Department of Pathology University of Melbourne
Sanger Sequencing and Quality Assurance Zbigniew Rudzki Department of Pathology University of Melbourne Sanger DNA sequencing The era of DNA sequencing essentially started with the publication of the enzymatic
More informationCloning Blunt-End Pfu DNA Polymerase- Generated PCR Fragments into pgem -T Vector Systems
Promega Notes Number 71, 1999, p. 10 Blunt-End Pfu DNA Polymerase- Generated PCR Fragments into pgem -T Vector Systems By Kimberly Knoche, Ph.D., and Dan Kephart, Ph.D. Promega Corporation Corresponding
More informationBrief Communication. B. Freeman, 1 N. Smith, 1 C. Curtis, 1 L. Huckett, 1 J. Mill, 1 and I. W. Craig 1,2
Behavior Genetics, Vol. 33, No. 1, January 2003 ( 2003) Brief Communication DNA from Buccal Swabs Recruited by Mail: Evaluation of Storage Effects on Long-term Stability and Suitability for Multiplex Polymerase
More informationRecombinant DNA and Biotechnology
Recombinant DNA and Biotechnology Chapter 18 Lecture Objectives What Is Recombinant DNA? How Are New Genes Inserted into Cells? What Sources of DNA Are Used in Cloning? What Other Tools Are Used to Study
More informationIIID 14. Biotechnology in Fish Disease Diagnostics: Application of the Polymerase Chain Reaction (PCR)
IIID 14. Biotechnology in Fish Disease Diagnostics: Application of the Polymerase Chain Reaction (PCR) Background Infectious diseases caused by pathogenic organisms such as bacteria, viruses, protozoa,
More informationmircute mirna qpcr Detection Kit (SYBR Green)
mircute mirna qpcr Detection Kit (SYBR Green) For detection of mirna using real-time RT-PCR (SYBR Green I) www.tiangen.com QP110302 mircute mirna qpcr Detection Kit (SYBR Green) Kit Contents Cat. no. FP401
More informationGenomic DNA Extraction Kit INSTRUCTION MANUAL
Genomic DNA Extraction Kit INSTRUCTION MANUAL Table of Contents Introduction 3 Kit Components 3 Storage Conditions 4 Recommended Equipment and Reagents 4 Introduction to the Protocol 4 General Overview
More informationSingle Nucleotide Polymorphisms (SNPs)
Single Nucleotide Polymorphisms (SNPs) Additional Markers 13 core STR loci Obtain further information from additional markers: Y STRs Separating male samples Mitochondrial DNA Working with extremely degraded
More information