Isolation and characterization of microsatellite markers from the greater ani. Crotophaga major (Aves: Cuculidae)

Size: px
Start display at page:

Download "Isolation and characterization of microsatellite markers from the greater ani. Crotophaga major (Aves: Cuculidae)"

Transcription

1 Page 1 of 9 Isolation and characterization of microsatellite markers from the greater ani Crotophaga major (Aves: Cuculidae) C. RIEHL * and S. M. BOGDANOWICZ * Department of Ecology and Evolutionary Biology, Princeton University, 106A Guyot Hall, Princeton, NJ 08544, USA Department of Migration and Immuno-ecology, Max Planck Institute for Ornithology, Schlossallee 2, Radolfzell, Germany Department of Ecology and Evolutionary Biology, Cornell University, E145 Corson Hall, Ithaca, NY 14853, USA Keywords: Crotophaga, Crotophaga major, greater ani, microsatellite Correspondence: Christina Riehl, Fax:

2 Page 2 of Abstract The greater ani (Crotophaga major) is a communally breeding cuckoo found in Panama and northern South America. We developed 12 polymorphic microsatellite loci in 227 individuals, with a mean of 6.2 alleles per locus (range 4 10) and a mean observed heterozygosity of 0.58 (range ). These markers will allow determination of mating patterns and reproductive success of individuals within communally breeding groups The greater ani (Crotophaga major) practices a rare form of cooperative breeding in which several unrelated females lay eggs in one nest. Breeding groups are composed of socially monogamous pairs; however, the genetic mating system of this species has not been determined. Microsatellite loci have previously been developed for two related species (C. ani, Blanchard & Quinn 2001; and Guira guira, Muniz et al. 2003), but these loci are monomorphic in C. major. Here we describe the development of twelve polymorphic microsatellite loci for C. major, which will be used to determine mating patterns and reproductive success of individuals in nesting groups. Genomic DNA from a nestling greater ani from Barro Colorado Island, Panama, was used to create a DNA library enriched for microsatellites using the ligation procedure of Hamilton et al. (1999), with modifications following Grant & Bogdanowicz (2006). Briefly, blunt-ended DNA fragments were created by digestion with BsaA I and Hinc II, then ligated to SNX linker sequences and enriched for microsatellite sequences by a biotin-capture method using streptavidin-coated magnetic beads. Three libraries were

3 Page 3 of enriched in parallel using the dimeric, trimeric, and tetrameric biotinylated oligonucleotide repeat units described in Barnett et al. (2007). Captured fragments were amplified by polymerase chain reaction (PCR) using a primer complementary to the SNX linker (DYAD thermal cycler, Bio-rad), digested with Nhe I to remove the linker, and ligated into Xba I -digested puc 19 plasmids. Recombinant molecules were electroporated into competent Escherichia coli cells and transformed bacteria were screened with a 33 P-labelled probe of the oligonucleotide sequences used in the enrichment (Grant & Bogdanowicz 2006). We used PCR with universal M13 primers to amplify plasmid DNA from positive clones, then sequenced the products with BigDye Terminator version 3.1 Cycle Sequencing chemistry and an automated 3730xl DNA Analyser (Applied Biosystems). We sequenced 272 clones and designed primer pairs to amplify 30 microsatellite loci using the program Primer3 (Rozen & Skaletsky 2000). Primer pairs from 25 loci were successfully optimized and tested for variability on a panel of 16 unrelated greater ani nestlings from different nesting groups from Gatún Lake, Panama. We then selected twelve polymorphic loci to genotype 227 individuals from the same population (Table 1). For the initial screening for polymorphism, fluorescently labeled PCR products were created using the universal tag method of Schuelke (2000) with the conditions described in Makarewich et al. (2009). A pigtail (5 -GTTTCT) was attached to the reverse primer to ensure complete adenylation of the amplification products (Brownstein et al. 1996). Each PCR reaction contained ng DNA, 10 mm Tris-HCl, 50 mm KCl, 1.5 mm MgCl 2, 0.12 pm of the locus-specific forward primer, 1.2 pm of the universal forward primer, 1.2 pm of the locus-specific reverse primer, 0.2 U Taq polymerase

4 Page 4 of (Sigma), 200 µm dntps (Invitrogen), and H 2 O to bring the final volume to10 µl. Amplifications consisted of an initial denaturation (95 C, 4 min); 35 cycles of denaturation (95 C, 45 s), annealing (locus-specific annealing temperature, 60 s), and extension (72 C, 60 s); and a final extension of 5 min at 72 C. For the expanded genotyping, we amplified multiple loci in the same PCR reaction ( multiplexing ). Each locus-specific forward primer was fluorescently labeled at the 5 end (6-FAM, PET, NED, or VIC; Applied Biosystems) and was used with the pigtailed locus-specific reverse primer as described above. PCR conditions were as described above, with the following changes: i) 0.25 U Taq polymerase; ii) 3.25 mm MgCl 2 ; and iii) primer concentrations varied from 1 to 3 pm to yield similar fluorescent signals. PCR products were sized on an ABI PRISM 3100 Genetic Analyser (Applied Biosystems) with a GeneScan-500 LIZ molecular weight standard (Applied Biosystems) and GeneMapper 3.7 software (Applied Biosystems). We used GenePop 3.4 (Raymond and Rousset 1995) and Cervus 3.0 (Kalinowski et al. 2007) to determine observed and expected heterozygosity levels, conformation to Hardy-Weinberg proportions, null allele frequencies, and gametic disequilibrium between locus pairs. The number of alleles per locus ranged from 4 to 10 (mean = 6.2) with observed heterozygosities ranging from 0.22 to 0.8 (mean = 0.58; Table 2). Tests for gametic disequilibrium were not statistically significant after a Bonferroni correction for multiple comparisons. One locus, CrMa4-1, was not in HWE and had an estimated null allele frequency of 0.3. This may be due to the presence of alleles larger than 500 base pairs and therefore undetectable using a 500-bp size standard; however, it is possible that this locus could still be useful in genotyping analyses when used with a larger size standard.

5 Page 5 of The markers developed here will be used to determine mating patterns and reproductive success of individuals within communal groups, and will allow comparison of extra-pair copulation rates and reproductive skew between C. major and its congeners References Barnett JR, Stenzler LM, Ruiz-Gutierrez V, Bogdanowicz SM, Lovette IJ (2007) Isolation and characterization of microsatellite markers from the white-ruffed manakin Corapipo altera (Aves, Pipridae). Molecular Ecology Resources, 8, Blanchard L, Quinn JS (2001) The characterization of microsatellite loci in the communally breeding smooth-billed ani (Crotophaga ani). Molecular Ecology Notes, 1, Brownstein MH, Carpten JD, Smith JR (1996) Modulation of nontemplated nucleotide addition by Taq DNA polymerase: primer modifications that facilitate genotyping. BioTechniques, 20, Grant JB, Bogdanowicz SM (2006) Isolation and characterization of microsatellite markers from the panic moth, Saucrobotys futilalis L. (Lepidoptera: Pyralidae: Pyraustinae). Molecular Ecology Notes, 6, Hamilton MB, Pincus EL, Difiore A, Fleischer RC (1999) Universal linker and ligation procedures for construction of genomic DNA libraries enriched for microsatellites. BioTechniques, 27, Kalinowski ST, Taper ML, Marshall TC (2007) Revising how the computer program

6 Page 6 of CERVUS accommodates genotyping error increases success in paternity assignment. Molecular Ecology, 16, Makarewich CA, Stenzler LM, Ferretti V, Winkler DW, Lovette IJ (2009) Isolation and characterization of microsatellite markers from three species of swallows in the genus Tachycineta: T. albilinea, T. bicolor and T. leucorrhoa. Molecular Ecology Resources, 9, Muniz LSB, Macedo RHF, Graves J (2003) Isolation and characterization of dinucleotide microsatellite loci in communally breeding Guira cuckoos (Aves: Cuculidae). Molecular Ecology Notes, 3, Raymond M, Rousset F (2004) GenePop Version Updated from Raymond & Rousset (1995) GenePop version 1.2: population genetics software for exact tests and ecumenicism. Journal of Heredity, 83, Rozen S, Skaletsky HJ (2000) Primer3 on the WWW for general users and for biologist programmers. In: Bioinformatics Methods and Protocols: Methods in Molecular Biology (eds. Krawetz S, Misener S), pp Humana Press, Totowa, NJ. Schuelke M (2000) An economic method for the fluorescent labeling of PCR fragments. Nature Biotechnology, 18, Acknowledgments We thank L. M. Stenzler, I. J. Lovette, and the Cornell Laboratory of Ornithology for assistance in microsatellite development and genotyping, and L. Jara for field assistance.

7 Page 7 of This work was supported by the Max Planck Institute for Ornithology, Princeton University, and a NSF Graduate Research Fellowship to C. Riehl

8 Page 8 of 9 Locus Table 1 Microsatellite loci developed in Crotophaga major Fluorescent Dye Label; Multiplex Combination Repeat Motif Primer Sequence (5 3 ) GenBank Accession no. CrMa3-27 VIC; 1 (CAA) 11 (TAA) 7 (CAAA) 5 F: GGTGCTTCCCAAACCTTAT R: TGCTTGTCATCCTCAAGTGG CrMa3-95 FAM; 1 (GTTT) 8 F: CATGCCTTGAACCCTGACTT R: GGGAGAATTCTTTTCCTTGGAC CrMa2-23 FAM; 2 (TC) 43 F: CAGTCTGAGGGAAGCCAAAT R: AAAACCAAACCAACACGAGAA CrMa2-24 PET; 2 (CA) 12 F: AGCAGAACTTTGCCCCTCTT R: ATGGCTGTCAAAATGCTGTG CrMa4-1 FAM; 3 (GAAA) 36 F: TTGCACAGGAAGAGTGGATG R: GTTGCACAGGAGGAAAAAGC CrMa4-6 FAM; 3 (GATA) 10 F: TTGCATGTATGGCATGAGGT R: TCTTCTGGCTGTGTGGATTTC CrMa3-25 VIC; 3 (CTT) 34 F: GTGGGAAAGCTTGAAGAGCA R: CAGAGGTTAAGCTCAAGGAAAA CrMa3-142 NED; 4 (GTT) 18 F: TCCAGTTCCACCTCCCACTA R: GGAAAGAATCTCAGCTTTTGCT CrMa3-37 PET; 4 (GAA) 14 (CAA) 6 (GAA) 15 F: TTCTTACTCTGCGACTGAGCAC R: GTGGGAAAGCTTGAAGAGCA CrMa3-45 VIC; 4 (GTT) 16 (GTTT) 4 F: AATGGTTCGGGTGTGAAGAG R: AGGGTCCAATTTCTGCAGTG CrMa3-8 PET; 5 (CAA) 17 F: AAGTGCCATACATGCTGCTG R: GCAGGTTCCAGTCATTGCTC CrMa3-104 NED; 5 (TAG) 5 CTG(TAG) 3 (GTT) 11 F: TCATGCTCTGGTCCATCATC R: TTGGACTTCTGGTACTGTGTCC GQ GQ GQ GQ GQ GQ GQ GQ GQ GQ GQ GQ144426

9 Page 9 of 9 Table 2 Characteristics of microsatellite loci amplified in Crotophaga major. Ta, optimized annealing temperature; MgCl 2, optimized concentration; n, number of individuals genotyped; N A, number of alleles; H O, observed heterozygosity; H E, expected heterozygosity. Locus T a ( C) MgCl 2 (m) Allele size n N A H O H E range (bp) CrMa CrMa CrMa CrMa CrMa4-1* CrMa CrMa CrMa CrMa CrMa CrMa CrMa * Indicates locus not in HWE

Isolation and characterization of nine microsatellite loci in the Pale Pitcher Plant. MARGARET M. KOOPMAN*, ELIZABETH GALLAGHER, and BRYAN C.

Isolation and characterization of nine microsatellite loci in the Pale Pitcher Plant. MARGARET M. KOOPMAN*, ELIZABETH GALLAGHER, and BRYAN C. Page 1 of 28 1 1 2 3 PERMANENT GENETIC RESOURCES Isolation and characterization of nine microsatellite loci in the Pale Pitcher Plant Sarracenia alata (Sarraceniaceae). 4 5 6 MARGARET M. KOOPMAN*, ELIZABETH

More information

Forensic DNA Testing Terminology

Forensic DNA Testing Terminology Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.

More information

CAP BIOINFORMATICS Su-Shing Chen CISE. 10/5/2005 Su-Shing Chen, CISE 1

CAP BIOINFORMATICS Su-Shing Chen CISE. 10/5/2005 Su-Shing Chen, CISE 1 CAP 5510-8 BIOINFORMATICS Su-Shing Chen CISE 10/5/2005 Su-Shing Chen, CISE 1 Genomic Mapping & Mapping Databases High resolution, genome-wide maps of DNA markers. Integrated maps, genome catalogs and comprehensive

More information

Rapid Acquisition of Unknown DNA Sequence Adjacent to a Known Segment by Multiplex Restriction Site PCR

Rapid Acquisition of Unknown DNA Sequence Adjacent to a Known Segment by Multiplex Restriction Site PCR Rapid Acquisition of Unknown DNA Sequence Adjacent to a Known Segment by Multiplex Restriction Site PCR BioTechniques 25:415-419 (September 1998) ABSTRACT The determination of unknown DNA sequences around

More information

4 General PCR Methods Page

4 General PCR Methods Page Table of Contents General PCR Methods Page PCR Protocol Selection Guide...65.1 Basic PCR... 66.1.1 Hot Start PCR - The new Standard... 66.1.1.1 Reagents and Equipment Required... 66.1.1.2 General Considerations

More information

DNA Sequence Analysis

DNA Sequence Analysis DNA Sequence Analysis Two general kinds of analysis Screen for one of a set of known sequences Determine the sequence even if it is novel Screening for a known sequence usually involves an oligonucleotide

More information

360 Master Mix. , and a supplementary 360 GC Enhancer.

360 Master Mix. , and a supplementary 360 GC Enhancer. Product Bulletin AmpliTaq Gold 360 Master Mix and 360 DNA Polymerase AmpliTaq Gold 360 Master Mix AmpliTaq Gold 360 DNA Polymerase 360 Coverage for a Full Range of Targets AmpliTaq Gold 360 Master Mix

More information

Troubleshooting for PCR and multiplex PCR

Troubleshooting for PCR and multiplex PCR Page 1 of 5 Page designed and maintained by Octavian Henegariu (Email: Tavi's Yale email or Tavi's Yahoo email). As I am currently pursuing a new junior faculty position, the Yale URL and email may change

More information

3. comparison with proteins of known function

3. comparison with proteins of known function Lectures 26 and 27 recombinant DNA technology I. oal of genetics A. historically - easy to isolate total DNA - difficult to isolate individual gene B. recombinant DNA technology C. why get the gene? 1.

More information

PCR Polymerase Chain Reaction

PCR Polymerase Chain Reaction Biological Sciences Initiative HHMI PCR Polymerase Chain Reaction PCR is an extremely powerful technique used to amplify any specific piece of DNA of interest. The DNA of interest is selectively amplified

More information

Bayesian analysis of population structure and the characterization of nine novel

Bayesian analysis of population structure and the characterization of nine novel Page 1 of 11 1 2 3 Bayesian analysis of population structure and the characterization of nine novel microsatellite markers for the study of a Caribbean coral reef Gobiid (Coryphopterus personatus) and

More information

BacReady TM Multiplex PCR System

BacReady TM Multiplex PCR System BacReady TM Multiplex PCR System Technical Manual No. 0191 Version 10112010 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI Detailed Experimental

More information

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Biotechnology and reporter genes Here, a lentivirus is used to carry foreign DNA into chickens. A reporter gene (GFP)indicates that foreign DNA has been successfully transferred. Recombinant DNA continued

More information

PrimeSTAR HS DNA Polymerase

PrimeSTAR HS DNA Polymerase Cat. # R010A For Research Use PrimeSTAR HS DNA Polymerase Product Manual Table of Contents I. Description...3 II. III. IV. Components...3 Storage...3 Features...3 V. General Composition of PCR Reaction

More information

Taq98 Hot Start 2X Master Mix

Taq98 Hot Start 2X Master Mix Taq98 Hot Start 2X Master Mix Optimized for 98C Denaturation Lucigen Corporation 2905 Parmenter St, Middleton, WI 53562 USA Toll Free: (888) 575-9695 (608) 831-9011 FAX: (608) 831-9012 lucigen@lucigen.com

More information

Technical Note. Roche Applied Science. No. LC 18/2004. Assay Formats for Use in Real-Time PCR

Technical Note. Roche Applied Science. No. LC 18/2004. Assay Formats for Use in Real-Time PCR Roche Applied Science Technical Note No. LC 18/2004 Purpose of this Note Assay Formats for Use in Real-Time PCR The LightCycler Instrument uses several detection channels to monitor the amplification of

More information

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Genetic engineering: humans Gene replacement therapy or gene therapy Many technical and ethical issues implications for gene pool for germ-line gene therapy what traits constitute disease rather than just

More information

Biotechnology Test Test

Biotechnology Test Test Log In Sign Up Biotechnology Test Test 15 Matching Questions Regenerate Test 1. Plasmid 2. PCR Process 3. humulin 4. pluripotent 5. polymerase chain reaction (PCR) a b Is much smaller than the human genome,

More information

Chapter 20: Biotechnology: DNA Technology & Genomics

Chapter 20: Biotechnology: DNA Technology & Genomics Biotechnology Chapter 20: Biotechnology: DNA Technology & Genomics The BIG Questions How can we use our knowledge of DNA to: o Diagnose disease or defect? o Cure disease or defect? o Change/improve organisms?

More information

Short Communication. Corresponding author: I.G. Hamoy E-mail: ighamoy@gmail.com

Short Communication. Corresponding author: I.G. Hamoy E-mail: ighamoy@gmail.com Short Communication Multiplex PCR panel of microsatellite markers for the tambaqui, Colossoma macropomum, developed as a tool for use in conservation and broodstock management I.G. Hamoy and S. Santos

More information

Gene Mapping Techniques

Gene Mapping Techniques Gene Mapping Techniques OBJECTIVES By the end of this session the student should be able to: Define genetic linkage and recombinant frequency State how genetic distance may be estimated State how restriction

More information

Genetics Faculty of Agriculture and Veterinary Medicine

Genetics Faculty of Agriculture and Veterinary Medicine Genetics 10201232 Faculty of Agriculture and Veterinary Medicine Instructor: Dr. Jihad Abdallah Topic 15:Recombinant DNA Technology 1 Recombinant DNA Technology Recombinant DNA Technology is the use of

More information

quantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476

quantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476 BioScience quantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476 This method describes a Real-time semi-quantitative TaqMan PCR procedure for the determination of

More information

BIOTECHNOLOGY. What can we do with DNA?

BIOTECHNOLOGY. What can we do with DNA? BIOTECHNOLOGY What can we do with DNA? Biotechnology Manipulation of biological organisms or their components for research and industrial purpose Usually manipulate DNA itself How to study individual gene?

More information

Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis

Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype

More information

Exercise 5: Detection of a Human Alu Element by PCR

Exercise 5: Detection of a Human Alu Element by PCR Exercise 5: Detection of a Human Alu Element by PCR (adapted from Dolan DNA Learning Center, Cold Spring Harbor Laboratory, NY and Science Outreach, Washington University, St. Louis, MO) Background Information

More information

Troubleshooting Sequencing Data

Troubleshooting Sequencing Data Troubleshooting Sequencing Data Troubleshooting Sequencing Data No recognizable sequence (see page 7-10) Insufficient Quantitate the DNA. Increase the amount of DNA in the sequencing reactions. See page

More information

SERVICES CATALOGUE WITH SUBMISSION GUIDELINES

SERVICES CATALOGUE WITH SUBMISSION GUIDELINES SERVICES CATALOGUE WITH SUBMISSION GUIDELINES 3921 Montgomery Road Cincinnati, Ohio 45212 513-841-2428 www.agctsequencing.com CONTENTS Welcome Dye Terminator Sequencing DNA Sequencing Services - Full Service

More information

VeriFiler Direct PCR Amplification Kit

VeriFiler Direct PCR Amplification Kit QUICK REFERENCE VeriFiler Direct PCR Amplification Kit Publication Number 4479554 Rev. A Note: For safety and biohazard guidelines, refer to the Safety section in the VeriFiler Direct PCR Amplification

More information

Seventy-five EST-linked Atlantic salmon (Salmo salar L.) microsatellite markers and their cross-amplification in five salmonid species

Seventy-five EST-linked Atlantic salmon (Salmo salar L.) microsatellite markers and their cross-amplification in five salmonid species Molecular Ecology Notes (2005) 5, 282 288 doi: 10.1111/j.1471-8286.2005.00902.x Blackwell Publishing, Ltd. PRIMER NOTE Seventy-five EST-linked Atlantic salmon (Salmo salar L.) microsatellite markers and

More information

Tools and Techniques. Chapter 10. Genetic Engineering. Restriction endonuclease. 1. Enzymes

Tools and Techniques. Chapter 10. Genetic Engineering. Restriction endonuclease. 1. Enzymes Chapter 10. Genetic Engineering Tools and Techniques 1. Enzymes 2. 3. Nucleic acid hybridization 4. Synthesizing DNA 5. Polymerase Chain Reaction 1 2 1. Enzymes Restriction endonuclease Ligase Reverse

More information

Catalina Monzó n-argü ello Æ Joaquín Muñ oz Æ Adolfo Marco Æ Luis Felipe Ló pez-jurado Æ Ciro Rico

Catalina Monzó n-argü ello Æ Joaquín Muñ oz Æ Adolfo Marco Æ Luis Felipe Ló pez-jurado Æ Ciro Rico Twelve new polymorphic microsatellite markers from the loggerhead sea turtle (Caretta caretta) and cross-species amplification on other marine turtle species Catalina Monzó n-argü ello Æ Joaquín Muñ oz

More information

Artifacts in Genotyping STRs

Artifacts in Genotyping STRs Biology of STRs Artifacts in Genotyping STRs A number of artifacts are possible: Stuttering Non-template additions Microvariants Three peaks Allele dropouts Mutations All interfere with reading a DNA profile

More information

Commonly Used STR Markers

Commonly Used STR Markers Commonly Used STR Markers Repeats Satellites 100 to 1000 bases repeated Minisatellites VNTR variable number tandem repeat 10 to 100 bases repeated Microsatellites STR short tandem repeat 2 to 6 bases repeated

More information

Extraction from Buccal Epithelial Cells

Extraction from Buccal Epithelial Cells Genomic DNA Extraction from Buccal Epithelial Cells The purpose of this lab is to collect a DNA sample from the cells that line the inside of your mouth and to use this sample to explore one of the most

More information

RT-PCR: Two-Step Protocol

RT-PCR: Two-Step Protocol RT-PCR: Two-Step Protocol We will provide both one-step and two-step protocols for RT-PCR. We recommend the twostep protocol for this class. In the one-step protocol, the components of RT and PCR are mixed

More information

MOLECULAR BIOLOGY OVERVIEW NUCLEIC ACIDS: THE BASICS

MOLECULAR BIOLOGY OVERVIEW NUCLEIC ACIDS: THE BASICS MOLECULAR BIOLOGY OVERVIEW NUCLEIC ACIDS: THE BASICS Richard L. Hodinka, Ph.D. University of South Carolina School of Medicine Greenville Greenville Health System, Greenville, SC hodinka@greenvillemed.sc.edu

More information

Chapter 9. Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA

Chapter 9. Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA Chapter 9 Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA Q&A Interferons are species specific, so that interferons to be used in humans must be produced in human cells. Can you think

More information

Perfect Match PCR Enhancer

Perfect Match PCR Enhancer Perfect Match PCR Enhancer Instruction Manual Catalog #600129 (100 U) and #600130 (200 U) Revision C.0 For Research Use Only. Not for use in diagnostic procedures. 600129-12 LIMITED PRODUCT WARRANTY This

More information

The correct answer is c B. Answer b is incorrect. Type II enzymes recognize and cut a specific site, not at random sites.

The correct answer is c B. Answer b is incorrect. Type II enzymes recognize and cut a specific site, not at random sites. 1. A recombinant DNA molecules is one that is a. produced through the process of crossing over that occurs in meiosis b. constructed from DNA from different sources c. constructed from novel combinations

More information

Procedures For DNA Sequencing

Procedures For DNA Sequencing Procedures For DNA Sequencing Plant-Microbe Genomics Facility (PMGF) Ohio State University 420 Biological Sciences Building 484 W. 12th Ave., Columbus OH 43210 Telephone: 614/247-6204 FAX: 614/292-6337

More information

The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics

The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics The GS Junior System The Power of Next-Generation Sequencing on Your Benchtop Proven technology: Uses the same long

More information

DNA: A Person s Ultimate Fingerprint

DNA: A Person s Ultimate Fingerprint A partnership between the UAB Center for Community Outreach Development and McWane Center DNA: A Person s Ultimate Fingerprint This project is supported by a Science Education Partnership Award (SEPA)

More information

Zback Faster Ligation Kit

Zback Faster Ligation Kit Zback Faster Ligation Kit For the highest efficiency cloning of PCR products either blunt or sticky-end Kit Contents Contents TGVTB04 TGVTB04-2 pzback/blunt vector 10 µl 20 µl T4 DNA Ligase 5 µl 10 µl

More information

How many of you have checked out the web site on protein-dna interactions?

How many of you have checked out the web site on protein-dna interactions? How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss

More information

Introduction. Preparation of Template DNA

Introduction. Preparation of Template DNA Procedures and Recommendations for DNA Sequencing at the Plant-Microbe Genomics Facility Ohio State University Biological Sciences Building Room 420, 484 W. 12th Ave., Columbus OH 43210 Telephone: 614/247-6204;

More information

GENOTYPING ASSAYS AT ZIRC

GENOTYPING ASSAYS AT ZIRC GENOTYPING ASSAYS AT ZIRC A. READ THIS FIRST - DISCLAIMER Dear ZIRC user, We now provide detailed genotyping protocols for a number of zebrafish lines distributed by ZIRC. These protocols were developed

More information

Genomics Services @ GENterprise

Genomics Services @ GENterprise Genomics Services @ GENterprise since 1998 Mainz University spin-off privately financed 6-10 employees since 2006 Genomics Services @ GENterprise Sequencing Service (Sanger/3730, 454) Genome Projects (Bacteria,

More information

DNA FRAGMENT ANALYSIS by Capillary Electrophoresis

DNA FRAGMENT ANALYSIS by Capillary Electrophoresis DNA FRAGMENT ANALYSIS by Capillary Electrophoresis USER GUIDE DNA Fragment Analysis by Capillary Electrophoresis Publication Number 4474504 Rev. A Revision Date September 2012 For Research Use Only. Not

More information

Recombinant DNA technology (genetic engineering) involves combining genes from different sources into new cells that can express the genes.

Recombinant DNA technology (genetic engineering) involves combining genes from different sources into new cells that can express the genes. Recombinant DNA technology (genetic engineering) involves combining genes from different sources into new cells that can express the genes. Recombinant DNA technology has had-and will havemany important

More information

The specificity, sensitivity and efficiency of the PCR microsystem based on LTCC technology

The specificity, sensitivity and efficiency of the PCR microsystem based on LTCC technology The specificity, sensitivity and efficiency of the PCR microsystem based on LTCC technology MALGORZATA MALODOBRA 1, PAWEL BEMBNOWICZ 2, ANNA JONKISZ 1, ANNA KARPIEWSKA 1, PATRYCJA SNIADEK 2, ANNA GORECKA-DRZAZGA

More information

SYBR Premix Ex Taq (Tli RNaseH Plus)

SYBR Premix Ex Taq (Tli RNaseH Plus) Cat. # RR420A For Research Use SYBR Premix Ex Taq (Tli RNaseH Plus) Product Manual Table of Contents I. Description... 3 II. Principle... 3 III. Components... 4 IV. Materials Required but not Provided...

More information

HiPer RT-PCR Teaching Kit

HiPer RT-PCR Teaching Kit HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The

More information

11/19/2008. Gene analysis. Sequencing PCR. Northern-blot RT PCR. Western-blot Sequencing. in situ hybridization. Southern-blot

11/19/2008. Gene analysis. Sequencing PCR. Northern-blot RT PCR. Western-blot Sequencing. in situ hybridization. Southern-blot Recombinant technology Gene analysis Sequencing PCR RNA Northern-blot RT PCR Protein Western-blot Sequencing Southern-blot in situ hybridization in situ hybridization Function analysis Histochemical analysis

More information

Recombinant DNA Technology

Recombinant DNA Technology PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology

More information

Application Guide... 2

Application Guide... 2 Protocol for GenomePlex Whole Genome Amplification from Formalin-Fixed Parrafin-Embedded (FFPE) tissue Application Guide... 2 I. Description... 2 II. Product Components... 2 III. Materials to be Supplied

More information

TCB No May Technical Bulletin. GS FLX and GS Junior Systems. Short Fragment Removal for the Amplicon Library Preparation Procedure

TCB No May Technical Bulletin. GS FLX and GS Junior Systems. Short Fragment Removal for the Amplicon Library Preparation Procedure TCB No. 2011-007 May 2013 Technical Bulletin GS FLX and GS Junior Systems Short Fragment Removal for the Amplicon Library Preparation Procedure Introduction Some library preparation methods may result

More information

GenScript BloodReady TM Multiplex PCR System

GenScript BloodReady TM Multiplex PCR System GenScript BloodReady TM Multiplex PCR System Technical Manual No. 0174 Version 20040915 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI

More information

Chapter 12 - DNA Technology

Chapter 12 - DNA Technology Bio 100 DNA Technology 1 Chapter 12 - DNA Technology Among bacteria, there are 3 mechanisms for transferring genes from one cell to another cell: transformation, transduction, and conjugation 1. Transformation

More information

Title: Characterization of microsatellite primers for Bembidion lampros through

Title: Characterization of microsatellite primers for Bembidion lampros through 1 2 Title: Characterization of microsatellite primers for Bembidion lampros through 454-sequencing of the genome. 3 4 C Marchi 1, LW Andersen 2, F Panitz 3, L-E Holm 3, V Loeschcke 1 5 6 7 8 9 10 1 Integrative

More information

Biotechnology: DNA Technology & Genomics

Biotechnology: DNA Technology & Genomics Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 The BIG Questions How can we use our knowledge of DNA to: diagnose disease or defect? cure disease or defect? change/improve organisms? What

More information

Sequencing a Genome: Inside the Washington University Genome Sequencing Center. Activity Supplement Paper PCR (DNA Amplification)

Sequencing a Genome: Inside the Washington University Genome Sequencing Center. Activity Supplement Paper PCR (DNA Amplification) Sequencing a Genome: Inside the Washington University Genome Sequencing Center Activity Supplement (DNA Amplification) Project Outline The multimedia project Sequencing a Genome: Inside the Washington

More information

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing Molecular Methods Sylvain Forêt March 2010 http://dayhoff.anu.edu.au/~sf/next_gen_seq 1 Introduction 2 Sanger 3 Illumina 4 454 5 SOLiD 6 Summary The Genomic Age Recent landmarks

More information

E.Z.N.A. Plant Seed Direct PCR Kit

E.Z.N.A. Plant Seed Direct PCR Kit E.Z.N.A. Plant Seed Direct PCR Kit TQ2900-00 TQ2900-01 20 preps 100 preps June 2013 E.Z.N.A. Plant Seed Direct PCR Kit Table of Contents Introduction...2 Kit Contents/Storage and Stability...3 Suggested

More information

Fast PCR: General Considerations for Minimizing Run Times and Maximizing Throughput

Fast PCR: General Considerations for Minimizing Run Times and Maximizing Throughput amplification tech note 5362 Fast PCR: General Considerations for Minimizing Run Times and Maximizing Throughput Daniel Sullivan, Babette Fahey, and David Titus, Bio-Rad Laboratories, Inc., Waltham, MA

More information

Blend Taq / Blend Taq -Plus-

Blend Taq / Blend Taq -Plus- Instruction manual Blend Taq and Blend Taq -Plus- 0810 F0938K Blend Taq / Blend Taq -Plus- BTQ-101 250 U 200 reactions BTQ-201 250 U 200 reactions Contents [1] Introduction

More information

Realtime PCR Master Mix

Realtime PCR Master Mix Instruction manual Realtime PCR Master Mix 0810 F0923K Realtime PCR Master Mix Contents [1] Introduction [2] Components [3] Primer/Probe design [4] Detection [5] Specimens [6] Protocol 1. TaqMan assay

More information

Introduction To Real Time Quantitative PCR (qpcr)

Introduction To Real Time Quantitative PCR (qpcr) Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors

More information

AmpFlSTR Identifiler Direct PCR Amplification Kit

AmpFlSTR Identifiler Direct PCR Amplification Kit USER GUIDE AmpFlSTR Identifiler Direct PCR Amplification Kit for use with: 200 reaction kit (Part no. 4467831) 1000 reaction kit (Part no. 4408580) Publication Part Number 4415125 Rev. J For Forensic or

More information

1/12 Dideoxy DNA Sequencing

1/12 Dideoxy DNA Sequencing 1/12 Dideoxy DNA Sequencing Dideoxy DNA sequencing utilizes two steps: PCR (polymerase chain reaction) amplification of DNA using dideoxy nucleoside triphosphates (Figures 1 and 2)and denaturing polyacrylamide

More information

DNA Sequencing: The Past, the Present and the Future

DNA Sequencing: The Past, the Present and the Future STARS Mini-Symposium 9/12/2016 DNA Sequencing: The Past, the Present and the Future Ralf Kittler, Ph.D. McDermott Center for Human Growth and Development ralf.kittler@utsouthwestern.edu Outline DNA sequencing

More information

Becker Muscular Dystrophy

Becker Muscular Dystrophy Muscular Dystrophy A Case Study of Positional Cloning Described by Benjamin Duchenne (1868) X-linked recessive disease causing severe muscular degeneration. 100 % penetrance X d Y affected male Frequency

More information

Lab 1: Who s Your Daddy? (AKA DNA Purification and PCR)

Lab 1: Who s Your Daddy? (AKA DNA Purification and PCR) Lab 1: Who s Your Daddy? (AKA DNA Purification and PCR) Goals of the lab: 1. To understand how DNA s chemical properties can be exploited for purification 2. To learn practical applications of DNA purification

More information

Chapter 20: Biotechnology

Chapter 20: Biotechnology Name Period The AP Biology exam has reached into this chapter for essay questions on a regular basis over the past 15 years. Student responses show that biotechnology is a difficult topic. This chapter

More information

EU Reference Laboratory for E. coli Department of Veterinary Public Health and Food Safety Unit of Foodborne Zoonoses Istituto Superiore di Sanità

EU Reference Laboratory for E. coli Department of Veterinary Public Health and Food Safety Unit of Foodborne Zoonoses Istituto Superiore di Sanità Identification and characterization of Verocytotoxin-producing Escherichia coli (VTEC) by Real Time PCR amplification of the main virulence genes and the genes associated with the serogroups mainly associated

More information

Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation

Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation BDGP Resources Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation For recovery of sequences flanking PZ, PlacW and PEP elements E. Jay Rehm Berkeley Drosophila Genome Project I.

More information

PCR Optimization: Reaction Conditions and Components Sample Volume and Reaction Tubes Vapor Barrier and Thermal Transfer Fluid Template DNA or RNA

PCR Optimization: Reaction Conditions and Components Sample Volume and Reaction Tubes Vapor Barrier and Thermal Transfer Fluid Template DNA or RNA PCR Optimization: Reaction Conditions and Components The GeneAmp PCR process is widely employed in a tremendous variety of experimental applications to produce high yields of specific DNA target sequences.

More information

Essentials of Real Time PCR. About Sequence Detection Chemistries

Essentials of Real Time PCR. About Sequence Detection Chemistries Essentials of Real Time PCR About Real-Time PCR Assays Real-time Polymerase Chain Reaction (PCR) is the ability to monitor the progress of the PCR as it occurs (i.e., in real time). Data is therefore collected

More information

Appendix D: Pre-lab Assignments and Gel Electrophoresis Worksheet

Appendix D: Pre-lab Assignments and Gel Electrophoresis Worksheet Appendix D: Pre-lab Assignments and Gel Electrophoresis Worksheet PCR Pre-Lab (pg. 1-3) PCR Pre-Lab Answers (pg. 4-7) RNAi Pre-Lab (pg. 8) RNAi Pre-Lab Answers (pg. 9-10 Gel Electrophoresis Worksheet (pg.

More information

MOLECULAR GENETICS GENETIC ENGINEERING RECOMBINANT DNA. Molecular Genetics Activity #6 page 1

MOLECULAR GENETICS GENETIC ENGINEERING RECOMBINANT DNA. Molecular Genetics Activity #6 page 1 AP BIOLOGY MOLECULAR GENETICS ACTIVITY #6 NAME DATE HOUR RECOMBINANT DNA GENETIC ENGINEERING Molecular Genetics Activity #6 page 1 GENETIC ENGINEERING Molecular Genetics Activity #6 page 2 PART I: PRODUCING

More information

Advantages of pspark over other popular DNA Cloning systems on the market: pgem -T and TOPO TA cloning

Advantages of pspark over other popular DNA Cloning systems on the market: pgem -T and TOPO TA cloning Advantages of pspark over other popular DNA Cloning systems on the market: pgem -T and TOPO TA cloning This study compares the efficiency of the pspark I DNA Cloning system with other popular cloning systems,

More information

Biotechnology. Selective breeding Use of microbes (bacteria & yeast)

Biotechnology. Selective breeding Use of microbes (bacteria & yeast) Biotechnology bio and technology The use of living organisms to solve problems or make useful products. Biotechnology has been practiced for the last 10,000 years. Selective breeding Use of microbes (bacteria

More information

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99. 1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence

More information

FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE.

FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE. Instruction manual KOD -Plus- 0902 F0934K KOD -Plus- Contents [1] Introduction [2] Components [3] Quality testing [4] Primer design [5] Cloning of PCR products [6] Protocol 1. Standard reaction setup 2.

More information

Recombinant DNA Unit Exam

Recombinant DNA Unit Exam Recombinant DNA Unit Exam Question 1 Restriction enzymes are extensively used in molecular biology. Below are the recognition sites of two of these enzymes, BamHI and BclI. a) BamHI, cleaves after the

More information

PCR Product Pre-Sequencing Kit

PCR Product Pre-Sequencing Kit All goods and services are sold subject to the terms and conditions of sale of the company within USB Corporation or the group which supplies them. A copy of these terms and conditions is available on

More information

The Techniques of Molecular Biology: Forensic DNA Fingerprinting

The Techniques of Molecular Biology: Forensic DNA Fingerprinting Revised Fall 2011 The Techniques of Molecular Biology: Forensic DNA Fingerprinting The techniques of molecular biology are used to manipulate the structure and function of molecules such as DNA and proteins

More information

Recipient Cell. DNA Foreign DNA. Recombinant DNA

Recipient Cell. DNA Foreign DNA. Recombinant DNA Module 4B Biotechnology In this module, we will examine some of the techniques scientists have developed to study and manipulate the DNA of living organisms. Objective # 7 Explain what genetic recombination

More information

510K Summary. This summary of 510(k) safety and effectiveness information is being submitted in accordance with the requirements of 21 CFR 807.92.

510K Summary. This summary of 510(k) safety and effectiveness information is being submitted in accordance with the requirements of 21 CFR 807.92. 510K Summary This summary of 510(k) safety and effectiveness information is being submitted in accordance with the requirements of 21 CFR 807.92. Submitter: Contact: One Lambda, Incorporated 21001 Kittridge

More information

Genome Sequencer System. Amplicon Sequencing. Application Note No. 5 / February 2007. www.roche-applied-science.com

Genome Sequencer System. Amplicon Sequencing. Application Note No. 5 / February 2007. www.roche-applied-science.com Genome Sequencer System Application Note No. 5 / February 2007 Amplicon Sequencing www.roche-applied-science.com 1 Amplicon Sequencing Corresponding author: Tom Jarvie, 454 Life Sciences Corporation, Branford,

More information

Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA

Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA Page 1 of 5 Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA Genetics Exercise: Understanding how meiosis affects genetic inheritance and DNA patterns

More information

WORKING GROUP ON BIOCHEMICAL AND MOLECULAR TECHNIQUES AND DNA-PROFILING IN PARTICULAR. Eighth Session Tsukuba, Japan, September 3 to 5, 2003

WORKING GROUP ON BIOCHEMICAL AND MOLECULAR TECHNIQUES AND DNA-PROFILING IN PARTICULAR. Eighth Session Tsukuba, Japan, September 3 to 5, 2003 E BMT/8/8 ORIGINAL: English DATE: August 14, 200 INTERNATIONAL UNION FOR THE PROTECTION OF NEW VARIETIES OF PLANTS GENEVA WORKING GROUP ON BIOCHEMICAL AND MOLECULAR TECHNIQUES AND DNA-PROFILING IN PARTICULAR

More information

Chapter 10 Manipulating Genes

Chapter 10 Manipulating Genes How DNA Molecules Are Analyzed Chapter 10 Manipulating Genes Until the development of recombinant DNA techniques, crucial clues for understanding how cell works remained lock in the genome. Important advances

More information

Super One-step RT-PCR Kit for Virus Detection

Super One-step RT-PCR Kit for Virus Detection Super One-step RT-PCR Kit for Virus Detection For fast and sensitive one-step RT-PCR with highly specificity www.tiangen.com/en SD121221 Super One-step RT-PCR Kit Kit Contents Contents Cat. no. SD103 SD103

More information

Lecture 38: DNA Fingerprinting

Lecture 38: DNA Fingerprinting Lecture 38: DNA Fingerprinting (DNA technology) The most awesome and powerful tool acquired by man since the splitting of atoms - The Time Magazine (USA) Conventional fingerprint of an individual comes

More information

PCR was carried out in a reaction volume of 20 µl using the ABI AmpliTaq GOLD kit (ABI,

PCR was carried out in a reaction volume of 20 µl using the ABI AmpliTaq GOLD kit (ABI, Supplemental Text/Tables PCR Amplification and Sequencing PCR was carried out in a reaction volume of 20 µl using the ABI AmpliTaq GOLD kit (ABI, Foster City, CA). Each PCR reaction contained 20 ng genomic

More information

ONLINE SUPPLEMENTAL MATERIAL. Allele-Specific Expression of Angiotensinogen in Human Subcutaneous Adipose Tissue

ONLINE SUPPLEMENTAL MATERIAL. Allele-Specific Expression of Angiotensinogen in Human Subcutaneous Adipose Tissue ONLINE SUPPLEMENTAL MATERIAL Allele-Specific Expression of Angiotensinogen in Human Subcutaneous Adipose Tissue Sungmi Park 1, Ko-Ting Lu 1, Xuebo Liu 1, Tapan K. Chatterjee 2, Steven M. Rudich 3, Neal

More information

ABSTRACT. Promega Corporation, Updated September 2008. http://www.promega.com/pubhub. 1 Campbell-Staton, S.

ABSTRACT. Promega Corporation, Updated September 2008. http://www.promega.com/pubhub. 1 Campbell-Staton, S. A Modified Wizard SV Genomic DNA Purification System Protocol to Purify Genomic DNA... A Modified Wizard SV Genomic DNA Purification System Protocol to Purify Genomic DNA from Shed Reptile Skin ABSTRACT

More information

Precision TM FAST and Precision TM Mastermix

Precision TM FAST and Precision TM Mastermix Precision TM FAST and Precision TM Mastermix Instructions for use of PrimerDesign Precision TM Mastermix and Precision TM FAST Mastermix MM MasterMix Contents Introduction 3 Kit Contents 5 Recommended

More information

PicoMaxx High Fidelity PCR System

PicoMaxx High Fidelity PCR System PicoMaxx High Fidelity PCR System Instruction Manual Catalog #600420 (100 U), #600422 (500 U), and #600424 (1000 U) Revision B Research Use Only. Not for Use in Diagnostic Procedures. 600420-12 LIMITED

More information