Supporting Information

Transcription

1 Supporting Information Wiley-VCH Weinheim, Germany

2 Blockage of sirna Binding to a p19 Viral Suppressor of RNA Silencing by Cysteine Alkylation Selena M. Sagan, Roger Koukiekolo, Elisabeth Rodgers, Natalie K. Goto, John Paul Pezacki* Codon Optimization of CIRV p19 CIRV p19 codon optimization for mammalian and bacterial expression was done manually using codon usage tables for Homo sapiens and Escherichia coli obtained from the Genbank Codon Usage Database at and the Carnation Italian Ringspot virus genome (Genbank Accession #: NC_35). Chosen codons had a frequency score >1 for both Homo sapiens and Escherichia coli. Sequence of Codon Optimized CIRV p19 [ ] S.M. Sagan, Dr. R. Koukiekolo, E. Rodgers, Prof. J.P. Pezacki, The Steacie Institute for Molecular Sciences, National Research Council of Canada, 1 Sussex Drive, Ottawa, K1A R6 (Canada) Fax: (+1) John.Pezacki@nrc-cnrc.gc.ca [ ] These authors contributed equally to the work. Prof. N.K. Goto, Prof. J.P. Pezacki, Department of Chemistry, University of Ottawa, Ottawa, Canada, K1N 6N5 Selena M. Sagan, Prof. Natalie K. Goto, Prof. John Paul Pezacki, Department of Biochemistry, Microbiology & Immunology/Ottawa Institute of Systems Biology, University of Ottawa, Ottawa, Canada K1H 8M5 1

3 atggaacgcgctatccaaggcaacgacactcgcgaacaagctaacggtgaacgctgggatggcggctccggcggtatcacttctccattcaaactgcctg acgaaagcccaagctggactgagtggcgcctgtataacgatgagaccaattccaatcaagataatccactgggtttcaaggaaagctggggtttcgggaaa gttgtctttaagcgctatctgcgctacgaccgcaccgaagcttccctgcaccgcgtcctgggctcttggaccggcgattccgttaactatgcagcatctcgcttt ctgggtgccaaccaggtcggctgtacctatagcattcgctttcgcggcgttagcgtcaccatttctggcgggtcccgcactctgcagcatctgtgtgagatgg caattcgctctaagcaagaactgctgcagctgaccccagtcgaagtggaaagcaatgtgtcccgcggctgccctgaaggtattgaaaccttcaagaaagaa agcgagtaa sirna Sequences All sirnas were duplex RNA unless indicated and were purchased from Dharmacon (Lafayette, CO). sirna sequences used in this study are as follows: Cy3-GL2 19-nt sirna 5 -Cy3- UACGCGGAAUACUUCGAdTdT-3 ; unlabeled GL2 21-nt sirna 5 - CGUACGCGGAAUACUUCGAdTdT-3 ; Cy3-GL2 21-nt sirna 5 -Cy3- CGUACGCGGAAUACUUCGAdTdT-3 ; Cy3-GL2 21-nt single-stranded sirna 5 -Cy3- CGUACGCGGAAUACUUCGAdTdT-3 ; Cy3-GL2 23-nt sirna 5 -Cy3- CGUACGCGGAAUACUUCGAAAdTdT-3 ; Cy3-GL2 25-nt sirna 5 -Cy3- UCACGUACGCGGAAUACUUCGAAdTdT-3 ; Cy3-GL2 28-nt sirna 5 -Cy3- ACAUCACGUACGCGGAAUACUUCGAAdTdT-3 ; Cy3-GL3 21-nt sirna 5 -Cy3- CUUACGCUGAGUACUUCGAdTdT-3 ; Cy3-CSK-2 21-nt sirna 5 -Cy3- CUACCGCAUCAUGUACCAUdTdT-3 ; Cy nt sirna 5 - GGUCUCGUAGACCGUGCACdTdT-3. 2

4 A 6 Relative fluorescence intensity sirna (nm) 4 21-nt GL2 sirna B Relative fluorescence intensity C sirna (nm) 4 21-nt CSK-2 sirna Relative fluorescence intensity sirna (nm) 4 21-nt 331 sirna Figure S1. Plots of relative fluorescence vs. sirna concentration for: (A) 21-nt GL2 sirna (K d = 74 nm), (B) 21-nt CSK-2 sirna (K d =57 nm), and (C) 21-nt 331 sirna (K d ~ 12 nm). Each point represents the mean fluoresence of three experiments, with the error bars showing the standard deviation from the mean. Curves obtained from fitting these points to Equation [1] to obtain the indicated K d values are also shown. 3

5 A B Figure S2. (A) Fluorescence measurements for the binding activity of GL2 sirna to CIRV p19-h in the presence of a representative sampling of the small molecule library used to identify compounds 1 and 2. Relative reduction in sirna binding by each compound was measured upon addition of 1 µm to a well where sirna was already bound to p19. Each measurement was performed in triplicate. (B) The decrease in fluorescence measured when an equivalent amount of unlabeled sirna (CSK-2) was added to the mixture of p19 bound with labeled sirna (Cy3- CSK-2). Means ± SE are presented (the error bar for Cy3-CSK-2 is too small to be visualized). Screen hits were selected based on statistical analyses of fluorescence intensity differences between compound treated and mock treated wells (each an average of three measurements). Unlabeled sirna that reduces the fluorescence signal by competitive binding to p19 served as a positive control. Two-tailed P-values of t-tests for the screening data were determined and P- values <.5 was set as the threshold for significance. Compounds 1 and 2, corresponding to entries 61 and 67 above, respectively, both showed P-values <.1. 4

6 Figure S3. Concentration-dependent inhibition of the CSK-2 sirna:p19 interaction by compound 1; with 1 added after the saturating amounts of sirna were added to arrayed CIRV p19-h. Log (IC 5 ) = /-.6 M. The curve was determined bit fitting to a sigmoidal dose-response (variable slope) equation. 5

7 Figure S4. Relative fluorescence intensity obtained from N-ethyl maleimide treated and untreated CIRV p19-h binding to fluorescently tagged GL2 21-nt sirna. Each bar represents the average of three measurements with the error provided by the standard deviation from the mean. (The magnitude of the error is too small to be visualized for the N-ethyl maleimide treated samples.) 6

8 A B C Figure S5. MALDI-TOF spectra for p19 treated with compound 1. A) p19 alone; B) p19 treated with a 1:1 molar ratio of 1; inset shows an expanded mass spectrum for p19 treated with a 1:1 ratio of 1. The peak with m/z = corresponds to unmodified p19 and the peak with m/z = corresponds to p19 doubly modified by 1, within experimental error. 7

9 A B Figure S6. MALDI-TOF spectra for p19 treated with compound 3. A) p19 alone; B) p19 treated with 1:1 ratio of 3:p19. The peak with m/z = 4144 in A) corresponds to unmodified p19 and the peak with m/z = corresponds to p19 containing four modifications by 3 (two modifications per p19 monomer), within experimental error. 8