*Corresponding author: Yoshitaka Nishiyama,

Size: px
Start display at page:

Download "*Corresponding author: Yoshitaka Nishiyama, E-mail: nishiyama@molbiol.saitama-u.ac.jp"

Transcription

1 SUPPLEMENTAL DATA Elongation Factor G Is a Critical Target during Oxidative Damage to the Translation System of Escherichia coli Takanori Nagano 1, Kouji Kojima 1,7, Toru Hisabori 2, Hidenori Hayashi 3, Eugene Hayato Morita 4, Takashi Kanamori 5,8, Tomoko Miyagi 5,8, Takuya Ueda 5,8, and Yoshitaka Nishiyama 1,6, * From 1 Department of Biochemistry and Molecular Biology, Graduate School of Science and Engineering, Saitama University, 255 Shimo-Okubo, Sakura-ku, Saitama , Japan; 2 Chemical Resources Laboratory, Tokyo Institute of Technology, 4259 Nagatsuta, Yokohama , Japan; 3 Cell-Free Science and Technology Research Center and Venture Business Laboratory, Ehime University, 3 Bunkyo-cho, Matsuyama , Japan; 4 Department of Bioresources, Faculty of Agriculture, Ehime University, Tarumi, Matsuyama, Ehime , Japan; 5 Department of Medical Genome Sciences, Graduate School of Frontier Sciences, The University of Tokyo, Kashiwanoha, Chiba , Japan; 6 Institute for Environmental Science and Technology, Saitama University, 255 Shimo-Okubo, Sakura-ku, Saitama , Japan *Corresponding author: Yoshitaka Nishiyama, nishiyama@molbiol.saitama-u.ac.jp Present address: 7 Department of Biological Chemistry, Chubu University, 1200 Kasugai , Japan. 8 GeneFrontier Corporation, 308 Todai-Kashiwa Venture Plaza, Kashiwanoha, Kashiwa, Chiba , Japan. EXPERIMENTAL PROCEDURES Circular Dichroism Spectrometry The ultraviolet-circular dichroism (UV-CD) spectra of reduced and oxidized EF-G were obtained with a UV-CD spectrophotometer (J-820; JASCO, Tokyo, Japan), equipped with a temperature control unit (PTC-423L; JASCO). EF-G at 1.6 µm was incubated at 25ºC for 5 min in the presence of 5 mm DTT or 0.5 mm H 2 O 2 prior to the measurement. Measurements were performed at 4ºC with 8 scans. The width of band and the spectral resolution were 1 nm, and the scan speed was 100 nm min -1. LEGENDS TO FIGURES FIGURE S1. Effects of various oxidants on the redox state and the translational activity of wild-type EF-G. Wild-type EF-G (2 µm) was incubated for 10 min in the presence, separately, of 0.5 mm H 2 O 2, 10 µm CuCl 2, and 10 µm Aldrithiol TM -4. EF-G was then subjected to the 1

2 thiol-modification assay (A) and the translational assay (B), as described in the legend to Figure 1. No, No thiol modification; Red, reducing conditions. FIGURE S2. Effects of H 2 O 2 on the secondary structure of wild-type EF-G. The UV-CD spectra of wild-type EF-G (1.6 µm) that had been incubated for 5 min in the presence of 5 mm DTT (blue line) and 0.5 mm H 2 O 2 (red line). FIGURE S3. Mass spectra of tryptic digests of wild-type EF-G. The acquired profiles of wild-type EF-G, which had been incubated with 2 mm H 2 O 2 (A) and 5 mm DTT (B) were focused on mass ranges from to Incubated proteins were digested with trypsin and the resultant peptides were analyzed by MALDI-TOF MS. C, D, and E, Magnified views of the peaks of peptide fragments that contained Cys114, Cys266, and Cys398, respectively. F, Magnified view of the spectrum of the peptide fragments that resulted from the combination of two peptides via formation of a disulfide bond between Cys114 and Cys266. FIGURE S4. Predicted three-dimensional structure of EF-G of E. coli. The crystal structure of EF-G of E. coli, which was bound to the ribosome-recycling factor (RRF), was determined by Yokoyama et al. (19). The structure of EF-G was generated by subtracting the structural information of RRF from that of the EF-G-RRF complex (PDB: 3JOE). The putative positions of three cysteine residues in EF-G are shown in yellow. FIGURE S5. Alignment of the amino acid sequences and locations of cysteine residues in bacterial, chloroplastic and mitochondrial EF-G proteins. Primary amino acid sequences of EF-G were analyzed with the Clustal X software. Amino acid sequences of EF-G from cyanobacteria and Arabidopsis thaliana were obtained from Cyanobase ( and TAIR ( respectively. Other sequences were obtained from UniProtKB/Swiss-Prot ( The organisms examined were as follows: Escherichia coli (ECOLI_P0A6M8, fusa); Synechocystis sp. PCC 6803 (S68_Slr1463); Synechococcus sp. PCC 7942 (S79_Syc0655d); Thermosynechococcus elongatus BP-1 (Tel_Tlr1749); Anabaena sp. PCC 7120 (A71_All4338); Synechococcus sp. WH 8102 (S81_SYNW2137); Gloeobacter violaceus PCC 7421 (GLOVI_Q7NEF2); Prochlorococcus marinus MIT 9313 (PROMM_Q7V501); Salmonella typhi CT18 (SALTY_P0A1H4); Rhodobacter sphaeroides strain ATCC (RHOSP_A4WVL1); Bradyrhizobium japonicum (BRAJA_Q89J81); Bacillus subtilis (BACSU_P80868); Thermus thermophilus (THETH_Q72I01); Arabidopsis thaliana (ARATH_AT1G62750); Glycine max (SOYBN_P34811); Oryza sativa (ORYZA_Q7XQQ7); Homo sapiens (HUMAN_Q8N6D8); Mus musculus (Mouse_Q8K0D5) and Drosophila melanogaster (DROME_Q9VM33). Domains of EF-G are indicated by boxes with names 2

3 at the top. Dark vertical bands in boxes indicate locations of cysteine residues in EF-G. The positions of cysteine residues in EF-G (ECOLI_P0A6M8) are numbered. 3

4

5

6

7

8

Supporting Information

Supporting Information Supporting Information Wiley-VCH 27 69451 Weinheim, Germany Blockage of sirna Binding to a p19 Viral Suppressor of RNA Silencing by Cysteine Alkylation Selena M. Sagan, Roger Koukiekolo, Elisabeth Rodgers,

More information

SpikeTides TM Peptides for relative and absolute quantification in SRM and MRM Assays

SpikeTides TM Peptides for relative and absolute quantification in SRM and MRM Assays Protocol SpikeTides TM Peptides for relative and absolute quantification in SRM and MRM Assays Contact us: InfoLine: +49-30-6392-7878 Order per fax: +49-30-6392-7888 or e-mail: www: peptide@jpt.com www.jpt.com

More information

Quan%ta%ve proteomics. Maarten Altelaar, 2014

Quan%ta%ve proteomics. Maarten Altelaar, 2014 Quan%ta%ve proteomics Maarten Altelaar, 2014 Proteomics Altelaar et al. Nat Rev Gen 14, 2013, 35-48 Quan%ta%ve proteomics Quan%ta%ve proteomics Control Diseased, s%mulated, Knock down, etc. How quan%ta%ve

More information

Peptide Bonds: Structure

Peptide Bonds: Structure Peptide Bonds: Structure Peptide primary structure The amino acid sequence, from - to C-terminus, determines the primary structure of a peptide or protein. The amino acids are linked through amide or peptide

More information

Supporting Information. The G-triplex DNA could function as a new variety of DNA peroxidase

Supporting Information. The G-triplex DNA could function as a new variety of DNA peroxidase Supporting Information The G-triplex DNA could function as a new variety of DNA peroxidase Shaoru Wang +, Boshi Fu +, Shuang Peng, Xiaoe Zhang, Tian Tian*, Xiang Zhou* College of Chemistry and Molecular

More information

Figure 1: Genome sizes of different organisms.

Figure 1: Genome sizes of different organisms. How big are genomes? Genomes are now being sequenced at such a rapid rate that it is fair to say that it is becoming routine. As a result, there is a growing interest in trying to understand the meaning

More information

Thermo Scientific PepFinder Software A New Paradigm for Peptide Mapping

Thermo Scientific PepFinder Software A New Paradigm for Peptide Mapping Thermo Scientific PepFinder Software A New Paradigm for Peptide Mapping For Conclusive Characterization of Biologics Deep Protein Characterization Is Crucial Pharmaceuticals have historically been small

More information

Supporting Information. Minimum active structure of insulin-like. peptide 5 (INSL5)

Supporting Information. Minimum active structure of insulin-like. peptide 5 (INSL5) Supporting Information Minimum active structure of insulin-like peptide 5 (INSL5) Alessia Belgi 1,2, Ross A.D. Bathgate *1,2,3, Martina Kocan *4, Nitin Patil 1,5, Suode Zhang 1, Geoffrey W. Tregear 1,2,

More information

Increasing the Multiplexing of High Resolution Targeted Peptide Quantification Assays

Increasing the Multiplexing of High Resolution Targeted Peptide Quantification Assays Increasing the Multiplexing of High Resolution Targeted Peptide Quantification Assays Scheduled MRM HR Workflow on the TripleTOF Systems Jenny Albanese, Christie Hunter AB SCIEX, USA Targeted quantitative

More information

Definition of the Measurand: CRP

Definition of the Measurand: CRP A Reference Measurement System for C-reactive Protein David M. Bunk, Ph.D. Chemical Science and Technology Laboratory National Institute of Standards and Technology Definition of the Measurand: Human C-reactive

More information

Effects of Intelligent Data Acquisition and Fast Laser Speed on Analysis of Complex Protein Digests

Effects of Intelligent Data Acquisition and Fast Laser Speed on Analysis of Complex Protein Digests Effects of Intelligent Data Acquisition and Fast Laser Speed on Analysis of Complex Protein Digests AB SCIEX TOF/TOF 5800 System with DynamicExit Algorithm and ProteinPilot Software for Robust Protein

More information

Aiping Lu. Key Laboratory of System Biology Chinese Academic Society APLV@sibs.ac.cn

Aiping Lu. Key Laboratory of System Biology Chinese Academic Society APLV@sibs.ac.cn Aiping Lu Key Laboratory of System Biology Chinese Academic Society APLV@sibs.ac.cn Proteome and Proteomics PROTEin complement expressed by genome Marc Wilkins Electrophoresis. 1995. 16(7):1090-4. proteomics

More information

Searching Nucleotide Databases

Searching Nucleotide Databases Searching Nucleotide Databases 1 When we search a nucleic acid databases, Mascot always performs a 6 frame translation on the fly. That is, 3 reading frames from the forward strand and 3 reading frames

More information

DNA Assembly and Enzymatic Cutting in Solutions: A Gold Nanoparticle Based SERS Detection Strategy

DNA Assembly and Enzymatic Cutting in Solutions: A Gold Nanoparticle Based SERS Detection Strategy Supporting Information DNA Assembly and Enzymatic Cutting in Solutions: A Gold Nanoparticle Based SERS Detection Strategy Elizabeth Crew 1, Hong Yan 1, Liqin Lin 1, Jun Yin 1, Zakiya Skeete 1, Timur Kotlyar

More information

PROTEIN SEQUENCING. First Sequence

PROTEIN SEQUENCING. First Sequence PROTEIN SEQUENCING First Sequence The first protein sequencing was achieved by Frederic Sanger in 1953. He determined the amino acid sequence of bovine insulin Sanger was awarded the Nobel Prize in 1958

More information

Global and Discovery Proteomics Lecture Agenda

Global and Discovery Proteomics Lecture Agenda Global and Discovery Proteomics Christine A. Jelinek, Ph.D. Johns Hopkins University School of Medicine Department of Pharmacology and Molecular Sciences Middle Atlantic Mass Spectrometry Laboratory Global

More information

Choices, choices, choices... Which sequence database? Which modifications? What mass tolerance?

Choices, choices, choices... Which sequence database? Which modifications? What mass tolerance? Optimization 1 Choices, choices, choices... Which sequence database? Which modifications? What mass tolerance? Where to begin? 2 Sequence Databases Swiss-prot MSDB, NCBI nr dbest Species specific ORFS

More information

Master course KEMM03 Principles of Mass Spectrometric Protein Characterization. Exam

Master course KEMM03 Principles of Mass Spectrometric Protein Characterization. Exam Exam Master course KEMM03 Principles of Mass Spectrometric Protein Characterization 2010-10-29 kl 08.15-13.00 Use a new paper for answering each question! Write your name on each paper! Aids: Mini calculator,

More information

Error Tolerant Searching of Uninterpreted MS/MS Data

Error Tolerant Searching of Uninterpreted MS/MS Data Error Tolerant Searching of Uninterpreted MS/MS Data 1 In any search of a large LC-MS/MS dataset 2 There are always a number of spectra which get poor scores, or even no match at all. 3 Sometimes, this

More information

Tutorial for Proteomics Data Submission. Katalin F. Medzihradszky Robert J. Chalkley UCSF

Tutorial for Proteomics Data Submission. Katalin F. Medzihradszky Robert J. Chalkley UCSF Tutorial for Proteomics Data Submission Katalin F. Medzihradszky Robert J. Chalkley UCSF Why Have Guidelines? Large-scale proteomics studies create huge amounts of data. It is impossible/impractical to

More information

VTT TECHNICAL RESEARCH CENTRE OF FINLAND

VTT TECHNICAL RESEARCH CENTRE OF FINLAND Figure from: http://www.embl.de/nmr/sattler/teaching Why NMR (instead of X ray crystallography) a great number of macromolecules won't crystallize) natural environmant (water) ligand binding and inter

More information

MASCOT Search Results Interpretation

MASCOT Search Results Interpretation The Mascot protein identification program (Matrix Science, Ltd.) uses statistical methods to assess the validity of a match. MS/MS data is not ideal. That is, there are unassignable peaks (noise) and usually

More information

18.2 Protein Structure and Function: An Overview

18.2 Protein Structure and Function: An Overview 18.2 Protein Structure and Function: An Overview Protein: A large biological molecule made of many amino acids linked together through peptide bonds. Alpha-amino acid: Compound with an amino group bonded

More information

When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want

When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want 1 When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want to search other databases as well. There are very

More information

Nucleic Acid Purity Assessment using A 260 /A 280 Ratios

Nucleic Acid Purity Assessment using A 260 /A 280 Ratios Nucleic Acid Purity Assessment using A 260 /A 280 Ratios A common practice in molecular biology is to perform a quick assessment of the purity of nucleic acid samples by determining the ratio of spectrophotometric

More information

Advantages of the LTQ Orbitrap for Protein Identification in Complex Digests

Advantages of the LTQ Orbitrap for Protein Identification in Complex Digests Application Note: 386 Advantages of the LTQ Orbitrap for Protein Identification in Complex Digests Rosa Viner, Terry Zhang, Scott Peterman, and Vlad Zabrouskov, Thermo Fisher Scientific, San Jose, CA,

More information

Laboration 1. Identifiering av proteiner med Mass Spektrometri. Klinisk Kemisk Diagnostik

Laboration 1. Identifiering av proteiner med Mass Spektrometri. Klinisk Kemisk Diagnostik Laboration 1 Identifiering av proteiner med Mass Spektrometri Klinisk Kemisk Diagnostik Sven Kjellström 2014 kjellstrom.sven@gmail.com 0702-935060 Laboration 1 Klinisk Kemisk Diagnostik Identifiering av

More information

Session 1. Course Presentation: Mass spectrometry-based proteomics for molecular and cellular biologists

Session 1. Course Presentation: Mass spectrometry-based proteomics for molecular and cellular biologists Program Overview Session 1. Course Presentation: Mass spectrometry-based proteomics for molecular and cellular biologists Session 2. Principles of Mass Spectrometry Session 3. Mass spectrometry based proteomics

More information

Application Note # LCMS-81 Introducing New Proteomics Acquisiton Strategies with the compact Towards the Universal Proteomics Acquisition Method

Application Note # LCMS-81 Introducing New Proteomics Acquisiton Strategies with the compact Towards the Universal Proteomics Acquisition Method Application Note # LCMS-81 Introducing New Proteomics Acquisiton Strategies with the compact Towards the Universal Proteomics Acquisition Method Introduction During the last decade, the complexity of samples

More information

Introduction to Genome Annotation

Introduction to Genome Annotation Introduction to Genome Annotation AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT

More information

Methods for Protein Analysis

Methods for Protein Analysis Methods for Protein Analysis 1. Protein Separation Methods The following is a quick review of some common methods used for protein separation: SDS-PAGE (SDS-polyacrylamide gel electrophoresis) separates

More information

Peak intensity Trypsin. Protein Sequence Before trypsin digestion After digestion with trypsin for 24 h digestion

Peak intensity Trypsin. Protein Sequence Before trypsin digestion After digestion with trypsin for 24 h digestion Supplemental table 1. The completeness of trypsin digestion of the signature peptides with native flanking sequence. The signature peptides with native flanking sequence were digested with trypsin as described

More information

LABORATÓRIUMI GYAKORLAT SILLABUSZ SYLLABUS OF A PRACTICAL DEMONSTRATION. financed by the program

LABORATÓRIUMI GYAKORLAT SILLABUSZ SYLLABUS OF A PRACTICAL DEMONSTRATION. financed by the program TÁMOP-4.1.1.C-13/1/KONV-2014-0001 projekt Az élettudományi-klinikai felsőoktatás gyakorlatorientált és hallgatóbarát korszerűsítése a vidéki képzőhelyek nemzetközi versenyképességének erősítésére program

More information

Investigating Biological Variation of Liver Enzymes in Human Hepatocytes

Investigating Biological Variation of Liver Enzymes in Human Hepatocytes Investigating Biological Variation of Liver Enzymes in Human Hepatocytes MS/MS ALL with SWATH Acquisition on the TripleTOF Systems Xu Wang 1, Hui Zhang 2, Christie Hunter 1 1 AB SCIEX, USA, 2 Pfizer, USA

More information

Module 10: Bioinformatics

Module 10: Bioinformatics Module 10: Bioinformatics 1.) Goal: To understand the general approaches for basic in silico (computer) analysis of DNA- and protein sequences. We are going to discuss sequence formatting required prior

More information

An Overview of Cells and Cell Research

An Overview of Cells and Cell Research An Overview of Cells and Cell Research 1 An Overview of Cells and Cell Research Chapter Outline Model Species and Cell types Cell components Tools of Cell Biology Model Species E. Coli: simplest organism

More information

How To Make A Molecular Encoder And Decoder

How To Make A Molecular Encoder And Decoder Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Supporting information Molecular Encoder - Decoder Based on Assembly of Graphene with Dye-labeled

More information

Computational Systems Biology. Lecture 2: Enzymes

Computational Systems Biology. Lecture 2: Enzymes Computational Systems Biology Lecture 2: Enzymes 1 Images from: David L. Nelson, Lehninger Principles of Biochemistry, IV Edition, Freeman ed. or under creative commons license (search for images at http://search.creativecommons.org/)

More information

Workshop IIc. Manual interpretation of MS/MS spectra. Ebbing de Jong. Center for Mass Spectrometry and Proteomics Phone (612)625-2280 (612)625-2279

Workshop IIc. Manual interpretation of MS/MS spectra. Ebbing de Jong. Center for Mass Spectrometry and Proteomics Phone (612)625-2280 (612)625-2279 Workshop IIc Manual interpretation of MS/MS spectra Ebbing de Jong Why MS/MS spectra? The information contained in an MS spectrum (m/z, isotope spacing and therefore z ) is not enough to tell us the amino

More information

M.Sc. in Nano Technology with specialisation in Nano Biotechnology

M.Sc. in Nano Technology with specialisation in Nano Biotechnology M.Sc. in Nano Technology with specialisation in Nano Biotechnology Nanotechnology is all about designing, fabricating and controlling materials, components and machinery with dimensions on the nanoscale,

More information

Shotgun Proteomic Analysis. Department of Cell Biology The Scripps Research Institute

Shotgun Proteomic Analysis. Department of Cell Biology The Scripps Research Institute Shotgun Proteomic Analysis Department of Cell Biology The Scripps Research Institute Biological/Functional Resolution of Experiments Organelle Multiprotein Complex Cells/Tissues Function Expression Analysis

More information

Mass Spectra Alignments and their Significance

Mass Spectra Alignments and their Significance Mass Spectra Alignments and their Significance Sebastian Böcker 1, Hans-Michael altenbach 2 1 Technische Fakultät, Universität Bielefeld 2 NRW Int l Graduate School in Bioinformatics and Genome Research,

More information

Marmara Üniversitesi Fen-Edebiyat Fakültesi Kimya Bölümü / Biyokimya Anabilim Dalı

Marmara Üniversitesi Fen-Edebiyat Fakültesi Kimya Bölümü / Biyokimya Anabilim Dalı EXPERIMENT IX Marmara Üniversitesi DETERMINATION OF N-TERMINAL AMINO ACID RESIDUE OF PROTEINS BY THIN LAYER CHROMATOGRAPHY Functions of the proteins depend upon its amino acid sequence. Because amino acid

More information

DBDB : a Disulfide Bridge DataBase for the predictive analysis of cysteine residues involved in disulfide bridges

DBDB : a Disulfide Bridge DataBase for the predictive analysis of cysteine residues involved in disulfide bridges DBDB : a Disulfide Bridge DataBase for the predictive analysis of cysteine residues involved in disulfide bridges Emmanuel Jaspard Gilles Hunault Jean-Michel Richer Laboratoire PMS UMR A 9, Université

More information

In-Depth Qualitative Analysis of Complex Proteomic Samples Using High Quality MS/MS at Fast Acquisition Rates

In-Depth Qualitative Analysis of Complex Proteomic Samples Using High Quality MS/MS at Fast Acquisition Rates In-Depth Qualitative Analysis of Complex Proteomic Samples Using High Quality MS/MS at Fast Acquisition Rates Using the Explore Workflow on the AB SCIEX TripleTOF 5600 System A major challenge in proteomics

More information

Introduction to Proteomics 1.0

Introduction to Proteomics 1.0 Introduction to Proteomics 1.0 CMSP Workshop Tim Griffin Associate Professor, BMBB Faculty Director, CMSP Objectives Why are we here? For participants: Learn basics of MS-based proteomics Learn what s

More information

FINDING RELATION BETWEEN AGING AND

FINDING RELATION BETWEEN AGING AND FINDING RELATION BETWEEN AGING AND TELOMERE BY APRIORI AND DECISION TREE Jieun Sung 1, Youngshin Joo, and Taeseon Yoon 1 Department of National Science, Hankuk Academy of Foreign Studies, Yong-In, Republic

More information

Human serum albumin (HSA) nanoparticles stabilized with. intermolecular disulfide bonds. Supporting Information

Human serum albumin (HSA) nanoparticles stabilized with. intermolecular disulfide bonds. Supporting Information Human serum albumin (HSA) nanoparticles stabilized with intermolecular disulfide bonds Wentan Wang, Yanbin Huang*, Shufang Zhao, Ting Shao and Yi Cheng* Department of Chemical Engineering, Tsinghua University,

More information

Protein Protein Interactions (PPI) APID (Agile Protein Interaction DataAnalyzer)

Protein Protein Interactions (PPI) APID (Agile Protein Interaction DataAnalyzer) APID (Agile Protein Interaction DataAnalyzer) 23 APID (Agile Protein Interaction DataAnalyzer) Integrates and unifies 7 DBs: BIND, DIP, HPRD, IntAct, MINT, BioGRID. Includes 51,873 proteins 241,204 interactions

More information

Del Giudice Alessandra

Del Giudice Alessandra 1 Del Giudice Alessandra E-mail address: delgiudice.alessandra.a@gmail.com alessandra.delgiudice@uniroma1.it Mobile: +39 327 4566932 Telephone (Home): +39 06 44247472 Personal Information Date of birth:

More information

Effects of Antibiotics on Bacterial Growth and Protein Synthesis: Student Laboratory Manual

Effects of Antibiotics on Bacterial Growth and Protein Synthesis: Student Laboratory Manual Effects of Antibiotics on Bacterial Growth and Protein Synthesis: Student Laboratory Manual I. Purpose...1 II. Introduction...1 III. Inhibition of Bacterial Growth Protocol...2 IV. Inhibition of in vitro

More information

Standard Mixture. TOF/TOF Calibration Mixture. Calibration Mixture 1 (Cal Mix 1, 1:10) Calibration Mixture 1 (Cal Mix 1, 1:100)

Standard Mixture. TOF/TOF Calibration Mixture. Calibration Mixture 1 (Cal Mix 1, 1:10) Calibration Mixture 1 (Cal Mix 1, 1:100) Mass Standards Kit for Calibration of AB SCIEX TOF/TOF Instruments Protocol 1 Product Description The Mass Standards Kit includes reagents needed to test instrument function, optimize instrument parameters,

More information

Integration of data management and analysis for genome research

Integration of data management and analysis for genome research Integration of data management and analysis for genome research Volker Brendel Deparment of Zoology & Genetics and Department of Statistics Iowa State University 2112 Molecular Biology Building Ames, Iowa

More information

Fast and Automatic Mapping of Disulfide Bonds in a Monoclonal Antibody using SYNAPT G2 HDMS and BiopharmaLynx 1.3

Fast and Automatic Mapping of Disulfide Bonds in a Monoclonal Antibody using SYNAPT G2 HDMS and BiopharmaLynx 1.3 Fast and Automatic Mapping of Disulfide Bonds in a Monoclonal Antibody using SYNAPT G2 HDMS and BiopharmaLynx 1.3 Hongwei Xie and Weibin Chen Waters Corporation, Milford, MA, U.S. A P P L I C AT ION B

More information

Ionization of amino acids

Ionization of amino acids Amino Acids 20 common amino acids there are others found naturally but much less frequently Common structure for amino acid COOH, -NH 2, H and R functional groups all attached to the a carbon Ionization

More information

NMR and other Instrumental Techniques in Chemistry and the proposed National Curriculum.

NMR and other Instrumental Techniques in Chemistry and the proposed National Curriculum. NMR and other Instrumental Techniques in Chemistry and the proposed National Curriculum. Dr. John Jackowski Chair of Science, Head of Chemistry Scotch College Melbourne john.jackowski@scotch.vic.edu.au

More information

Human Genome and Human Genome Project. Louxin Zhang

Human Genome and Human Genome Project. Louxin Zhang Human Genome and Human Genome Project Louxin Zhang A Primer to Genomics Cells are the fundamental working units of every living systems. DNA is made of 4 nucleotide bases. The DNA sequence is the particular

More information

Biological Databases and Protein Sequence Analysis

Biological Databases and Protein Sequence Analysis Biological Databases and Protein Sequence Analysis Introduction M. Madan Babu, Center for Biotechnology, Anna University, Chennai 25, India Bioinformatics is the application of Information technology to

More information

1) Technical informations. - a) How does it work? - b) Purification - c) Quality Control. 2) Standard synthesis

1) Technical informations. - a) How does it work? - b) Purification - c) Quality Control. 2) Standard synthesis 1) Technical informations - a) How does it work? - b) Purification - c) Quality Control 2) Standard synthesis - a) Standard peptides - b) Modified peptides - c) Shipment and Delivery Time - d) How to order?

More information

Genome Viewing. Module 2. Using Genome Browsers to View Annotation of the Human Genome

Genome Viewing. Module 2. Using Genome Browsers to View Annotation of the Human Genome Module 2 Genome Viewing Using Genome Browsers to View Annotation of the Human Genome Bert Overduin, Ph.D. PANDA Coordination & Outreach EMBL - European Bioinformatics Institute Wellcome Trust Genome Campus

More information

Sosei acquires Jitsubo, a leading Japanese peptide technology company

Sosei acquires Jitsubo, a leading Japanese peptide technology company Sosei acquires Jitsubo, a leading Japanese peptide technology company Tokyo, Japan 11 December 2014: Sosei Group Corporation ( The Group ; TSE Mothers Index: 4565) is pleased to announce that at the meeting

More information

ProteinPilot Report for ProteinPilot Software

ProteinPilot Report for ProteinPilot Software ProteinPilot Report for ProteinPilot Software Detailed Analysis of Protein Identification / Quantitation Results Automatically Sean L Seymour, Christie Hunter SCIEX, USA Pow erful mass spectrometers like

More information

Introduction to Proteomics

Introduction to Proteomics Introduction to Proteomics Åsa Wheelock, Ph.D. Division of Respiratory Medicine & Karolinska Biomics Center asa.wheelock@ki.se In: Systems Biology and the Omics Cascade, Karolinska Institutet, June 9-13,

More information

The Scheduled MRM Algorithm Enables Intelligent Use of Retention Time During Multiple Reaction Monitoring

The Scheduled MRM Algorithm Enables Intelligent Use of Retention Time During Multiple Reaction Monitoring The Scheduled MRM Algorithm Enables Intelligent Use of Retention Time During Multiple Reaction Monitoring Delivering up to 2500 MRM Transitions per LC Run Christie Hunter 1, Brigitte Simons 2 1 AB SCIEX,

More information

BRENDA Exercises Quick Search

BRENDA Exercises Quick Search BRENDA Exercises Quick Search Exercise 1 How often can you find the term glucosidase in enzyme names? How many EC classes are connected with this term? Exercise 2 How many enzymes accept molybdopterin

More information

Protein Prospector and Ways of Calculating Expectation Values

Protein Prospector and Ways of Calculating Expectation Values Protein Prospector and Ways of Calculating Expectation Values 1/16 Aenoch J. Lynn; Robert J. Chalkley; Peter R. Baker; Mark R. Segal; and Alma L. Burlingame University of California, San Francisco, San

More information

FTIR Analysis of Protein Structure

FTIR Analysis of Protein Structure FTIR Analysis of Protein Structure Warren Gallagher A. Introduction to protein structure The first structures of proteins at an atomic resolution were determined in the late 1950 s. 1 From that time to

More information

Peptide Bond Amino acids are linked together by peptide bonds to form polypepetide chain.

Peptide Bond Amino acids are linked together by peptide bonds to form polypepetide chain. Peptide Bond Peptide Bond Amino acids are linked together by peptide bonds to form polypepetide chain. + H 2 O 2 Peptide bonds are strong and not broken by conditions that denature proteins, such as heating.

More information

Mass Spectrometry Signal Calibration for Protein Quantitation

Mass Spectrometry Signal Calibration for Protein Quantitation Cambridge Isotope Laboratories, Inc. www.isotope.com Proteomics Mass Spectrometry Signal Calibration for Protein Quantitation Michael J. MacCoss, PhD Associate Professor of Genome Sciences University of

More information

Analysis of structural dynamics by H/D-exchange coupled to mass spectrometry HDX-MS

Analysis of structural dynamics by H/D-exchange coupled to mass spectrometry HDX-MS Analysis of structural dynamics by H/D-exchange coupled to mass spectrometry () New Approaches in Drug Design & Discovery 2014 25 th of March 2014 Introduction What are the challenges in structure-based

More information

Accelerated Electrophoresis with Faster Run Times and Increased Sample Throughput

Accelerated Electrophoresis with Faster Run Times and Increased Sample Throughput ELECTROPHORESIS Criterion TGX Precast Gels Get superior results with convenient, fast Criterion TGX gels: Run in as little as min Blot transfer times as short as min Use standard Laemmli buffers and reagents

More information

P i Per Pyrophosphate Assay Kit

P i Per Pyrophosphate Assay Kit P i Per Pyrophosphate Assay Kit Table 1. Contents and storage information. Material Amount Concentration Storage Stability Amplex Red reagent (Component A, MW = 257) 5 vials, 0.26 mg each DMSO, anhydrous

More information

Peptides: Synthesis and Biological Interest

Peptides: Synthesis and Biological Interest Peptides: Synthesis and Biological Interest Therapeutic Agents Therapeutic peptides approved by the FDA (2009-2011) 3 Proteins Biopolymers of α-amino acids. Amino acids are joined by peptide bond. They

More information

PRACTICAL 3: DIGESTIVE ENZYMES, SPECIFICITY AND ph

PRACTICAL 3: DIGESTIVE ENZYMES, SPECIFICITY AND ph PRACTICAL 3: DIGESTIVE ENZYMES, SPECIFICITY AND ph 3.1 Introduction The aims of this practical are: to illustrate the different ph dependence of gastric and pancreatic digestive proteases to illustrate

More information

Lab 2 Biochemistry. Learning Objectives. Introduction. Lipid Structure and Role in Food. The lab has the following learning objectives.

Lab 2 Biochemistry. Learning Objectives. Introduction. Lipid Structure and Role in Food. The lab has the following learning objectives. 1 Lab 2 Biochemistry Learning Objectives The lab has the following learning objectives. Investigate the role of double bonding in fatty acids, through models. Developing a calibration curve for a Benedict

More information

Application Note # MT-90 MALDI-TDS: A Coherent MALDI Top-Down-Sequencing Approach Applied to the ABRF-Protein Research Group Study 2008

Application Note # MT-90 MALDI-TDS: A Coherent MALDI Top-Down-Sequencing Approach Applied to the ABRF-Protein Research Group Study 2008 Bruker Daltonics Application Note # MT-90 MALDI-TDS: A Coherent MALDI Top-Down-Sequencing Approach Applied to the ABRF-Protein Research Group Study 2008 In the ABRF-PRG study 2008 [*] the ability to characterize

More information

Amino Acids. Amino acids are the building blocks of proteins. All AA s have the same basic structure: Side Chain. Alpha Carbon. Carboxyl. Group.

Amino Acids. Amino acids are the building blocks of proteins. All AA s have the same basic structure: Side Chain. Alpha Carbon. Carboxyl. Group. Protein Structure Amino Acids Amino acids are the building blocks of proteins. All AA s have the same basic structure: Side Chain Alpha Carbon Amino Group Carboxyl Group Amino Acid Properties There are

More information

Protease Peptide Microarrays Ready-to-use microarrays for protease profiling

Protease Peptide Microarrays Ready-to-use microarrays for protease profiling Protocol Protease Peptide Microarrays Ready-to-use microarrays for protease profiling Contact us: InfoLine: +49-30-97893-117 Order per fax: +49-30-97893-299 Or e-mail: peptide@jpt.com www: www.jpt.com

More information

Requirement for the Two AhpF Cystine Disulfide Centers in Catalysis of Peroxide Reduction by Alkyl Hydroperoxide Reductase

Requirement for the Two AhpF Cystine Disulfide Centers in Catalysis of Peroxide Reduction by Alkyl Hydroperoxide Reductase Biochemistry 1997, 36, 13357-13364 13357 Requirement for the Two AhpF Cystine Disulfide Centers in Catalysis of Peroxide Reduction by Alkyl Hydroperoxide Reductase Marco Li Calzi and Leslie B. Poole* Department

More information

MRMPilot Software: Accelerating MRM Assay Development for Targeted Quantitative Proteomics

MRMPilot Software: Accelerating MRM Assay Development for Targeted Quantitative Proteomics MRMPilot Software: Accelerating MRM Assay Development for Targeted Quantitative Proteomics With Unique QTRAP and TripleTOF 5600 System Technology Targeted peptide quantification is a rapidly growing application

More information

Quantification of Multiple Therapeutic mabs in Serum Using microlc-esi-q-tof Mass Spectrometry

Quantification of Multiple Therapeutic mabs in Serum Using microlc-esi-q-tof Mass Spectrometry Quantification of Multiple Therapeutic mabs in Serum Using microlc-esi-q-tof Mass Spectrometry Paula Ladwig, David Barnidge, Mindy Kohlhagen, John Mills, Maria Willrich, Melissa R. Snyder and David Murray

More information

Pipe Cleaner Proteins. Essential question: How does the structure of proteins relate to their function in the cell?

Pipe Cleaner Proteins. Essential question: How does the structure of proteins relate to their function in the cell? Pipe Cleaner Proteins GPS: SB1 Students will analyze the nature of the relationships between structures and functions in living cells. Essential question: How does the structure of proteins relate to their

More information

Correlation of the Mass Spectrometric Analysis of Heat-Treated Glutaraldehyde Preparations to Their 235nm / 280 nm UV Absorbance Ratio

Correlation of the Mass Spectrometric Analysis of Heat-Treated Glutaraldehyde Preparations to Their 235nm / 280 nm UV Absorbance Ratio an ABC Laboratories white paper Correlation of the Mass Spectrometric Analysis of Heat-Treated Glutaraldehyde Preparations to Their 235nm / 280 nm UV Absorbance Ratio A. Sen, R. Dunphy, L. Rosik Analytical

More information

Fields of Application / Industry:

Fields of Application / Industry: = Fields of Application / Industry: Chemistry / Polymer Industry Clinical Chemistry / Medicine / Hygiene / Health Care Cosmetics Electronics Energy Environment / Water / Waste Food / Agriculture Geology

More information

A Hybrid Microchip/Capillary Electrophoresis Mass Spectrometry Platform for Rapid and Ultrasensitive Bioanalysis

A Hybrid Microchip/Capillary Electrophoresis Mass Spectrometry Platform for Rapid and Ultrasensitive Bioanalysis A Hybrid Microchip/Capillary Electrophoresis Mass Spectrometry Platform for Rapid and Ultrasensitive Bioanalysis Ryan Kelly 1, Chenchen Wang, Cheng S. Lee, Richard D. Smith, Keqi Tang 1 Environmental Molecular

More information

Enzymes: Amylase Activity in Starch-degrading Soil Isolates

Enzymes: Amylase Activity in Starch-degrading Soil Isolates Enzymes: Amylase Activity in Starch-degrading Soil Isolates Introduction This week you will continue our theme of industrial microbiologist by characterizing the enzyme activity we selected for (starch

More information

Molecular Facts and Figures

Molecular Facts and Figures Nucleic Acids Molecular Facts and Figures DNA/RNA bases: DNA and RNA are composed of four bases each. In DNA the four are Adenine (A), Thymidine (T), Cytosine (C), and Guanine (G). In RNA the four are

More information

Amino Acids, Proteins, and Enzymes. Primary and Secondary Structure Tertiary and Quaternary Structure Protein Hydrolysis and Denaturation

Amino Acids, Proteins, and Enzymes. Primary and Secondary Structure Tertiary and Quaternary Structure Protein Hydrolysis and Denaturation Amino Acids, Proteins, and Enzymes Primary and Secondary Structure Tertiary and Quaternary Structure Protein Hydrolysis and Denaturation 1 Primary Structure of Proteins H 3 N The particular sequence of

More information

Student name ID # 2. (4 pts) What is the terminal electron acceptor in respiration? In photosynthesis? O2, NADP+

Student name ID # 2. (4 pts) What is the terminal electron acceptor in respiration? In photosynthesis? O2, NADP+ 1. Membrane transport. A. (4 pts) What ion couples primary and secondary active transport in animal cells? What ion serves the same function in plant cells? Na+, H+ 2. (4 pts) What is the terminal electron

More information

Enteric Unknowns Miramar College Biology 205 Microbiology

Enteric Unknowns Miramar College Biology 205 Microbiology Enteric Unknowns Miramar College Biology 205 Microbiology Enteric (Greek enteron = intestine) bacteria are comprised of several different genera, but all reside in the digestive tract of mammals. Because

More information

Infrared Spectroscopy 紅 外 線 光 譜 儀

Infrared Spectroscopy 紅 外 線 光 譜 儀 Infrared Spectroscopy 紅 外 線 光 譜 儀 Introduction Spectroscopy is an analytical technique which helps determine structure. It destroys little or no sample (nondestructive method). The amount of light absorbed

More information

PROTEINS THE PEPTIDE BOND. The peptide bond, shown above enclosed in the blue curves, generates the basic structural unit for proteins.

PROTEINS THE PEPTIDE BOND. The peptide bond, shown above enclosed in the blue curves, generates the basic structural unit for proteins. Ca 2+ The contents of this module were developed under grant award # P116B-001338 from the Fund for the Improvement of Postsecondary Education (FIPSE), United States Department of Education. However, those

More information

Chapter 3. Protein Structure and Function

Chapter 3. Protein Structure and Function Chapter 3 Protein Structure and Function Broad functional classes So Proteins have structure and function... Fine! -Why do we care to know more???? Understanding functional architechture gives us POWER

More information

Proteogenomic Analysis of Geobacter Communities during in situ Bioremediation. Presenter: Jill Banfield

Proteogenomic Analysis of Geobacter Communities during in situ Bioremediation. Presenter: Jill Banfield Proteogenomic Analysis of Geobacter Communities during in situ Bioremediation Presenter: Jill Banfield 2007 Proteomic sampling Sampling after acetate was detected in the sampling wells K. Williams, M.

More information

Biochemistry - I. Prof. S. Dasgupta Department of Chemistry Indian Institute of Technology, Kharagpur Lecture-11 Enzyme Mechanisms II

Biochemistry - I. Prof. S. Dasgupta Department of Chemistry Indian Institute of Technology, Kharagpur Lecture-11 Enzyme Mechanisms II Biochemistry - I Prof. S. Dasgupta Department of Chemistry Indian Institute of Technology, Kharagpur Lecture-11 Enzyme Mechanisms II In the last class we studied the enzyme mechanisms of ribonuclease A

More information

Outline. Market & Technology Trends. LifeTein Technology Portfolio. LifeTein Services

Outline. Market & Technology Trends. LifeTein Technology Portfolio. LifeTein Services 1 Outline Market & Technology Trends LifeTein Technology Portfolio LifeTein Services 2 Synthetic Therapeutic Peptides More than 60 synthetic therapeutic peptides under 50 amino acids in size have reached

More information

Protein engineering for structural biology

Protein engineering for structural biology Protein engineering for structural biology J. Michael Sauder, Ph.D. Lilly Biotechnology Center Eli Lilly and Company San Diego, CA 92121 michael.sauder@lilly.com PSDI 2012, Nov 12-13 Structural Biology

More information

AP Biology 2013 Free-Response Questions

AP Biology 2013 Free-Response Questions AP Biology 2013 Free-Response Questions About the College Board The College Board is a mission-driven not-for-profit organization that connects students to college success and opportunity. Founded in 1900,

More information

ProteinScape. Innovation with Integrity. Proteomics Data Analysis & Management. Mass Spectrometry

ProteinScape. Innovation with Integrity. Proteomics Data Analysis & Management. Mass Spectrometry ProteinScape Proteomics Data Analysis & Management Innovation with Integrity Mass Spectrometry ProteinScape a Virtual Environment for Successful Proteomics To overcome the growing complexity of proteomics

More information

Monoclonal Antibody Fragment Separation and Characterization Using Size Exclusion Chromatography Coupled with Mass Spectrometry

Monoclonal Antibody Fragment Separation and Characterization Using Size Exclusion Chromatography Coupled with Mass Spectrometry Monoclonal ntibody Fragment Separation and haracterization Using Size Exclusion hromatography oupled with Mass Spectrometry uthors Haiying hen Katherine McLaughlin Sepax Technologies, Inc. 5 Innovation

More information