*Corresponding author: Yoshitaka Nishiyama,
|
|
- Marion Hunt
- 8 years ago
- Views:
Transcription
1 SUPPLEMENTAL DATA Elongation Factor G Is a Critical Target during Oxidative Damage to the Translation System of Escherichia coli Takanori Nagano 1, Kouji Kojima 1,7, Toru Hisabori 2, Hidenori Hayashi 3, Eugene Hayato Morita 4, Takashi Kanamori 5,8, Tomoko Miyagi 5,8, Takuya Ueda 5,8, and Yoshitaka Nishiyama 1,6, * From 1 Department of Biochemistry and Molecular Biology, Graduate School of Science and Engineering, Saitama University, 255 Shimo-Okubo, Sakura-ku, Saitama , Japan; 2 Chemical Resources Laboratory, Tokyo Institute of Technology, 4259 Nagatsuta, Yokohama , Japan; 3 Cell-Free Science and Technology Research Center and Venture Business Laboratory, Ehime University, 3 Bunkyo-cho, Matsuyama , Japan; 4 Department of Bioresources, Faculty of Agriculture, Ehime University, Tarumi, Matsuyama, Ehime , Japan; 5 Department of Medical Genome Sciences, Graduate School of Frontier Sciences, The University of Tokyo, Kashiwanoha, Chiba , Japan; 6 Institute for Environmental Science and Technology, Saitama University, 255 Shimo-Okubo, Sakura-ku, Saitama , Japan *Corresponding author: Yoshitaka Nishiyama, nishiyama@molbiol.saitama-u.ac.jp Present address: 7 Department of Biological Chemistry, Chubu University, 1200 Kasugai , Japan. 8 GeneFrontier Corporation, 308 Todai-Kashiwa Venture Plaza, Kashiwanoha, Kashiwa, Chiba , Japan. EXPERIMENTAL PROCEDURES Circular Dichroism Spectrometry The ultraviolet-circular dichroism (UV-CD) spectra of reduced and oxidized EF-G were obtained with a UV-CD spectrophotometer (J-820; JASCO, Tokyo, Japan), equipped with a temperature control unit (PTC-423L; JASCO). EF-G at 1.6 µm was incubated at 25ºC for 5 min in the presence of 5 mm DTT or 0.5 mm H 2 O 2 prior to the measurement. Measurements were performed at 4ºC with 8 scans. The width of band and the spectral resolution were 1 nm, and the scan speed was 100 nm min -1. LEGENDS TO FIGURES FIGURE S1. Effects of various oxidants on the redox state and the translational activity of wild-type EF-G. Wild-type EF-G (2 µm) was incubated for 10 min in the presence, separately, of 0.5 mm H 2 O 2, 10 µm CuCl 2, and 10 µm Aldrithiol TM -4. EF-G was then subjected to the 1
2 thiol-modification assay (A) and the translational assay (B), as described in the legend to Figure 1. No, No thiol modification; Red, reducing conditions. FIGURE S2. Effects of H 2 O 2 on the secondary structure of wild-type EF-G. The UV-CD spectra of wild-type EF-G (1.6 µm) that had been incubated for 5 min in the presence of 5 mm DTT (blue line) and 0.5 mm H 2 O 2 (red line). FIGURE S3. Mass spectra of tryptic digests of wild-type EF-G. The acquired profiles of wild-type EF-G, which had been incubated with 2 mm H 2 O 2 (A) and 5 mm DTT (B) were focused on mass ranges from to Incubated proteins were digested with trypsin and the resultant peptides were analyzed by MALDI-TOF MS. C, D, and E, Magnified views of the peaks of peptide fragments that contained Cys114, Cys266, and Cys398, respectively. F, Magnified view of the spectrum of the peptide fragments that resulted from the combination of two peptides via formation of a disulfide bond between Cys114 and Cys266. FIGURE S4. Predicted three-dimensional structure of EF-G of E. coli. The crystal structure of EF-G of E. coli, which was bound to the ribosome-recycling factor (RRF), was determined by Yokoyama et al. (19). The structure of EF-G was generated by subtracting the structural information of RRF from that of the EF-G-RRF complex (PDB: 3JOE). The putative positions of three cysteine residues in EF-G are shown in yellow. FIGURE S5. Alignment of the amino acid sequences and locations of cysteine residues in bacterial, chloroplastic and mitochondrial EF-G proteins. Primary amino acid sequences of EF-G were analyzed with the Clustal X software. Amino acid sequences of EF-G from cyanobacteria and Arabidopsis thaliana were obtained from Cyanobase ( and TAIR ( respectively. Other sequences were obtained from UniProtKB/Swiss-Prot ( The organisms examined were as follows: Escherichia coli (ECOLI_P0A6M8, fusa); Synechocystis sp. PCC 6803 (S68_Slr1463); Synechococcus sp. PCC 7942 (S79_Syc0655d); Thermosynechococcus elongatus BP-1 (Tel_Tlr1749); Anabaena sp. PCC 7120 (A71_All4338); Synechococcus sp. WH 8102 (S81_SYNW2137); Gloeobacter violaceus PCC 7421 (GLOVI_Q7NEF2); Prochlorococcus marinus MIT 9313 (PROMM_Q7V501); Salmonella typhi CT18 (SALTY_P0A1H4); Rhodobacter sphaeroides strain ATCC (RHOSP_A4WVL1); Bradyrhizobium japonicum (BRAJA_Q89J81); Bacillus subtilis (BACSU_P80868); Thermus thermophilus (THETH_Q72I01); Arabidopsis thaliana (ARATH_AT1G62750); Glycine max (SOYBN_P34811); Oryza sativa (ORYZA_Q7XQQ7); Homo sapiens (HUMAN_Q8N6D8); Mus musculus (Mouse_Q8K0D5) and Drosophila melanogaster (DROME_Q9VM33). Domains of EF-G are indicated by boxes with names 2
3 at the top. Dark vertical bands in boxes indicate locations of cysteine residues in EF-G. The positions of cysteine residues in EF-G (ECOLI_P0A6M8) are numbered. 3
4
5
6
7
8
Supporting Information
Supporting Information Wiley-VCH 27 69451 Weinheim, Germany Blockage of sirna Binding to a p19 Viral Suppressor of RNA Silencing by Cysteine Alkylation Selena M. Sagan, Roger Koukiekolo, Elisabeth Rodgers,
More informationSpikeTides TM Peptides for relative and absolute quantification in SRM and MRM Assays
Protocol SpikeTides TM Peptides for relative and absolute quantification in SRM and MRM Assays Contact us: InfoLine: +49-30-6392-7878 Order per fax: +49-30-6392-7888 or e-mail: www: peptide@jpt.com www.jpt.com
More informationQuan%ta%ve proteomics. Maarten Altelaar, 2014
Quan%ta%ve proteomics Maarten Altelaar, 2014 Proteomics Altelaar et al. Nat Rev Gen 14, 2013, 35-48 Quan%ta%ve proteomics Quan%ta%ve proteomics Control Diseased, s%mulated, Knock down, etc. How quan%ta%ve
More informationPeptide Bonds: Structure
Peptide Bonds: Structure Peptide primary structure The amino acid sequence, from - to C-terminus, determines the primary structure of a peptide or protein. The amino acids are linked through amide or peptide
More informationSupporting Information. The G-triplex DNA could function as a new variety of DNA peroxidase
Supporting Information The G-triplex DNA could function as a new variety of DNA peroxidase Shaoru Wang +, Boshi Fu +, Shuang Peng, Xiaoe Zhang, Tian Tian*, Xiang Zhou* College of Chemistry and Molecular
More informationFigure 1: Genome sizes of different organisms.
How big are genomes? Genomes are now being sequenced at such a rapid rate that it is fair to say that it is becoming routine. As a result, there is a growing interest in trying to understand the meaning
More informationThermo Scientific PepFinder Software A New Paradigm for Peptide Mapping
Thermo Scientific PepFinder Software A New Paradigm for Peptide Mapping For Conclusive Characterization of Biologics Deep Protein Characterization Is Crucial Pharmaceuticals have historically been small
More informationSupporting Information. Minimum active structure of insulin-like. peptide 5 (INSL5)
Supporting Information Minimum active structure of insulin-like peptide 5 (INSL5) Alessia Belgi 1,2, Ross A.D. Bathgate *1,2,3, Martina Kocan *4, Nitin Patil 1,5, Suode Zhang 1, Geoffrey W. Tregear 1,2,
More informationIncreasing the Multiplexing of High Resolution Targeted Peptide Quantification Assays
Increasing the Multiplexing of High Resolution Targeted Peptide Quantification Assays Scheduled MRM HR Workflow on the TripleTOF Systems Jenny Albanese, Christie Hunter AB SCIEX, USA Targeted quantitative
More informationDefinition of the Measurand: CRP
A Reference Measurement System for C-reactive Protein David M. Bunk, Ph.D. Chemical Science and Technology Laboratory National Institute of Standards and Technology Definition of the Measurand: Human C-reactive
More informationEffects of Intelligent Data Acquisition and Fast Laser Speed on Analysis of Complex Protein Digests
Effects of Intelligent Data Acquisition and Fast Laser Speed on Analysis of Complex Protein Digests AB SCIEX TOF/TOF 5800 System with DynamicExit Algorithm and ProteinPilot Software for Robust Protein
More informationAiping Lu. Key Laboratory of System Biology Chinese Academic Society APLV@sibs.ac.cn
Aiping Lu Key Laboratory of System Biology Chinese Academic Society APLV@sibs.ac.cn Proteome and Proteomics PROTEin complement expressed by genome Marc Wilkins Electrophoresis. 1995. 16(7):1090-4. proteomics
More informationSearching Nucleotide Databases
Searching Nucleotide Databases 1 When we search a nucleic acid databases, Mascot always performs a 6 frame translation on the fly. That is, 3 reading frames from the forward strand and 3 reading frames
More informationDNA Assembly and Enzymatic Cutting in Solutions: A Gold Nanoparticle Based SERS Detection Strategy
Supporting Information DNA Assembly and Enzymatic Cutting in Solutions: A Gold Nanoparticle Based SERS Detection Strategy Elizabeth Crew 1, Hong Yan 1, Liqin Lin 1, Jun Yin 1, Zakiya Skeete 1, Timur Kotlyar
More informationPROTEIN SEQUENCING. First Sequence
PROTEIN SEQUENCING First Sequence The first protein sequencing was achieved by Frederic Sanger in 1953. He determined the amino acid sequence of bovine insulin Sanger was awarded the Nobel Prize in 1958
More informationGlobal and Discovery Proteomics Lecture Agenda
Global and Discovery Proteomics Christine A. Jelinek, Ph.D. Johns Hopkins University School of Medicine Department of Pharmacology and Molecular Sciences Middle Atlantic Mass Spectrometry Laboratory Global
More informationChoices, choices, choices... Which sequence database? Which modifications? What mass tolerance?
Optimization 1 Choices, choices, choices... Which sequence database? Which modifications? What mass tolerance? Where to begin? 2 Sequence Databases Swiss-prot MSDB, NCBI nr dbest Species specific ORFS
More informationMaster course KEMM03 Principles of Mass Spectrometric Protein Characterization. Exam
Exam Master course KEMM03 Principles of Mass Spectrometric Protein Characterization 2010-10-29 kl 08.15-13.00 Use a new paper for answering each question! Write your name on each paper! Aids: Mini calculator,
More informationError Tolerant Searching of Uninterpreted MS/MS Data
Error Tolerant Searching of Uninterpreted MS/MS Data 1 In any search of a large LC-MS/MS dataset 2 There are always a number of spectra which get poor scores, or even no match at all. 3 Sometimes, this
More informationTutorial for Proteomics Data Submission. Katalin F. Medzihradszky Robert J. Chalkley UCSF
Tutorial for Proteomics Data Submission Katalin F. Medzihradszky Robert J. Chalkley UCSF Why Have Guidelines? Large-scale proteomics studies create huge amounts of data. It is impossible/impractical to
More informationVTT TECHNICAL RESEARCH CENTRE OF FINLAND
Figure from: http://www.embl.de/nmr/sattler/teaching Why NMR (instead of X ray crystallography) a great number of macromolecules won't crystallize) natural environmant (water) ligand binding and inter
More informationMASCOT Search Results Interpretation
The Mascot protein identification program (Matrix Science, Ltd.) uses statistical methods to assess the validity of a match. MS/MS data is not ideal. That is, there are unassignable peaks (noise) and usually
More information18.2 Protein Structure and Function: An Overview
18.2 Protein Structure and Function: An Overview Protein: A large biological molecule made of many amino acids linked together through peptide bonds. Alpha-amino acid: Compound with an amino group bonded
More informationWhen you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want
1 When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want to search other databases as well. There are very
More informationNucleic Acid Purity Assessment using A 260 /A 280 Ratios
Nucleic Acid Purity Assessment using A 260 /A 280 Ratios A common practice in molecular biology is to perform a quick assessment of the purity of nucleic acid samples by determining the ratio of spectrophotometric
More informationAdvantages of the LTQ Orbitrap for Protein Identification in Complex Digests
Application Note: 386 Advantages of the LTQ Orbitrap for Protein Identification in Complex Digests Rosa Viner, Terry Zhang, Scott Peterman, and Vlad Zabrouskov, Thermo Fisher Scientific, San Jose, CA,
More informationLaboration 1. Identifiering av proteiner med Mass Spektrometri. Klinisk Kemisk Diagnostik
Laboration 1 Identifiering av proteiner med Mass Spektrometri Klinisk Kemisk Diagnostik Sven Kjellström 2014 kjellstrom.sven@gmail.com 0702-935060 Laboration 1 Klinisk Kemisk Diagnostik Identifiering av
More informationSession 1. Course Presentation: Mass spectrometry-based proteomics for molecular and cellular biologists
Program Overview Session 1. Course Presentation: Mass spectrometry-based proteomics for molecular and cellular biologists Session 2. Principles of Mass Spectrometry Session 3. Mass spectrometry based proteomics
More informationApplication Note # LCMS-81 Introducing New Proteomics Acquisiton Strategies with the compact Towards the Universal Proteomics Acquisition Method
Application Note # LCMS-81 Introducing New Proteomics Acquisiton Strategies with the compact Towards the Universal Proteomics Acquisition Method Introduction During the last decade, the complexity of samples
More informationIntroduction to Genome Annotation
Introduction to Genome Annotation AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT
More informationMethods for Protein Analysis
Methods for Protein Analysis 1. Protein Separation Methods The following is a quick review of some common methods used for protein separation: SDS-PAGE (SDS-polyacrylamide gel electrophoresis) separates
More informationPeak intensity Trypsin. Protein Sequence Before trypsin digestion After digestion with trypsin for 24 h digestion
Supplemental table 1. The completeness of trypsin digestion of the signature peptides with native flanking sequence. The signature peptides with native flanking sequence were digested with trypsin as described
More informationLABORATÓRIUMI GYAKORLAT SILLABUSZ SYLLABUS OF A PRACTICAL DEMONSTRATION. financed by the program
TÁMOP-4.1.1.C-13/1/KONV-2014-0001 projekt Az élettudományi-klinikai felsőoktatás gyakorlatorientált és hallgatóbarát korszerűsítése a vidéki képzőhelyek nemzetközi versenyképességének erősítésére program
More informationInvestigating Biological Variation of Liver Enzymes in Human Hepatocytes
Investigating Biological Variation of Liver Enzymes in Human Hepatocytes MS/MS ALL with SWATH Acquisition on the TripleTOF Systems Xu Wang 1, Hui Zhang 2, Christie Hunter 1 1 AB SCIEX, USA, 2 Pfizer, USA
More informationModule 10: Bioinformatics
Module 10: Bioinformatics 1.) Goal: To understand the general approaches for basic in silico (computer) analysis of DNA- and protein sequences. We are going to discuss sequence formatting required prior
More informationAn Overview of Cells and Cell Research
An Overview of Cells and Cell Research 1 An Overview of Cells and Cell Research Chapter Outline Model Species and Cell types Cell components Tools of Cell Biology Model Species E. Coli: simplest organism
More informationHow To Make A Molecular Encoder And Decoder
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Supporting information Molecular Encoder - Decoder Based on Assembly of Graphene with Dye-labeled
More informationComputational Systems Biology. Lecture 2: Enzymes
Computational Systems Biology Lecture 2: Enzymes 1 Images from: David L. Nelson, Lehninger Principles of Biochemistry, IV Edition, Freeman ed. or under creative commons license (search for images at http://search.creativecommons.org/)
More informationWorkshop IIc. Manual interpretation of MS/MS spectra. Ebbing de Jong. Center for Mass Spectrometry and Proteomics Phone (612)625-2280 (612)625-2279
Workshop IIc Manual interpretation of MS/MS spectra Ebbing de Jong Why MS/MS spectra? The information contained in an MS spectrum (m/z, isotope spacing and therefore z ) is not enough to tell us the amino
More informationM.Sc. in Nano Technology with specialisation in Nano Biotechnology
M.Sc. in Nano Technology with specialisation in Nano Biotechnology Nanotechnology is all about designing, fabricating and controlling materials, components and machinery with dimensions on the nanoscale,
More informationShotgun Proteomic Analysis. Department of Cell Biology The Scripps Research Institute
Shotgun Proteomic Analysis Department of Cell Biology The Scripps Research Institute Biological/Functional Resolution of Experiments Organelle Multiprotein Complex Cells/Tissues Function Expression Analysis
More informationMass Spectra Alignments and their Significance
Mass Spectra Alignments and their Significance Sebastian Böcker 1, Hans-Michael altenbach 2 1 Technische Fakultät, Universität Bielefeld 2 NRW Int l Graduate School in Bioinformatics and Genome Research,
More informationMarmara Üniversitesi Fen-Edebiyat Fakültesi Kimya Bölümü / Biyokimya Anabilim Dalı
EXPERIMENT IX Marmara Üniversitesi DETERMINATION OF N-TERMINAL AMINO ACID RESIDUE OF PROTEINS BY THIN LAYER CHROMATOGRAPHY Functions of the proteins depend upon its amino acid sequence. Because amino acid
More informationDBDB : a Disulfide Bridge DataBase for the predictive analysis of cysteine residues involved in disulfide bridges
DBDB : a Disulfide Bridge DataBase for the predictive analysis of cysteine residues involved in disulfide bridges Emmanuel Jaspard Gilles Hunault Jean-Michel Richer Laboratoire PMS UMR A 9, Université
More informationIn-Depth Qualitative Analysis of Complex Proteomic Samples Using High Quality MS/MS at Fast Acquisition Rates
In-Depth Qualitative Analysis of Complex Proteomic Samples Using High Quality MS/MS at Fast Acquisition Rates Using the Explore Workflow on the AB SCIEX TripleTOF 5600 System A major challenge in proteomics
More informationIntroduction to Proteomics 1.0
Introduction to Proteomics 1.0 CMSP Workshop Tim Griffin Associate Professor, BMBB Faculty Director, CMSP Objectives Why are we here? For participants: Learn basics of MS-based proteomics Learn what s
More informationFINDING RELATION BETWEEN AGING AND
FINDING RELATION BETWEEN AGING AND TELOMERE BY APRIORI AND DECISION TREE Jieun Sung 1, Youngshin Joo, and Taeseon Yoon 1 Department of National Science, Hankuk Academy of Foreign Studies, Yong-In, Republic
More informationHuman serum albumin (HSA) nanoparticles stabilized with. intermolecular disulfide bonds. Supporting Information
Human serum albumin (HSA) nanoparticles stabilized with intermolecular disulfide bonds Wentan Wang, Yanbin Huang*, Shufang Zhao, Ting Shao and Yi Cheng* Department of Chemical Engineering, Tsinghua University,
More informationProtein Protein Interactions (PPI) APID (Agile Protein Interaction DataAnalyzer)
APID (Agile Protein Interaction DataAnalyzer) 23 APID (Agile Protein Interaction DataAnalyzer) Integrates and unifies 7 DBs: BIND, DIP, HPRD, IntAct, MINT, BioGRID. Includes 51,873 proteins 241,204 interactions
More informationDel Giudice Alessandra
1 Del Giudice Alessandra E-mail address: delgiudice.alessandra.a@gmail.com alessandra.delgiudice@uniroma1.it Mobile: +39 327 4566932 Telephone (Home): +39 06 44247472 Personal Information Date of birth:
More informationEffects of Antibiotics on Bacterial Growth and Protein Synthesis: Student Laboratory Manual
Effects of Antibiotics on Bacterial Growth and Protein Synthesis: Student Laboratory Manual I. Purpose...1 II. Introduction...1 III. Inhibition of Bacterial Growth Protocol...2 IV. Inhibition of in vitro
More informationStandard Mixture. TOF/TOF Calibration Mixture. Calibration Mixture 1 (Cal Mix 1, 1:10) Calibration Mixture 1 (Cal Mix 1, 1:100)
Mass Standards Kit for Calibration of AB SCIEX TOF/TOF Instruments Protocol 1 Product Description The Mass Standards Kit includes reagents needed to test instrument function, optimize instrument parameters,
More informationIntegration of data management and analysis for genome research
Integration of data management and analysis for genome research Volker Brendel Deparment of Zoology & Genetics and Department of Statistics Iowa State University 2112 Molecular Biology Building Ames, Iowa
More informationFast and Automatic Mapping of Disulfide Bonds in a Monoclonal Antibody using SYNAPT G2 HDMS and BiopharmaLynx 1.3
Fast and Automatic Mapping of Disulfide Bonds in a Monoclonal Antibody using SYNAPT G2 HDMS and BiopharmaLynx 1.3 Hongwei Xie and Weibin Chen Waters Corporation, Milford, MA, U.S. A P P L I C AT ION B
More informationIonization of amino acids
Amino Acids 20 common amino acids there are others found naturally but much less frequently Common structure for amino acid COOH, -NH 2, H and R functional groups all attached to the a carbon Ionization
More informationNMR and other Instrumental Techniques in Chemistry and the proposed National Curriculum.
NMR and other Instrumental Techniques in Chemistry and the proposed National Curriculum. Dr. John Jackowski Chair of Science, Head of Chemistry Scotch College Melbourne john.jackowski@scotch.vic.edu.au
More informationHuman Genome and Human Genome Project. Louxin Zhang
Human Genome and Human Genome Project Louxin Zhang A Primer to Genomics Cells are the fundamental working units of every living systems. DNA is made of 4 nucleotide bases. The DNA sequence is the particular
More informationBiological Databases and Protein Sequence Analysis
Biological Databases and Protein Sequence Analysis Introduction M. Madan Babu, Center for Biotechnology, Anna University, Chennai 25, India Bioinformatics is the application of Information technology to
More information1) Technical informations. - a) How does it work? - b) Purification - c) Quality Control. 2) Standard synthesis
1) Technical informations - a) How does it work? - b) Purification - c) Quality Control 2) Standard synthesis - a) Standard peptides - b) Modified peptides - c) Shipment and Delivery Time - d) How to order?
More informationGenome Viewing. Module 2. Using Genome Browsers to View Annotation of the Human Genome
Module 2 Genome Viewing Using Genome Browsers to View Annotation of the Human Genome Bert Overduin, Ph.D. PANDA Coordination & Outreach EMBL - European Bioinformatics Institute Wellcome Trust Genome Campus
More informationSosei acquires Jitsubo, a leading Japanese peptide technology company
Sosei acquires Jitsubo, a leading Japanese peptide technology company Tokyo, Japan 11 December 2014: Sosei Group Corporation ( The Group ; TSE Mothers Index: 4565) is pleased to announce that at the meeting
More informationProteinPilot Report for ProteinPilot Software
ProteinPilot Report for ProteinPilot Software Detailed Analysis of Protein Identification / Quantitation Results Automatically Sean L Seymour, Christie Hunter SCIEX, USA Pow erful mass spectrometers like
More informationIntroduction to Proteomics
Introduction to Proteomics Åsa Wheelock, Ph.D. Division of Respiratory Medicine & Karolinska Biomics Center asa.wheelock@ki.se In: Systems Biology and the Omics Cascade, Karolinska Institutet, June 9-13,
More informationThe Scheduled MRM Algorithm Enables Intelligent Use of Retention Time During Multiple Reaction Monitoring
The Scheduled MRM Algorithm Enables Intelligent Use of Retention Time During Multiple Reaction Monitoring Delivering up to 2500 MRM Transitions per LC Run Christie Hunter 1, Brigitte Simons 2 1 AB SCIEX,
More informationBRENDA Exercises Quick Search
BRENDA Exercises Quick Search Exercise 1 How often can you find the term glucosidase in enzyme names? How many EC classes are connected with this term? Exercise 2 How many enzymes accept molybdopterin
More informationProtein Prospector and Ways of Calculating Expectation Values
Protein Prospector and Ways of Calculating Expectation Values 1/16 Aenoch J. Lynn; Robert J. Chalkley; Peter R. Baker; Mark R. Segal; and Alma L. Burlingame University of California, San Francisco, San
More informationFTIR Analysis of Protein Structure
FTIR Analysis of Protein Structure Warren Gallagher A. Introduction to protein structure The first structures of proteins at an atomic resolution were determined in the late 1950 s. 1 From that time to
More informationPeptide Bond Amino acids are linked together by peptide bonds to form polypepetide chain.
Peptide Bond Peptide Bond Amino acids are linked together by peptide bonds to form polypepetide chain. + H 2 O 2 Peptide bonds are strong and not broken by conditions that denature proteins, such as heating.
More informationMass Spectrometry Signal Calibration for Protein Quantitation
Cambridge Isotope Laboratories, Inc. www.isotope.com Proteomics Mass Spectrometry Signal Calibration for Protein Quantitation Michael J. MacCoss, PhD Associate Professor of Genome Sciences University of
More informationAnalysis of structural dynamics by H/D-exchange coupled to mass spectrometry HDX-MS
Analysis of structural dynamics by H/D-exchange coupled to mass spectrometry () New Approaches in Drug Design & Discovery 2014 25 th of March 2014 Introduction What are the challenges in structure-based
More informationAccelerated Electrophoresis with Faster Run Times and Increased Sample Throughput
ELECTROPHORESIS Criterion TGX Precast Gels Get superior results with convenient, fast Criterion TGX gels: Run in as little as min Blot transfer times as short as min Use standard Laemmli buffers and reagents
More informationP i Per Pyrophosphate Assay Kit
P i Per Pyrophosphate Assay Kit Table 1. Contents and storage information. Material Amount Concentration Storage Stability Amplex Red reagent (Component A, MW = 257) 5 vials, 0.26 mg each DMSO, anhydrous
More informationPeptides: Synthesis and Biological Interest
Peptides: Synthesis and Biological Interest Therapeutic Agents Therapeutic peptides approved by the FDA (2009-2011) 3 Proteins Biopolymers of α-amino acids. Amino acids are joined by peptide bond. They
More informationPRACTICAL 3: DIGESTIVE ENZYMES, SPECIFICITY AND ph
PRACTICAL 3: DIGESTIVE ENZYMES, SPECIFICITY AND ph 3.1 Introduction The aims of this practical are: to illustrate the different ph dependence of gastric and pancreatic digestive proteases to illustrate
More informationLab 2 Biochemistry. Learning Objectives. Introduction. Lipid Structure and Role in Food. The lab has the following learning objectives.
1 Lab 2 Biochemistry Learning Objectives The lab has the following learning objectives. Investigate the role of double bonding in fatty acids, through models. Developing a calibration curve for a Benedict
More informationApplication Note # MT-90 MALDI-TDS: A Coherent MALDI Top-Down-Sequencing Approach Applied to the ABRF-Protein Research Group Study 2008
Bruker Daltonics Application Note # MT-90 MALDI-TDS: A Coherent MALDI Top-Down-Sequencing Approach Applied to the ABRF-Protein Research Group Study 2008 In the ABRF-PRG study 2008 [*] the ability to characterize
More informationAmino Acids. Amino acids are the building blocks of proteins. All AA s have the same basic structure: Side Chain. Alpha Carbon. Carboxyl. Group.
Protein Structure Amino Acids Amino acids are the building blocks of proteins. All AA s have the same basic structure: Side Chain Alpha Carbon Amino Group Carboxyl Group Amino Acid Properties There are
More informationProtease Peptide Microarrays Ready-to-use microarrays for protease profiling
Protocol Protease Peptide Microarrays Ready-to-use microarrays for protease profiling Contact us: InfoLine: +49-30-97893-117 Order per fax: +49-30-97893-299 Or e-mail: peptide@jpt.com www: www.jpt.com
More informationRequirement for the Two AhpF Cystine Disulfide Centers in Catalysis of Peroxide Reduction by Alkyl Hydroperoxide Reductase
Biochemistry 1997, 36, 13357-13364 13357 Requirement for the Two AhpF Cystine Disulfide Centers in Catalysis of Peroxide Reduction by Alkyl Hydroperoxide Reductase Marco Li Calzi and Leslie B. Poole* Department
More informationMRMPilot Software: Accelerating MRM Assay Development for Targeted Quantitative Proteomics
MRMPilot Software: Accelerating MRM Assay Development for Targeted Quantitative Proteomics With Unique QTRAP and TripleTOF 5600 System Technology Targeted peptide quantification is a rapidly growing application
More informationQuantification of Multiple Therapeutic mabs in Serum Using microlc-esi-q-tof Mass Spectrometry
Quantification of Multiple Therapeutic mabs in Serum Using microlc-esi-q-tof Mass Spectrometry Paula Ladwig, David Barnidge, Mindy Kohlhagen, John Mills, Maria Willrich, Melissa R. Snyder and David Murray
More informationPipe Cleaner Proteins. Essential question: How does the structure of proteins relate to their function in the cell?
Pipe Cleaner Proteins GPS: SB1 Students will analyze the nature of the relationships between structures and functions in living cells. Essential question: How does the structure of proteins relate to their
More informationCorrelation of the Mass Spectrometric Analysis of Heat-Treated Glutaraldehyde Preparations to Their 235nm / 280 nm UV Absorbance Ratio
an ABC Laboratories white paper Correlation of the Mass Spectrometric Analysis of Heat-Treated Glutaraldehyde Preparations to Their 235nm / 280 nm UV Absorbance Ratio A. Sen, R. Dunphy, L. Rosik Analytical
More informationFields of Application / Industry:
= Fields of Application / Industry: Chemistry / Polymer Industry Clinical Chemistry / Medicine / Hygiene / Health Care Cosmetics Electronics Energy Environment / Water / Waste Food / Agriculture Geology
More informationA Hybrid Microchip/Capillary Electrophoresis Mass Spectrometry Platform for Rapid and Ultrasensitive Bioanalysis
A Hybrid Microchip/Capillary Electrophoresis Mass Spectrometry Platform for Rapid and Ultrasensitive Bioanalysis Ryan Kelly 1, Chenchen Wang, Cheng S. Lee, Richard D. Smith, Keqi Tang 1 Environmental Molecular
More informationEnzymes: Amylase Activity in Starch-degrading Soil Isolates
Enzymes: Amylase Activity in Starch-degrading Soil Isolates Introduction This week you will continue our theme of industrial microbiologist by characterizing the enzyme activity we selected for (starch
More informationMolecular Facts and Figures
Nucleic Acids Molecular Facts and Figures DNA/RNA bases: DNA and RNA are composed of four bases each. In DNA the four are Adenine (A), Thymidine (T), Cytosine (C), and Guanine (G). In RNA the four are
More informationAmino Acids, Proteins, and Enzymes. Primary and Secondary Structure Tertiary and Quaternary Structure Protein Hydrolysis and Denaturation
Amino Acids, Proteins, and Enzymes Primary and Secondary Structure Tertiary and Quaternary Structure Protein Hydrolysis and Denaturation 1 Primary Structure of Proteins H 3 N The particular sequence of
More informationStudent name ID # 2. (4 pts) What is the terminal electron acceptor in respiration? In photosynthesis? O2, NADP+
1. Membrane transport. A. (4 pts) What ion couples primary and secondary active transport in animal cells? What ion serves the same function in plant cells? Na+, H+ 2. (4 pts) What is the terminal electron
More informationEnteric Unknowns Miramar College Biology 205 Microbiology
Enteric Unknowns Miramar College Biology 205 Microbiology Enteric (Greek enteron = intestine) bacteria are comprised of several different genera, but all reside in the digestive tract of mammals. Because
More informationInfrared Spectroscopy 紅 外 線 光 譜 儀
Infrared Spectroscopy 紅 外 線 光 譜 儀 Introduction Spectroscopy is an analytical technique which helps determine structure. It destroys little or no sample (nondestructive method). The amount of light absorbed
More informationPROTEINS THE PEPTIDE BOND. The peptide bond, shown above enclosed in the blue curves, generates the basic structural unit for proteins.
Ca 2+ The contents of this module were developed under grant award # P116B-001338 from the Fund for the Improvement of Postsecondary Education (FIPSE), United States Department of Education. However, those
More informationChapter 3. Protein Structure and Function
Chapter 3 Protein Structure and Function Broad functional classes So Proteins have structure and function... Fine! -Why do we care to know more???? Understanding functional architechture gives us POWER
More informationProteogenomic Analysis of Geobacter Communities during in situ Bioremediation. Presenter: Jill Banfield
Proteogenomic Analysis of Geobacter Communities during in situ Bioremediation Presenter: Jill Banfield 2007 Proteomic sampling Sampling after acetate was detected in the sampling wells K. Williams, M.
More informationBiochemistry - I. Prof. S. Dasgupta Department of Chemistry Indian Institute of Technology, Kharagpur Lecture-11 Enzyme Mechanisms II
Biochemistry - I Prof. S. Dasgupta Department of Chemistry Indian Institute of Technology, Kharagpur Lecture-11 Enzyme Mechanisms II In the last class we studied the enzyme mechanisms of ribonuclease A
More informationOutline. Market & Technology Trends. LifeTein Technology Portfolio. LifeTein Services
1 Outline Market & Technology Trends LifeTein Technology Portfolio LifeTein Services 2 Synthetic Therapeutic Peptides More than 60 synthetic therapeutic peptides under 50 amino acids in size have reached
More informationProtein engineering for structural biology
Protein engineering for structural biology J. Michael Sauder, Ph.D. Lilly Biotechnology Center Eli Lilly and Company San Diego, CA 92121 michael.sauder@lilly.com PSDI 2012, Nov 12-13 Structural Biology
More informationAP Biology 2013 Free-Response Questions
AP Biology 2013 Free-Response Questions About the College Board The College Board is a mission-driven not-for-profit organization that connects students to college success and opportunity. Founded in 1900,
More informationProteinScape. Innovation with Integrity. Proteomics Data Analysis & Management. Mass Spectrometry
ProteinScape Proteomics Data Analysis & Management Innovation with Integrity Mass Spectrometry ProteinScape a Virtual Environment for Successful Proteomics To overcome the growing complexity of proteomics
More informationMonoclonal Antibody Fragment Separation and Characterization Using Size Exclusion Chromatography Coupled with Mass Spectrometry
Monoclonal ntibody Fragment Separation and haracterization Using Size Exclusion hromatography oupled with Mass Spectrometry uthors Haiying hen Katherine McLaughlin Sepax Technologies, Inc. 5 Innovation
More information